A snp molecular marker related to pig girth trait on pig chromosome 4 and application thereof

By using genome-wide association analysis and genotype filling strategies, we identified SNP molecular markers on pig chromosome 4, designed primer pairs and kits, solved the problem of selecting pig waist circumference traits, and achieved a significant improvement in pig waist circumference traits and increased economic benefits.

CN118516465BActive Publication Date: 2026-04-28SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410624830.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-20
Publication Date
2026-04-28
Estimated Expiration
2044-05-20

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively selecting and improving pig waist circumference traits, resulting in significant losses during pig trimming, which impacts breeding pig prices and corporate economic benefits.

Method used

By using genome-wide association analysis and genotype imputation strategies, we identified SNP molecular markers located on pig chromosome 4, designed primer pairs and kits, and used them to detect and screen pig breeds with large waist circumference, increasing the frequency of dominant alleles generation by generation to improve the pig waist circumference trait.

Benefits of technology

This has enabled efficient and accurate molecular marker-assisted breeding, significantly improving the waist circumference trait in pigs, increasing the economic benefits of breeding pigs, and shortening the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118516465B_ABST
    Figure CN118516465B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology and molecular marker, and particularly relates to a SNP molecular marker related to a pig girth trait on a chromosome 4 of a pig and application thereof. The SNP molecular marker related to the pig girth trait on the chromosome 4, wherein a SNP site corresponds to a T>G mutation at position 122124975 on a chromosome 4 of an international pig reference genome version 11.1, and the polymorphism of the base at the site influences the pig girth trait. The application can increase the frequency of the dominant allele generation by generation by selecting the dominant allele of the SNP, improve the pig girth trait, select the excellent germplasm of the above traits, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of pig breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on pig chromosome 4 that is associated with pig waist circumference and its application. Background Technology

[0002] In my country, pigs are primarily evaluated based on live pig size, making body shape selection particularly important. Existing research has shown a significant positive correlation between body measurements and carcass traits, thus these traits are often considered crucial breeding selection criteria. Furthermore, body measurements are specific indicators of pig conformation and abdominal line, which determine pork value and directly impact the profitability of pig farms' final products. An uneven abdominal line, commonly known as a "big belly," results in excessive fat accumulation in the pig, leading to significant trimming losses and affecting the selling price of breeding pigs, causing substantial economic losses for pig farming enterprises.

[0003] Early research on pig breeding focused primarily on meat yield, meat quality, and body shape, neglecting the selection of body conformation traits such as waist circumference. Furthermore, different regional cooking habits impose varying requirements on waist circumference. Therefore, current pig breeding lacks systematic and detailed research on waist circumference measurement and selection. It is necessary to conduct more detailed measurement and selection of waist circumference phenotypes to meet market demands, identify key molecular markers influencing pig waist circumference, and then utilize molecularly assisted selection strategies to accelerate the genetic progress of pig abdominal circumference traits.

[0004] Genome-wide association studies (GWAS) have become a reliable method for detecting genetic variations associated with target traits. However, marker density is a bottleneck factor affecting the identification of important candidate genetic variations for target traits and statistical power. Even with the continuous decline in the cost of whole-genome sequencing, the cost of whole-genome sequencing of large commercial populations remains high. Therefore, genotype imputation strategies have emerged. This strategy first constructs a reference panel at the whole-genome sequencing level and then imputs low-density genetic markers in the target population, significantly increasing the genetic marker density and thus enhancing statistical efficiency. Genotype imputation technology is an important tool in genome-wide association studies. This technology can accurately predict genotypes of polymorphic sites not covered by microarray design, precisely identify molecular markers affecting pig waist circumference, and thus effectively accelerate the genetic improvement of pig body traits, improving economic benefits. Summary of the Invention

[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 4 of pigs that is associated with the pig waist circumference trait.

[0006] Another object of the present invention is to provide applications of the above-mentioned SNP molecular markers.

[0007] Another object of the present invention is to provide a primer pair and kit for detecting the above-mentioned SNP molecular markers.

[0008] A fourth objective of this invention is to provide applications of the aforementioned primer pairs and reagent kits.

[0009] The fifth objective of this invention is to provide a method for screening pig breeds with large waist circumferences.

[0010] The sixth objective of this invention is to provide a method for genetic improvement of pigs.

[0011] The objective of this invention is achieved through the following technical solution:

[0012] A molecular marker of a SNP located on chromosome 4 of pigs that is associated with the pig waist circumference trait. The SNP site corresponds to the T>G mutation at position 122124975 on chromosome 4 of the International Pig Reference Genome 11.1. The polymorphism of the base at this site affects the pig waist circumference trait.

[0013] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where M in the sequence is T or G;

[0014] The SNP molecular marker is a nucleotide mutation of T123-G123 at position 123 of the sequence marked in SEQ ID NO:1 (corresponding to position 122124975 on chromosome 4 of the International Pig Reference Genome Version 11.1, named g.122124975T>G).

[0015] The aforementioned SNP molecular markers are used in identifying pig waist circumference traits, screening pig breeds with large waist circumferences, or increasing pig waist circumference or in pig genetic breeding.

[0016] The pigs mentioned are Duroc pigs and their synthetic lines;

[0017] The preferred pigs are the S21 Duroc pigs and their synthetic lines;

[0018] A method for detecting waist circumference in pigs includes the following steps:

[0019] The above-mentioned SNP molecular markers on pig chromosome 4 were detected, and it was determined whether the SNP site nucleotide of the SNP molecular marker was T or G.

[0020] The pigs mentioned are Duroc pigs and their synthetic lines;

[0021] The preferred pigs are the S21 Duroc pigs and their synthetic lines;

[0022] A primer pair for detecting the above-mentioned SNP molecular markers, comprising primers P001-F and P001-R, has the following nucleotide sequence:

[0023] P001-F: 5'-AGTTCCATCCATGTTGCTGCAA-3';

[0024] P001-R: 5'-CCGTGAGCTGTGGTGTAGGT-3';

[0025] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primer pairs;

[0026] Application of the primer pairs or kits described herein in identifying traits related to waist circumference in pigs;

[0027] Application of the primer pairs or kits in screening pig breeds with large waist circumference or increasing the waist circumference of pigs;

[0028] Application of the primer pairs or kits in marker-assisted breeding of pigs;

[0029] A method for selecting pig breeds with large waist circumferences or increasing pig waist circumference includes the following steps:

[0030] Detect the above-mentioned SNP molecular markers on pig chromosome 4; based on the SNP molecular markers, cull individuals with the GG genotype and retain individuals with the TT or TG genotypes;

[0031] The detection method includes the following steps:

[0032] (1) Extract genomic DNA from the pigs to be tested;

[0033] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products.

[0034] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0035] (4) Based on the sequencing results, determine the genotype of the SNP molecular markers;

[0036] A method for genetic improvement of pigs, comprising the following steps:

[0037] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig population were identified, and corresponding selections were made based on the molecular markers: breeding pig individuals with the TT or TG genotype at nucleotide locus 122124975 on chromosome 4 of the International Swine Reference Genome Version 11.1 were selected from the core breeding pig population, and breeding pig individuals with the GG genotype at nucleotide locus 122124975 were culled, so as to increase the frequency of the T allele at this locus in each generation, thereby improving the waist circumference trait of offspring pigs;

[0038] The pigs mentioned are Duroc pigs and their synthetic lines;

[0039] The preferred pigs are S21 Duroc pigs and their synthetic lines;

[0040] The present invention has the following advantages and effects compared with the prior art:

[0041] (1) This invention is based on genome-wide association analysis (GWIA) combined with a genome-wide completion strategy to analyze the genetic structure of the waist circumference trait in Duroc pigs, identify the major gene loci controlling the waist circumference trait in Duroc breeding pigs, study and determine the molecular markers affecting pig waist circumference located on the nucleotide sequences of pig chromosome 4, verify their effects on the waist circumference trait, and finally establish an efficient and accurate molecular marker-assisted breeding technology. This technology is applied to the genetic improvement of the waist circumference trait in breeding pigs, using molecular breeding methods to solve the problem of genetic improvement of pig waist circumference, thereby improving the body size of offspring pigs, increasing the economic benefits of enterprises, and enhancing core competitiveness. By selecting the dominant allele of this SNP, the frequency of the dominant allele can be increased generation by generation, improving the waist circumference trait in breeding pigs, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of pig breeding.

[0042] (2) This invention provides a primer pair and kit for detecting SNP molecular markers located on chromosome 4 of pigs that are related to the waist circumference trait. With this primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select for reproductive performance and accelerate the breeding process. Attached Figure Description

[0043] Figure 1 This is a Manhattan plot of genome-wide association analysis (GWAS) of waist circumference traits on chromosome 4 in Duroc pigs of the S21 strain; where: the horizontal axis represents the distribution of chromosome 4 in pigs; the vertical axis represents the statistical significance - logP value.

[0044] Figure 2 This is a phenotypic analysis of waist circumference trait in pigs of different genotypes, where 0.00099, 0.026, and 0.014 are P-values. Detailed Implementation

[0045] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0046] Example 1

[0047] (1) Laboratory animals

[0048] The experimental pig population used in this invention consists of 2,169 purebred S21 Duroc pigs from the pig farming experimental department of Wens Foodstuff Group Co., Ltd., which is the core group of the pig farming division, and the phylogenetic record of the group is detailed.

[0049] The pigs have free access to feed and water, and the feeding method and rearing conditions remain consistent throughout, which is a conventional approach.

[0050] Waist circumference: The vertical circumference measured at the waist (usually below the chest and above the buttocks). Waist circumference phenotype determination is carried out in breeding pigs at the 100±15kg stage. First, the experimental group is fasted for 24 hours. During the measurement, the pigs are placed in a relaxed standing position in a cage. A soft measuring tape is used to measure the waist circumference of the pig from the front edge of the hind legs. The plane of the measuring tape is perpendicular to the ground. The waist circumference phenotype of the individual is obtained by reading the measuring tape.

[0051] (2) Sample collection

[0052] The collected tail and ear tissues from the above-mentioned breeding pigs were soaked in a 75% ethanol solution and stored at -20°C for later use.

[0053] (3) Pig genome 50K SNP genotyping

[0054] Tail or ear tissues were collected from each of 2169 S21 Duroc pigs in the aforementioned resource population. Whole-genome DNA was extracted using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150V for 25 min. The DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device.

[0055] DNA samples were sent to Neogene Biotech (Shanghai) Co., Ltd., where the pig whole genome 50K SNP chip (Illumina, USA) was used to determine the genotype on the Illumina Beadstration platform according to the company's standard procedures, and the genotype data was read using GenomeStudio software.

[0056] Subsequently, genotyping was performed using the Swine Imputation Server (SWIM, website: https: / / swim.scau.pigselection.com / ).

[0057] Quality control was performed on all 50K chip scan genotyping data using PLINK v1.9, removing individuals with a detection rate below 90%, a family Mendelian error rate above 0.1, a minimum allele frequency below 0.05, and a Hardy-Weinberg equilibrium significance level above 10. -6 The SNPs were finally identified. A total of 7,442,761 SNPs were obtained, covering the entire pig genome.

[0058] (4) Genome-wide association analysis (GWAS)

[0059] To eliminate population stratification effects, this invention employs a linear mixed model with single-point regression analysis combined with GWAS analysis using GEMMA software. The stratification effect is corrected for using inter-individual genome similarity in the analytical model. Using the Bonferroni correction method for genome-wide sequence-level SNP data is too stringent and easily overlooks quantitative trait loci with effects; therefore, P < 1 × 10⁻⁶ was determined. -5 The significance threshold for the association between SNPs and waist circumference (significance thresholds at both the genomic and chromosomal levels).

[0060] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It can be seen that in the S21 Duroc pig line, there is a locus on chromosome 4 that significantly affects the waist circumference trait, and the strongest associated SNP is chr4:122124975 (P value 4.48E-06).

[0061] (5) Association analysis of different genotypes and waist circumference phenotype at significant associated loci

[0062] As shown in Table 1, the molecular marker SNP site chr4:122124975 (nucleotide 123 in SEQ NO:1, corresponding to the T>G mutation at position 122124975 on chromosome 4 of the international pig version 11.1 reference base sequence) was significantly associated with the waist circumference trait (P<0.001). This indicates that this molecular marker significantly affects the waist circumference trait in pigs, and the breeding process of the waist circumference trait in pigs can be accelerated by assisted selection at this SNP site.

[0063] In addition, according to Table 1 and Figure 2 It was found that the TT and TG genotypes at the molecular marker SNP locus chr4:122124975T>G had larger waist circumferences than the GG genotype (P<0.05). Specifically, the average waist circumference of TT genotype individuals was 1.17 cm larger than that of GG genotype individuals (P<0.001). Therefore, gradually retaining TT and TG genotypes in breeding pigs to gradually increase the frequency of the T allele at this locus can significantly improve the waist circumference trait in breeding pigs, bringing greater economic benefits to enterprises.

[0064] Table 1. Correlation analysis between molecular marker site chr4:122124975 and waist circumference.

[0065]

[0066] Note: ① Waist circumference results are expressed as mean ± standard deviation (SD); ② *** indicates that the ANOVA results for genotype and waist circumference traits are highly significant (P<0.01).

[0067] Example 2: Target DNA Sequence Amplification and Sequencing

[0068] (1) Primer design

[0069] The DNA sequence of SEQ ID NO:1 on pig chromosome 4 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using the primer design software Primer Premier 6.0. The DNA sequences of the designed primers are shown below:

[0070] Primer P001-F: 5'-AGTTCCATCCATGTTGCTGCAA-3';

[0071] Primer P001-R: 5'-CCGTGAGCTGTGGTGTAGGT-3';

[0072] (2) PCR amplification

[0073] To a 10 μL reaction mixture, add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Tag PCR StanMix with Loading Dye, and 0.3 μL each of primers P001-F and P002-R. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min, followed by 35 cycles of 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 45 s, with a final extension at 72℃ for 5 min.

[0074] (3) DNA sequencing

[0075] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (positive and negative). The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0076]

[0077] Note: M marked in the sequence listing is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The positions of the designed primer sequences are indicated by bolding at the beginning and end of the sequence.

[0078] Example 3: Analysis of the T>G effect of the SNP site chr4:122124975 of the molecular marker.

[0079] This invention provides a SNP marker that can significantly improve the waist circumference trait in Duroc pigs. Using this SNP for marker-assisted selection can greatly influence the breeding process of body shape-related traits in Duroc pigs. Through marker-assisted selection, if this invention successfully breeds all individuals with the GG type molecular marker affecting waist circumference into TT type individuals, the waist circumference of Duroc pigs will increase by 1.17 cm.

[0080] This invention provides a novel molecular marker for molecular-assisted selection of pigs by detecting the mutation site at position 123 of the SEQ ID NO:1 sequence and conducting preliminary association analysis between its genotype and waist circumference.

[0081] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker located on chromosome 4 of pigs and associated with the pig waist circumference trait in identifying the pig waist circumference trait, screening pig breeds with large waist circumference, or in pig waist circumference genetic breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where M is T or G; wherein, the waist circumference of pigs with TT genotype and TG genotype is larger than that of pigs with GG genotype. The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

2. A method for detecting waist circumference traits in pigs, characterized in that... It includes the following steps: The SNP molecular marker described in claim 1 is detected on chromosome 4 of pigs, wherein the SNP site nucleotide of the SNP molecular marker is T or G; wherein pigs with TT genotype and TG genotype have a larger waist circumference than pigs with GG genotype. The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

3. The application of a primer pair or kit for detecting SNP molecular markers located on pig chromosome 4 that are associated with pig waist circumference traits in the identification of pig waist circumference-related traits, characterized in that: The primer pair comprises primers P001-F and P001-R, whose nucleotide sequences are as follows: P001-F: 5'- AGTTCCATCCATGTTGCTGCAA -3'; P001-R: 5'- CCGTGAGCTGTGGTGTAGGT -3'; The kit contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, at this molecular marker, the waist circumference of pigs with TT and TG genotypes is larger than that of pigs with GG genotype; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

4. The application of a primer pair or kit for detecting SNP molecular markers located on pig chromosome 4 that are associated with the pig waist circumference trait in screening pig breeds with large waist circumference, characterized in that: The primer pair comprises primers P001-F and P001-R, whose nucleotide sequences are as follows: P001-F: 5'- AGTTCCATCCATGTTGCTGCAA -3'; P001-R: 5'- CCGTGAGCTGTGGTGTAGGT -3'; The kit contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, at this molecular marker, the waist circumference of pigs with TT and TG genotypes is larger than that of pigs with GG genotype; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

5. The application of a primer pair or kit for detecting SNP molecular markers located on pig chromosome 4 that are associated with the pig waist circumference trait in pig marker-assisted breeding, characterized in that: The primer pair comprises primers P001-F and P001-R, whose nucleotide sequences are as follows: P001-F: 5'- AGTTCCATCCATGTTGCTGCAA -3'; P001-R: 5'- CCGTGAGCTGTGGTGTAGGT -3'; The kit contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, at this molecular marker, the waist circumference of pigs with TT and TG genotypes is larger than that of pigs with GG genotype; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

6. A method for screening pig breeds with large waist circumference, comprising the following steps: Detect the SNP molecular markers described in claim 1 on pig chromosome 4; based on the SNP molecular markers, eliminate individuals with the genotype GG and retain individuals with the genotypes TT and TG; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

7. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers described in claim 1 for the breeding pigs in the core breeding pig population, and make corresponding selections based on the molecular markers: select breeding pig individuals with the SNP molecular markers described in claim 1 as TT or TG genotypes in the core breeding pig population, and eliminate breeding pig individuals with the GG genotype, so as to increase the frequency of the allele T at this locus generation by generation, thereby improving the waist circumference trait of the offspring pigs. The pigs mentioned are the S21 Duroc pigs and their synthetic lines.