At yucca1 gene, expression protein and application of the gene in enhancing potato branching

By overexpressing the AtYUCCA1 gene in potatoes and utilizing strong promoters and Agrobacterium-mediated transformation technology, the branching ability and stolon branching of potatoes were enhanced, solving the problem of insufficient potato yield in existing technologies and achieving high potato yield.

CN118546950BActive Publication Date: 2026-04-24YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410802460.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-20
Publication Date
2026-04-24
Estimated Expiration
2044-06-20

AI Technical Summary

Technical Problem

Existing technologies are insufficient in improving potato branching ability and yield, and there is a lack of effective genetic resources and methods, resulting in potato yields that are below the world average.

Method used

By introducing and overexpressing the AtYUCCA1 gene, using the strong promoter CaMV35S to ensure efficient expression, and combining it with the E9-terminator to terminate transcription, the expression vector pPZP222-AtYUCCA1-mGFP was constructed. Genetic transformation was carried out using Agrobacterium, which significantly enhanced the branching ability and stolon branching of potatoes and promoted the formation of underground tubers.

Benefits of technology

It significantly increased the number of potato branches and stolon branches, improved potato yield, provided high-quality germplasm resources, and has broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118546950B_ABST
    Figure CN118546950B_ABST
Patent Text Reader

Abstract

The application discloses an AtYUCCA1 gene, an expression protein thereof and application of the expression protein in enhancing potato branching, identifies a new gene AtYUCCA1 for enhancing potato branching and tuber number, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The application constructs the AtYUCCA1 into an overexpression vector pPZP222, constructs a recombination vector, transforms the recombination vector into agrobacterium, soaks potato stems in a resuspension solution of the agrobacterium to perform genetic transformation of the potato, and realizes efficient expression in vivo of the potato. The application promotes the growth and development of the potato by overexpressing the AtYUCCA1 in the potato plant. It is found that overexpression of the AtYUCCA1 promotes the branching of the potato, the production of stolon stems and the branching of underground stolon stems, and increases the number of underground tubers of the potato.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the AtYUCCA1 gene and its expressed protein and its application in enhancing potato branching. Background Technology

[0002] The potato (Solanum tuberosum L.) is one of the world's most important food crops, playing a vital role in agricultural production. Its tubers are rich in starch and are a major source of nutrients in people's daily diet. China is the world's largest potato producer, with vast potato-growing areas, but its yield per acre is still below the world average. Therefore, cultivating high-quality, high-yield potato germplasm to increase potato production has enormous production potential. With the rapid increase in potato demand and limited arable land, there is an urgent need to use modern biotechnology to cultivate high-quality, high-yield potato varieties and build a high-quality germplasm resource bank.

[0003] Branching is the core of plant spatial organization. First, branching increases the number of leaves, thereby enhancing photosynthetic capacity and laying the foundation for increased biomass accumulation. Second, branching enables plants to allocate nutrients and water more efficiently, helping to balance the growth of above-ground and below-ground parts. Furthermore, branching can extend the plant's growing season, providing more time for photosynthesis and nutrient accumulation. In agricultural production, optimal branching is associated with increased photosynthetic capacity, improved resource utilization efficiency, and increased yield potential. Controlling plant branching and establishing an "ideal plant type" has become one of the effective means to increase crop yield. For potatoes, branching affects both the above-ground nutrient structure and the formation of underground tubers. Reasonable branching helps to balance nutrient distribution, reduces the burden on individual tubers, and is of great significance for improving tuber quality and commercial value. Potato tubers develop from the swelling at the ends of their runners. Therefore, the number of runners and their branching have a decisive influence on the number of tubers and the final yield. Increased branching of stolons promotes the production of more stolons, thereby increasing the base number of tubers and ultimately improving yield. Therefore, cultivating high-yielding potatoes by increasing branching not only has a sound theoretical basis but is also of great significance for breeding high-quality potato germplasm, increasing potato yield, and maintaining food security. Meanwhile, current technologies typically focus on improving plant stress tolerance to increase crop yield, while neglecting to adequately address improving production efficiency from a developmental perspective. Summary of the Invention

[0004] Purpose of the invention: To address the shortcomings of existing technologies, this invention provides a gene AtYUCCA1 that enhances potato branching, effectively improving the branching ability of potatoes. By increasing branching, high-yield potatoes can be cultivated, high-quality potato germplasm can be developed, and potato yield can be increased.

[0005] This invention also provides the protein and applications of the AtYUCCA1 gene, which enhances potato branching.

[0006] Technical solution: In order to achieve the above objective, the present invention provides a gene AtYUCCA1 that enhances potato branching, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The primer pair used to amplify the AtYUCCA1 gene is SEQ ID NO.2: GCTCGGTACCCGGGGATCCATGGAGTCTCATCCTCACAAC; SEQ ID NO.3: TCTTCTCCTTTACTCATGGGTCGACGCGAGGATTTAGAGGT.

[0008] The protein expressing the AtYUCCA1 gene that enhances potato branching, as described in this invention, has the amino acid sequence shown in SEQ ID NO.4.

[0009] The expression vector of AtYUCCA1, a gene that enhances potato branching, as described in this invention.

[0010] The expression vector is based on the pPZP222 vector plasmid. The pPZP222 vector plasmid is linearized, and the AtYUCCA1 gene is inserted into the linearized pPZP222 to construct the AtYUCCA1 overexpression vector.

[0011] As a preferred method, using the prokaryotic expression vector pPZP222 as the base plasmid, the pPZP222 vector plasmid was linearized by double enzyme digestion at BamHI and PstI sites. The genes AtYUCCA1 and mGFP were then inserted into pPZP222 to construct the AtYUCCA1 expression vector pPZP222-AtYUCCA1-mGFP, where mGFP serves as the fluorescent gene.

[0012] The AtYUCCA1 gene has a constitutive strong promoter CaMV35S assembled at its 5' end and an E9-terminator assembled at its 3' end. The CaMV35S promoter enables efficient expression of the AtYUCCA1 gene in potatoes, while the E9-terminator effectively terminates transcription of the AtYUCCA1 gene in potatoes.

[0013] The expression vector is assembled with LB (T-Border left) and RB (T-Border right) sequences, which enable the AtYUCCA1 gene expression framework and the selection marker gene GmR assembled therein to be integrated into the chromosome of potato recipient cells.

[0014] The host cell for the AtYUCCA1 gene that enhances potato branching described in this invention is preferably Agrobacterium as the starting strain.

[0015] The application of the AtYUCCA1 gene, which enhances potato branching, or the protein, or the vector, or the host cell overexpression described in this invention in enhancing the number of potato branches, promoting stolon production, promoting underground stolon branching, increasing the number of underground potato tubers, and promoting yield.

[0016] The application of the potato branching enhancement gene AtYUCCA1, the protein, the vector, or the host cell described in this invention in the cultivation of potato germplasm with high branching performance and high yield.

[0017] The process of cultivating plants with the AtYUCCA1 gene that enhances potato branching, as described in this invention, is as follows: Using Arabidopsis leaves as material, the AtYUCCA1 gene is cloned. Using a vector preserving a publicly reported sequence as a template, mGFP is cloned. Then, AtYUCCA1 and mGFP are simultaneously constructed into the overexpression vector pPZP222 to obtain a recombinant vector. This recombinant vector is transformed into Agrobacterium, and potato stem segments are then immersed in Agrobacterium resuspension for genetic transformation. Driven by the CaMV35S promoter, AtYUCCA1 can be efficiently expressed in potatoes. This invention significantly enhances the branching ability of potatoes and promotes stolon production and underground stolon branching through overexpression of AtYUCCA1 in potato plants. Furthermore, this invention also found that overexpression of AtYUCCA1 significantly increases the number of underground tubers in potatoes. Therefore, this invention not only provides a reference for improving plant yield but also has broad application prospects in protecting food security.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0019] This invention identifies a novel AtYUCCA1 gene that enhances potato branching ability and promotes crop yield, providing a new gene resource for the molecular genetic improvement of potato branching. Through stem segment transformation and tissue culture experiments, this invention, for the first time, introduced the AtYUCCA1 gene into potato, successfully creating AtYUCCA1 overexpressing lines. Results showed that compared to the wild type, the overexpressing potato lines exhibited significantly enhanced branching ability, increased number of stolons, branching, and a marked increase in tuber production. Therefore, overexpression of the AtYUCCA1 gene to improve plant branching ability and crop yield has potential application value. Thus, the AtYUCCA1 gene in this invention, while increasing potato branching, also improves potato yield and has good application prospects for breeding potato germplasm resources with superior traits. Attached Figure Description

[0020] Figure 1 For cloning the target gene;

[0021] Figure 2 A schematic diagram of the structure of the expression vector pPZP222-AtYUCCA1-mGFP;

[0022] Figure 3 The process of potato genetic transformation of the AtYUCCA1 gene;

[0023] Figure 4 PCR identification of the AtYUCCA1 potato genetic transformation line;

[0024] Figure 5 Phenotypic analysis of the aboveground parts of AtYUCCA1 overexpressing lines;

[0025] Figure 6 Analysis of the underground stolons of AtYUCCA1 overexpressing lines;

[0026] Figure 7 Tuber analysis was performed on AtYUCCA1 overexpression lines;

[0027] Figure 8 Comparison of skin and flesh color of tubers from AtYUCCA1 overexpressing lines. Detailed Implementation

[0028] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0029] All raw materials or reagents used in this invention are commercially available. The carrier pPZP222 is a known carrier. (Trimming of N-glycans by the Golgi-localized α-1,2-mannosidases, MNS1 and MNS2, is crucial for maintaining RSW2 protein abundance during salt stress in Arabidopsis. "Molecular Plant 11.5(2018):678-690.")

[0030] Example 1

[0031] Cloning of AtYUCCA1 and mGFP

[0032] (1) Using Arabidopsis cDNA as a template, amplification primers were designed, with the forward primer (YUCA1F) being 5'-GCTCGGTACCCGGGGATCCATGGAGTCTCATCCTCACAAC-3' and the reverse primer (YUCA1R) being 5'-TCTTCTCCTTTACTCATGGGTCGACGCGAGGATTTAGAGGT-3'.

[0033] (2) PCR amplification.

[0034] The PCR reaction system is as follows:

[0035]

[0036] PCR reaction procedure:

[0037]

[0038] Electrophoresis: The gene amplification products from the PCR instrument are retrieved and spotted onto a 1% agarose gel using an electrophoresis apparatus. After approximately 25 minutes, the gel is removed and observed using an imaging system to obtain the target fragment, such as... Figure 1 As shown, the sequence of the AtYUCCA1 gene was determined by sequencing the PCR product as shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.4.

[0039] (3) Cloning of mGFP sequence: The mGFP sequence was synthesized with reference to the sequence in the NCBI database (GenBank: U87973.1) as a template. Amplification primers were designed using the synthesized mGFP sequence as a template. The forward primer (mGFPF) was 5'-CCCATGAGTAAAGGAGAAGAACT-3', and the reverse primer (mGFPR) was 5'-GATACGAACGAAAGCTCTGCAGTTATTTGTATAGTTCATCCAT-3'.

[0040] (4) PCR amplification.

[0041] The PCR reaction system is as follows:

[0042]

[0043] PCR reaction procedure:

[0044]

[0045] Electrophoresis: The gene amplification products from the PCR instrument are retrieved and spotted onto a 1.5% agarose gel using an electrophoresis apparatus. After approximately 25 minutes, the product is removed and observed using an imaging system to obtain the target fragment, such as... Figure 1 As shown, the PCR product was sequenced, and the mGFP gene sequence was determined to be as shown in SEQ ID NO.5.

[0046] Example 2

[0047] (1) In this experiment, pPZP222 was used as the base plasmid. The pPZP222 vector plasmid (which contains the promoter CAMV35S, the terminator E9-ter, the GmR gene expression cassette, and the LB and RB sequences) was linearized by double enzyme digestion. The enzyme digestion sites were BamHI and PstI. The genes AtYUCCA1 and mGFP were inserted into pPZP222 to construct the AtYUCCA1 expression vector pPZP222-AtYUCCA1-mGFP.

[0048] The enzyme digestion reaction system, enzyme digestion reaction procedure, recombinant reaction system, and recombinant reaction procedure are shown below. Enzyme digestion reaction, agarose gel electrophoresis to observe enzyme digestion bands, and the addition volume of linearized vector and insert fragment are adjusted according to their concentrations. The molar ratio of vector to insert fragment is 1:2. After recombination using recombinase (Nanjing Novizan Biotechnology Co., Ltd., model C112-02-AA), the recombinant product is stored at -20℃ for subsequent transformation of E. coli competent cells.

[0049] Enzyme digestion reaction system:

[0050]

[0051] Enzyme digestion reaction procedure:

[0052]

[0053] The recombination reaction system is as follows:

[0054]

[0055] Recombination reaction procedure

[0056]

[0057] The recombinant product was transformed into competent E. coli cells and cultured.

[0058] (2) Escherichia coli transformation

[0059] Referring to the Trans1-T1 Phage Resistant Chemically Competent Cell product instructions (TransGold, China), the ligated product was mixed with competent cells, and after ice bath, heat shock, and recovery, an appropriate amount was spread on LB plates, the plates were inverted, and cultured overnight at 37°C.

[0060] (3) Positive clone screening and sequencing analysis

[0061] Single colonies were selected from the screening culture plate and inoculated into LB liquid medium. The culture was incubated overnight at 37°C and 230 rpm. The recombinant transformants were directly detected by PCR using the overnight culture as a template.

[0062] Reaction system:

[0063]

[0064] Reaction procedure:

[0065]

[0066] Clones that tested positive by bacterial culture PCR were sent to Sangon Biotech Co., Ltd. (Shanghai) for sequencing and identification.

[0067] The recombinant product was transformed into competent E. coli cells and cultured. Positive clones were detected by PCR, and plasmids were extracted to confirm the successful construction of the AtYUCCA1 overexpression vector, named pPZP222-AtYUCCA1-mGFP. Figure 2As shown, the constructed expression vector assembled a constitutive strong expression promoter CaMV35S at the 5' end of AtYUCCA1 and a terminator E9 at the 3' end. The expression vector also contained a GmR gene expression cassette as a selection marker for transgenic potatoes. Simultaneously, the expression vector was assembled with LB and RB sequences, which facilitated the integration of the gene expression framework and the selection marker gene GmR into the chromosome of the potato recipient cell.

[0068] Example 3

[0069] Genetic transformation of the AtYUCCA1 gene

[0070] 1. Agrobacterium-mediated transformation

[0071] (1) Take 3 μL of the plasmid pPZP222-AtYUCCA1-mGFP that has been sequenced without error, add it to 50 μL of Agrobacterium GV3101 competent cells that have been thawed on ice, and mix slowly with a pipette tip.

[0072] (2) Place a 1.5 mL centrifuge tube containing the competent mixture on ice and incubate for 30 min, then place it in liquid nitrogen and cool for 3 min.

[0073] (3) Transfer the centrifuge tubes to a 37°C metal bath and melt for 5 minutes, then place them on ice and incubate for 2 minutes;

[0074] (4) Add 1 mL of room temperature LB liquid medium to the centrifuge tube, and then place the centrifuge tube in a shaker at 28°C for 2-3 hours;

[0075] (5) Centrifuge at 6000 rpm for 2 min, collect the bacterial cells, discard 800 μL of supernatant, and resuspend the remaining 200 μL of liquid and bacterial cell precipitate.

[0076] (6) Use a pipette tip to draw 100 μL of the suspension and spread it evenly on LB solid medium containing the corresponding resistance. After standing for 20 min, invert the medium in a 28℃ constant temperature incubator and incubate for 48 h until a single colony containing pPZP222-AtYUCCA1-mGFP is obtained.

[0077] 2. Cultivating sterile seedlings

[0078] All sterile potato seedlings were placed at 18-22℃ with 16 hours of light (light intensity of 80-110 μmol / m²). 2 / s), cultured in a dark environment for 8 hours.

[0079] (1) Cultivating test-tube seedlings from sprouted tubers

[0080] a. Cut off the buds on the tuber and rinse with tap water.

[0081] b. First, soak the cut buds in 70% ethanol with 2 drops of Tween 20 for 1 minute, then soak them in 10% Domestos for 15 minutes, rinse them 5 times with sterile water, and finally culture them in BM medium.

[0082] c. Subculture stem segments and shoot tips using 90mm culture dishes or tissue culture flasks containing BM medium.

[0083] (2) Cultivating test-tube seedlings from plants that are growing in a greenhouse.

[0084] a. Select vigorous plants that have not been attacked by pests or diseases, cut off their stem segments and bud tips, and rinse them immediately with tap water.

[0085] b. First, cut the stem segments and bud tips into small segments of 5 to 10 mm, then rinse with 70% ethanol with 2 drops of Tween 20 for 1 min, then soak in 10% Domestos for 15 min, then rinse 5 times with sterile water, and finally culture in BM medium.

[0086] c. Subculture stem segments and shoot tips using 90mm culture dishes or tissue culture flasks containing BM medium.

[0087] 3. Inoculation, transformation and regeneration

[0088] (1) Take leaves or stem segments (excluding axillary buds) about 10 mm long with a cut diameter of not less than 2.5 mm from potato plants that have grown for 3-4 weeks.

[0089] (2) Place the explants (no less than 30) in a pre-culture medium plate and pre-culture for 2 days. (Pre-culture for 2 days can improve transformation and regeneration efficiency).

[0090] (3) Add 1 mL of MS20 resuspended bacterial solution to a 90 mm agar plate, then place the explants into the plate, seal with sealing film, and place in a bacterial constant temperature shaker at 22°C and 50 rpm for 10-45 min for transformation and infection. (The genetic transformation efficiency is higher when the Agrobacterium bacterial solution concentration is OD600 = 0.5-0.8 and the infection time is 5-10 min. When the bacterial solution concentration is too high, the explant wound is prone to blackening, and it is difficult to inhibit the growth of Agrobacterium during the later induction of callus tissue, which easily leads to explant contamination and reduces the genetic transformation rate. Within the bacterial solution concentration range of OD600 = 0.5-0.8, the infection time is shortened accordingly as the bacterial solution concentration increases. Therefore, choosing a lower concentration of OD600 = 0.5 and a longer infection time of 10 min is optimal.)

[0091] (4) Pour the Agrobacterium suspension into a container and inactivate the Agrobacterium.

[0092] (5) Blot the surface moisture of the explants dry with sterile filter paper, then place them on CM medium (30 explants per plate). Seal the plates and incubate at 18-22℃ in low light (light intensity 20 μmol / m²). 2 / s) conversion takes 48 hours.

[0093] (6) The transformed explants were then placed on CMC medium for co-culture, with fewer than 10 explants per plate. After sealing the plates, they were stored at 18-22℃ in a well-lit area (light intensity 80-110 μmol / m²). 2 / s) cultivation.

[0094] (7) After 12 days, the explants in CMC medium were transferred to CMCK medium for further culture.

[0095] (8) Replace the CMCK culture medium every 14 days.

[0096] (9) Callus and shoot clusters appeared after 4 weeks, and then culture continued. When changing to CMCK medium for about the third time, carefully cut off the shoot clusters of about 5-10 mm and place them in SM medium.

[0097] (10) Continue to transfer the explants every 14 days, and cut off the buds that grow into clusters to ensure that each bud develops into a separate plant.

[0098] 4. Select and further grow transgenic clustered buds

[0099] (1) After culturing in SM medium for 14 days, remove the surviving seedlings (i.e. those that have grown roots only from the wounds of the buds). Cut off 10-15 mm bud tips and then place them in fresh SM medium for two screenings.

[0100] (2) When the test-tube seedlings with well-developed root systems have grown to 4-5 stem nodes, wash off the excess agar, then transplant them into 3L flowerpots containing mixed fertilizer and place them in a greenhouse, controlling the temperature at 15-20℃ (light intensity of 150μmol / m²). 2 / s (photoperiod of 16 hours), and keep the soil moist for 2 days.

[0101] (3) If the above steps are carefully followed, the transplant success rate can usually reach 100%. Vigorous plants should be fertilized weekly with liquid fertilizer (1:1:1 N:P:K) during the flowering period. In the end, each plant can usually produce 7-10 tubers.

[0102] (4) The tubers obtained from the transgenic plants can be used to preserve the transgenic lines under low temperature conditions (dark place, 4℃).

[0103] The culture medium used in this embodiment is shown below. Prepare an appropriate volume of culture medium according to experimental needs, dispense it into Durand bottles (blue-mouth bottles), and autoclave at 121°C for 20 minutes. Simultaneously, filter and sterilize the antibiotics. Then, in a clean bench, first add the growth regulator stock solution to the culture medium, and then dispense it into 10 9cm petri dishes or tissue culture flasks.

[0104] Essential plant growth medium (BM): 1×MS basal medium containing vitamins 4.4 g / L (Duchefa product no. MO 22), 20 g / L sucrose, diluted to 1 L with distilled water, and the pH adjusted to 5.8. Add 8.0 g / L agar powder, autoclave, and store at 4℃.

[0105] MS20 medium: also known as liquid BM medium, with the same composition as above, but without agar powder.

[0106] MS20 medium: MS medium supplemented with 20g sucrose; Pre-culture R3B medium formula: MS30 + 2.0mg·L⁻¹ NAA + 1.0mg·L⁻¹ 6-BA;

[0107] Co-culture medium (CM): Add 0.2 mg / L NAA, 0.02 mg / L GA3, 2.5 mg / L zeatin nucleoside (ZR), and 8 g / L agar powder to BM medium.

[0108] First-stage regeneration medium (CMC): Add 500 mg / L of cephalosporin to CM medium (sterilized by filtration; the working concentration of cephalosporin can be adjusted appropriately according to whether it effectively inhibits Agrobacterium, with a minimum of 300 mg / L; a lower concentration of cephalosporin is beneficial to explant differentiation and development, while too high a concentration will lead to browning of the explants).

[0109] Second-stage regeneration medium (CMCK): 0.02 mg / L NAA, 0.02 mg / L GA3, 2 mg / L Thidiazuion (TDZ), and 500 mg / L cephalosporin (sterilized by filtration) were added to BM medium. The resistance was screened and determined to be Gentamicin based on the corresponding resistance of the transformed Agrobacterium.

[0110] Selective medium (SM): Add 500 mg / L of cephalosporin (sterilized by filtration) and 50 mg / L of resistant gentamicin to BM medium.

[0111] LB medium: 10 g / L tryptone; 10 g / L yeast extract; 10 g / L NaCl, pH 7.5; 18 g / L agar powder.

[0112] The genetic transformation flowchart of potatoes is as follows: Figure 3 As shown.

[0113] Example 4

[0114] Potato seedlings that could grow normally in SM medium were selected from Example 3 above. DNA was extracted from the leaves, and the expression of the exogenous gene AtYUCCA1 in the transformed lines was detected. Identification primers were designed, with the forward primer being SEQ ID NO.6: 5'-CCCTGAATATTACCCAAAATACCCT-3' and the reverse primer being SEQ ID NO.7: 5'-CGTGCCGCTTCATATGATCT-3'. The constructed vector served as a positive control, while wild-type potato plants and the reaction system without template were used as negative controls.

[0115] Identification PCR reaction system:

[0116]

[0117] PCR reaction procedure:

[0118]

[0119]

[0120] Depend on Figure 4 It can be seen that obtaining a stable and heritable positive transgenic plant is the AtYUCCA1 overexpressing potato line.

[0121] Example 5

[0122] Phenotypic analysis of aerial parts of AtYUCCA1 overexpressing lines

[0123] AtYUCCA1 overexpression lines OE-2 and OE-4, as well as wild-type potato plants with uniform growth, were selected and transplanted into nutrient pots, one plant per pot. These were placed in a 22℃ light incubator and cultured normally for 16h / 8h (day / night) at 70% relative humidity. Figure 5As shown, after two weeks of culture, both the overexpression lines OE-2 and OE-4 exhibited significant branching. After another four weeks of growth, the production of above-ground stolons was observed in the overexpression lines. In contrast, the wild-type plants at the same stage showed neither branching nor stolon production. Furthermore, statistical analysis revealed that, compared to the wild-type, the overexpression lines had significantly higher plant height, fresh weight, and stem cross-sectional diameter. These results indicate that, compared to the wild-type, the AtYUCCA1 overexpression lines exhibited increased branching and a significantly increased growth rate. This demonstrates that AtYUCCA1 overexpression can significantly increase potato branching, promote stolon production, and enhance plant growth and development.

[0124] Example 6

[0125] Phenotypic analysis of stolon branching in AtYUCCA1 overexpression lines

[0126] The number and branching of runners have a decisive influence on the number of potato tubers. A comparison of the underground runners of 8-week-old wild-type potatoes and the AtYUCCA1 overexpression lines OE-2 and OE-4 showed that the runners of the overexpression lines exhibited significantly more branching than those of the wild-type plants. Figure 6 The results show that the number of underground stolon branches increased in AtYUCCA1 overexpression lines. This indicates that AtYUCCA1 promotes underground stolon branching and has potential value for increasing potato tuber number and yield.

[0127] Example 7

[0128] Analysis of tuber yield in AtYUCCA1 overexpression lines

[0129] Potato is an important food crop, and its tubers are its harvested organs. To further analyze whether the AtYUCCA1 overexpression lines increased tuber production, statistical analysis was performed on the number of stolons and tubers in 8-week-old AtYUCCA1 overexpression lines OE-2 and OE-4, as well as wild-type potatoes. Figure 7 The results showed that, compared with wild-type potatoes, the overexpressing lines had a significantly increased number of underground runners, and the number of tubers in the AtYUCCA1 overexpressing lines was also significantly higher than that in the wild type. These results indicate that AtYUCCA1 overexpression promotes the development of underground runners and tubers in potatoes, and also promotes tuber growth. These beneficial agronomic traits are of great significance for increasing potato yield.

[0130] Example 8

[0131] Comparison of skin and flesh color in tubers of AtYUCCA1 overexpression lines

[0132] The skin and flesh color of potato tubers are of great significance, not only helping to meet market demands for diversified products, but also playing a crucial role in breeding, agricultural production, product quality control, and marketing. Different skin colors (such as white, red, and purple) can satisfy market demands for diversified products. Figure 8 As shown, observations of tubers from 8-week-old AtYUCCA1 overexpressing lines and wild-type tubers revealed that both had a consistent pink skin color. This indicates that AtYUCCA1 expression does not affect the tuber skin color. Similarly, further observation of the flesh color showed that the flesh color of tubers from AtYUCCA1 overexpressing lines and wild-type tubers remained consistent, both being yellow. This consistency demonstrates that although AtYUCCA1 gene overexpression promotes potato branching, runner production, and tuber formation, the skin color and internal flesh color of the tubers remain unchanged.

Claims

1. A method through overexpression AtYUCCA1 Gene or overexpression AtYUCCA1 The application of the gene-encoded protein in increasing potato branching, promoting potato stolon production, promoting underground stolon branching, increasing the number of underground tubers, and promoting potato yield; AtYUCCA1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Contains AtYUCCA1 The application of gene overexpression vectors or host cells containing said overexpression vectors in increasing the number of potato branches, promoting the production of potato stolons, promoting the branching of potato underground stolons, increasing the number of potato underground tubers, and promoting potato yield; AtYUCCA1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the host cell is Agrobacterium as the starting strain.

3. A method through overexpression AtYUCCA1 Gene or overexpression AtYUCCA1 The application of gene-encoded proteins in breeding potato germplasm with high branching performance and high yield; AtYUCCA1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. Contains AtYUCCA1 The application of gene overexpression vectors or host cells containing said overexpression vectors in the cultivation of potato germplasm with high branching performance and high yield; AtYUCCA1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the host cell is Agrobacterium as the starting strain.

5. The application according to any one of claims 1-4, characterized in that, Used to amplify AtYUCCA1 The primer pairs for the gene are SEQ ID NO.2: GCTCGGTACCCGGGGATCCATGGAGTCTCATCCTCACAAC; SEQ ID NO.3: TCTTCTCCTTTACTCATGGGTCGACGCGAGGATTTAGAGGT.

6. The application according to claim 2 or 4, characterized in that, The overexpression vector uses pPZP222 as the base plasmid. The pPZP222 vector plasmid is linearized to express the gene. AtYUCCA1 The linearized pPZP222 was constructed by insertion. AtYUCCA1 Overexpression vector.

7. The application according to claim 6, characterized in that, The gene AtYUCCA1 The 5' end of the gene is assembled with a constitutive strong promoter CaMV35S, in the gene AtYUCCA1 The 3' end is equipped with an E9-terminator.

8. The application according to claim 6, characterized in that, The overexpression vector contains LB and RB sequences, which promote the assembly of genes therein. AtYUCCA1 The expression framework and selection marker GmR gene can be integrated into the chromosome of potato recipient cells.