A Dendrocalamus farinosus CAD gene and its application

Abstract

The present invention discloses a Dendrocalamus farinosus CAD gene and its application, including: the Dendrocalamus farinosus CAD gene is the DfCAD16 gene, and its nucleotide sequence is as shown in SEQ ID NO.1; the amino acid sequence encoded by the DfCAD16 gene is as shown in SEQ ID NO.2; the promoter sequence of the DfCAD16 gene is as shown in SEQ ID NO.3; the coding sequence of the DfCAD16 gene is as shown in SEQ ID NO.4. The present invention discloses a new CAD gene in Dendrocalamus farinosus, named DfCAD16, which is specifically expressed in the vascular tissue of plants, and its expression is proportional to the accumulation of lignin in plants. Heterologous overexpression of DfCAD16 in tobacco can increase the lignin content and the content of G-type lignin monomers in the plant stem, make the plant xylem wider, and the arrangement of the xylem is also more compact. The present invention reveals a key gene that regulates the lignin G / S ratio in the lignin biosynthesis process of Dendrocalamus farinosus, providing an effective way for directional breeding of plant germplasm resources containing high G-type lignin monomers according to industrial needs.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering. More specifically, the present invention relates to a Dendrocalamus farinosus CAD gene and its application. Background Art

[0002] Dendrocalamus farinosus is mainly distributed in Sichuan, Yunnan, Guizhou and other places in China. It is an important raw material in the industries of architecture, papermaking, furniture, and various agroforestry additives and drug production. It is a renewable energy source and an economic bamboo species that can be used for both bamboo shoots and timber in the southwestern region of China.

[0003] Lignin is an important component of the secondary cell wall and also an important secondary metabolite. Entwined with cellulose and hemicellulose, it is the skeleton of plant cells. Lignin provides support and cell hardness during plant growth and development, has a mechanical reinforcement effect on plant cells, can thus resist pests and diseases, defend against biotic and abiotic stresses, and maintain plant cell homeostasis. Therefore, lignin is particularly important during the plant growth and development process. In production and life, due to its very stable chemical structure, it has a wide range of uses: in agroforestry, lignin can be used as fertilizers, pesticide slow-release agents, feed additives, etc.; in the light industry, it can be used as surfactants, dye dispersants, activated carbon, carbon fibers, etc.; in addition, vanillin produced by lignin degradation and modification is a food and daily chemical flavor, a pharmaceutical intermediate, and can be used as an anti-epileptic drug for attention deficit hyperactivity disorder, dizziness, etc. Therefore, increasing the lignin content in plants is of great significance. Lignin is a high-molecular compound formed by the polymerization of G-type lignin monomers, S-type lignin monomers, and H-type lignin monomers. Among them, the proportion of H-type lignin monomers is extremely low, and the function of high-molecular lignin is closely related to the content of G-type lignin and S-type lignin during polymerization. Lignin containing a high S / G ratio is often more easily degraded and modified, which is more important for the drug production, agroforestry additive production, and pulp manufacturing industries. High-molecular lignin with a high proportion of G-type lignin monomers has better rigidity and anti-depolymerization ability, which is more important for the raw material production in the light industry and building materials industries. Therefore, being able to directionally regulate the ratio of G-type and S-type lignin contents in plant high-molecular lignin is of great significance for downstream production.

[0004] Cinnamyl alcohol dehydrogenase (CAD) is the last enzyme in the lignin biosynthesis pathway and the last step in the formation of G-type lignin monomers, S-type lignin monomers, and H-type lignin monomers. Its function is to convert derivatives of cinnamic acid into the corresponding alcohols. Since the CAD gene has a significant impact on the lignin synthesis pathway, it is of great significance to explore the function of the CAD gene in many plants. However, there is currently no relevant research on the CAD gene of Dendrocalamus farinosus. In polyploid plants, due to chromosome doubling and gene duplication, there are often multiple genes encoding the same type of protein, and these proteins have similar and more refined functions. Dendrocalamus farinosus is an autopolyploid hexaploid plant, so there are also multiple genes encoding CAD, and due to the collateral inheritance of genes, they play different roles in different growth and development processes of Dendrocalamus farinosus. Eventually, there are differences in the lignin content in different development processes and different tissues and organs of Dendrocalamus farinosus.

[0005] In summary, the problems existing in the prior art are: the total lignin content in existing plants is low and the ratio of S / G lignin monomers in their materials is difficult to control.

[0006] The difficulty in solving the above technical problems: The lignin content in wood is relatively high, the proportion of G-type lignin monomers in hardwood is high, and the proportion of S-type lignin monomers in softwood is high. However, considering various aspects such as ecology and cost, it is difficult to obtain sufficient raw materials for lignin extraction. And since lignin is a secondary metabolite of plants, it is very difficult to control it by traditional breeding methods. While through the method of molecular directed breeding, the ratio of monomers in lignin can be directionally improved at the molecular level by regulating the expression of catalytic enzyme genes that catalyze different lignin monomers. Summary of the Invention

[0007] One object of the present invention is to solve at least the above problems and / or deficiencies and provide at least the advantages described later.

[0008] To achieve these objects and other advantages of the present invention, a Dendrocalamus farinosus CAD gene is provided. The Dendrocalamus farinosus CAD gene is the DfCAD16 gene, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0009] Preferably, the amino acid sequence encoded by the DfCAD16 gene is as shown in SEQ ID NO.2.

[0010] Preferably, the promoter sequence of the DfCAD16 gene is as shown in SEQ ID NO.3.

[0011] Preferably, the coding sequence of the DfCAD16 gene is as shown in SEQ ID NO.4.

[0012] A recombinant vector, comprising the DfCAD16 gene as described above.

[0013] Preferably, the recombinant vector is pCM1307-flag-DfCAD16.

[0014] An application of the Dendrocalamus farinosus CAD gene as described above in regulating the lignin content of plants.

[0015] An application of the recombinant vector as described above in regulating the lignin content of plants.

[0016] Preferably, the application of the Dendrocalamus farinosus CAD gene or the recombinant vector in regulating the lignin content of plants includes:

[0017] Step 1: Construct the pCM1307-flag-DfCAD16 recombinant vector;

[0018] Step 2: Transform Agrobacterium;

[0019] Step 3: Select the positive strain in Step 2 and infect tobacco by the leaf disc method.

[0020] Preferably, in Step 3, the specific method for infecting tobacco by the leaf disc method is:

[0021] (1) In a laminar flow hood, take 1 mL of the positive strain, add 5 mL of LB (Rif+Kana) liquid medium, and shake at 180 rpm on a shaker at 28 °C for 10 - 16 h;

[0022] (2) Take out the bacterial liquid after shaking for 10 - 16 h, add 100 mL of LB (Rif+Kana) liquid medium, shake at 180 rpm on a shaker at 28 °C for 1 day, wait for OD 600 = 0.3 - 0.6, and let it stand at room temperature for 2 - 3 h;

[0023] (3) Centrifuge at 5000 rpm for 10 min, discard the supernatant, collect the bacterial cells, resuspend the bacterial cells, and let it stand at room temperature in the dark for 2 - 3 h, adjust OD 600 = 0.3 - 0.6 to obtain the infection solution;

[0024] (4) Take tobacco leaves, remove the leaf veins, and cut the leaves into pieces with a size of 0.8 - 1.2 cm 2 , soak and oscillate in the infection solution for 10 min, blot the residual infection solution on the leaves with a sterilized filter paper, place the leaves face up on the co-culture medium, and incubate in the dark at room temperature for 2 days;

[0025] (5) After 2 days, transfer them to the callus induction medium and culture them under the conditions of 25 °C, 16 hours of light and 8 hours of darkness until small pieces of callus grow. Cut off the callus and transfer it to a new callus induction medium, and continue to culture it under the conditions of 25 °C, 16 hours of light and 8 hours of darkness until small buds grow on the callus. Cut out the small buds and place them in the rooting medium. When they grow into seedlings, transplant them into the soil.

[0026] The present invention has at least the following beneficial effects: The present invention discloses a new CAD gene in Bambusa emarginata, named DfCAD16. This gene is specifically expressed in the vascular tissue of plants, and its expression is proportional to the accumulation of lignin in plants. Heterologous overexpression of DfCAD16 in tobacco (Nicotiana tabacum, N.t) can significantly increase the lignin content in the stems of plants, and the proportion of G-type lignin monomers also increases accordingly. Further discovery through tissue section staining and paraffin section of transgenic plants shows that overexpression of DfCAD16 will make the xylem of plants wider and the arrangement of the xylem more compact. The present invention reveals the key gene in the lignin biosynthesis process of Bambusa emarginata, providing a basis for the directional breeding of Bambusa emarginata, and especially providing an effective way for the directional breeding of plant germplasm resources containing high G-type lignin monomers for industrial needs.

[0027] Other advantages, objectives and features of the present invention will be partially reflected by the following description, and partially will also be understood by those skilled in the art through the research and practice of the present invention. Brief Description of the Drawings

[0028] Figure 1 Shows the change in the transcriptional level of DfCAD16 in Bambusa emarginata shoots at different heights in Example 1 of the present invention;

[0029] Figure 2 Shows the tissue and organ specific expression of DfCAD16 in plants in Example 2 of the present invention, A. GUS staining comparison of CK and Promoter DfCAD16 ::GUS positive plants; B. Staining results of CK plants; C. GUS staining results of transgenic tobacco; D. Magnification of the shoot tip part in C; E. Magnification of the root part in C, the scale bars are all 2 cm;

[0030] Figure 3 Shows the verification of transgenic tobacco in Example 3 of the present invention, A. Morphological phenotype analysis of the control and three transgenic tobacco lines; B. Plant heights of the control and three transgenic tobacco lines; C. Relative expression of the DfCAD16 gene in transgenic tobacco.

[0031] Figure 4For the phenotypic verification of transgenic tobacco in Example 3 of the present invention, A. Stems of the control and three transgenic tobacco lines; B. Internode lengths of the stems of the control and three transgenic tobacco lines; C. Number of internodes of the control and three transgenic tobacco lines.

[0032] Figure 5 For the histochemical staining and lignin content of DfCAD16 transgenic tobacco in Example 3 of the present invention, A. Tobacco section, with a scale bar of 5 mm; B. Tobacco section, with a scale bar of 500 μm; C. Paraffin section of tobacco, with a scale bar of 1 mm; D. Lignin content of tobacco; E. Xylem thickness of tobacco; F. Content of G-type lignin monomers in tobacco OX-2; G. Content of S-type lignin monomers in tobacco OX-2.

[0033] Figure 6 Shows the expression of the DfCAD gene family in different parts (A) and different heights (B) of Neosinocalamus affinis.

[0034] Figure 7 For the phylogenetic analysis of the DfCAD gene family, A. Phylogenetic analysis within the DfCAD gene family; B. Interspecific phylogenetic relationship. Detailed implementation mode

[0035] The present invention will be further described in detail below with reference to the accompanying drawings, so that those skilled in the art can implement it according to the text of the specification.

[0036] It should be understood that terms such as "having", "comprising" and "including" used herein do not exclude the presence or addition of one or more other elements or their combinations.

[0037] Based on the genome data of Neosinocalamus affinis and the PFAM database (http: / / pfam.janelia.org / ), the members of the DfCAD family in Neosinocalamus affinis were identified and screened. According to the HMM files (PF08240 and PF00107) of cinnamyl alcohol dehydrogenase CAD, a comparison query was carried out in the genome database of Neosinocalamus affinis, and then the amino acid sequences of the screened genes were submitted to NCBI (https: / / www.ncbi.nlm.nih.gov / ) for domain analysis. Finally, 18 genes encoding CAD in Neosinocalamus affinis were identified and named DfCAD1 to DfCAD18.

[0038] Analysis of the expression levels of DfCAD gene family members: According to the RNA-seq data of Neosinocalamus affinis, in 11 organs of mature bamboo: root (Root), rhizome neck (Rhne), rhizome bud (Rhbud), shoot sheath (ShB), culm sheath (CSh), internode (Inod), node (Node), branch (Branch), lateral bud (Labud), young leaf (Yleaf), and mature leaf (MLeaf), DfCAD4, DfCAD5, DfCAD16, DfCAD17, and DfCAD18 were all continuously highly expressed( Figure 6 A). Among these 5 DfCAD genes, further in the base of shoots at different developmental stages, the expression patterns of DfCAD4 and DfCAD5 were similar, both starting to strongly express after the bamboo shoot grew to 2 m; the expression patterns of DfCAD16 and DfCAD17 were similar, strongly expressing in the late stage of shoot development (4 m - 8 m), among which DfCAD17 reached the peak of expression at 4 m height of the shoot, while the expression level of DfCAD16 continued to increase; the expression pattern of DfCAD18 was opposite to that of the other 4 DfCAD genes, highly expressing in the juvenile stage of the shoot and gradually decreasing with the development of the shoot( Figure 6 B). The expression level results showed that among the members of the Neosinocalamus affinis gene family, each gene might play different roles at different developmental stages, and among them, the expression level of DfCAD16 gradually increased as the bamboo shoot continued to grow.

[0039] Meanwhile, through intragenomic collinearity analysis, we found that there were 4 groups of members in the Neosinocalamus affinis DfCAD gene family with repetitive gene fragments( Figure 7 A), indicating that these genes might come from gene duplication events. The results of the interspecific collinearity event analysis with Phyllostachys edulis showed that DfCAD4, DfCAD5, and DfCAD15 among them had repetitive fragments with PheCAD14 of Phyllostachys edulis; DfCAD9 and DfCAD18 had repetitive fragments with PheCAD11 of Phyllostachys edulis, and they might be orthologous genes( Figure 7 B). The repetitive gene fragments of DfCAD16 and DfCAD7 might be generated from the adaptation to the environment after the species differentiation of Neosinocalamus affinis, and they were paralogous genes, and their encoded products might have functions similar to but different from CAD in plants. Combining the analysis of the expression levels of these genes, DfCAD16 might be of great significance for the growth and development of Neosinocalamus affinis.

[0040] The nucleotide sequence of the DfCAD16 gene in the embodiment of the present invention is shown in SEQ ID NO.1, the amino acid sequence encoded by the DfCAD16 gene is shown in SEQ ID NO.2, the promoter sequence of DfCAD16 is shown in SEQ ID NO.3, and the coding sequence of DfCAD16 is shown in SEQ ID NO.4.

[0041] In the embodiment of the present invention, Dendrocalamus farinosus is from the bamboo planting base at the back mountain of Southwest University of Science and Technology. The bamboo shoots at different heights are 50 cm, 1 m, 2 m, 4 m, and 8 m above the ground when they emerge from the soil.

[0042] Example 1

[0043] Expression analysis of DfCAD16 during the growth process of Dendrocalamus farinosus bamboo shoots

[0044] 1. RNA extraction from the bases of Dendrocalamus farinosus bamboo shoots at different heights

[0045] Sterilize all the tools required before the experiment at 121 °C for 30 minutes. Use RNAiso PLUS (Takara) reagent to extract RNA from the bases of Dendrocalamus farinosus bamboo shoots at different heights (50 cm, 1 m, 2 m, 4 m, 8 m). Reverse transcribe the extracted RNA into cDNA (Vayme) using the First Strand cDNA Synthesis Kit (TIANGEN).

[0046] 2. Real-time fluorescence quantitative PCR experiment (qRT-PCR)

[0047] (1) Primer design

[0048] When designing primers, avoid positions based on conserved domains, and use Tublin as the internal reference primer. The specific primer sequences are shown in Table 1.

[0049] Table 1

[0050] Primer Name Primer Sequence Tublin-F GCCGTGAATCTCATCCCCTT Tublin-R TTGTTCTTGGCATCCCACAT DfCAD16qRT-F GTAGTGTAACTGGAGGTA DfCAD16qRT-R GTTGATGTAGTCTATCTTGA

[0051] (2) The DfCAD16 qRT-PCR reaction system is shown in Table 2.

[0052] Table 2

[0053]

[0054]

[0055] (3) DfCAD16 qRT-PCR reaction procedure: 95 °C for 3 min, 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1.5 min, 30 cycles, 72 °C for 10 min. After the program is completed, store at 4 °C.

[0056] The experimental data are the average values of 3 biological replicates, and significant analysis is performed by t-test. "*" represents p < 0.05, with significant differences; "***" represents p < 0.01, with extremely significant differences. The results are as follows Figure 1As shown, it can be seen that the transcriptional level of DfCAD16 begins to increase when the bamboo shoot grows to 2 m, and the transcriptional level increases the fastest between 2 m and 4 m of bamboo shoot growth, and it is continuously induced by the height growth of the bamboo shoot. When the bamboo shoot grows to 8 m, it reaches more than 4 times the transcriptional level at 50 cm above the ground when it just emerges, indicating that along with the growth of the bamboo shoot of Dendrocalamus farinosus, the demand for DfCAD16 also increases.

[0057] Example 2

[0058] Cloning and specific expression analysis of the DfCAD16 promoter (Promoter DfCAD16 )

[0059] 1. Extraction of Dendrocalamus farinosus genome

[0060] (1) Take one-year-old bamboo leaves of Dendrocalamus farinosus and place them in a 1.5 mL centrifuge tube, and quickly put them into liquid nitrogen;

[0061] (2) Preheat 2X CTAB in a 65 °C water bath;

[0062] (3) Grind the sample in a mortar and add the preheated CTAB;

[0063] (4) Incubate in a 65 °C water bath for 25 min, centrifuge at 12000 rpm for 5 min, aspirate the supernatant and place it in a new 1.5 mL EP tube;

[0064] (5) Add an equal volume of chloroform mixture, mix well, centrifuge at 12000 rpm for 5 min, and aspirate the supernatant into a new 1.5 mL tube;

[0065] (6) Add an equal volume of isopropanol, let it stand at room temperature for 30 min, and centrifuge at 12000 rpm for 5 min;

[0066] (7) Remove the supernatant, wash the DNA with 75% ethanol, and centrifuge at 12000 rpm for 5 min;

[0067] (8) Dissolve the obtained DNA with ddH2O and store it at -20 °C;

[0068] 2. Amplification of the DfCAD16 promoter of Dendrocalamus farinosus

[0069] (1) Using the extracted Dendrocalamus farinosus genome as a template, perform PCR amplification, and the primers are shown in Table 3;

[0070] Table 3

[0071]

[0072]

[0073] (2) PromoterDfCAD16 The promoter amplification reaction system is shown in Table 4 as follows:

[0074] Table 4

[0075] TaKaRa LA MIX 25μL PromoterDfCAD16-F 1μL PromoterDfCAD16-R 1μL DNA 2μL <![CDATA[RNase-Free ddH2O]]> Make up to 50μL

[0076] (3) Promoter DfCAD16 The promoter amplification reaction procedure is as follows: 95°C for 3 min, 95°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 30 cycles, 72°C for 10 min. After the program is completed, control the temperature at 4°C for storage;

[0077] (4) Promoter DfCAD16 Recovery of PCR products: After the electrophoresis of the PCR products is completed, cut the tape of the target band and use the TIANGEN purification and recovery kit to recover the target band.

[0078] 3. pMD19-T-Promoter DfCAD16 Vector construction

[0079] (1) Mix evenly according to the connection system in Table 5, put it into a PCR instrument, and connect at 22°C for 30 min;

[0080] Table 5

[0081] <![CDATA[10X T4 DNA ligase]]> 1μL <![CDATA[T4 ligase]]> 1μL <![CDATA[Promoter DfCAD16 Recycled product]]> 6μL pMD19-T vector (10ng / μL) 2μL

[0082] (2) Add the ligation product to the competent cells of DH5α Escherichia coli, mix well, and immediately place it on ice for 30 min;

[0083] (3) Heat shock at 42°C for 3 min, immediately place it on ice, and incubate on ice for 5 min;

[0084] (4) Add 600 μL of LB liquid medium in a laminar flow hood, put it into a shaker, and incubate at 37°C and 180 rpm for 3 h;

[0085] (5) In a laminar flow hood, pipette 500 μL of the bacterial solution and spread it evenly on the LB solid medium, and culture overnight;

[0086] (6) Colony PCR identification: Select 10 visible colonies from the LB solid medium, add LB liquid medium in a laminar flow hood, shake in a shaker at 37°C for 2 h until it becomes visibly turbid, then perform bacterial solution PCR identification. After identifying the positive ones, send them to a sequencing company for sequencing. Compare the sequencing results with the target sequence, and the vector with consistent sequences is the successfully constructed pMD19-T-Promoter DfCAD16 The bacterial solution PCR reaction system is shown in Table 6, and the bacterial solution PCR reaction procedure is the same as the promoter amplification reaction procedure.

[0087] Table 6

[0088] TaKaRa LA MIX 10μL PromoterDfCAD16-F 0.5μL PromoterDfCAD16-R 0.5μL Bacterial solution 1μL <![CDATA[RNase-Free ddH2O]]> Make up to 20μL

[0089] 4. Bambusa emarginata Promoter DfCAD16 GUS staining analysis of transgenic positive plants

[0090] (1) Use the Snapgene bioinformatics software to query available restriction enzyme sites, amplify using the pMD19-T-Promoter DfCAD16 plasmid as a template, purify the PCR product, after purification, perform double digestion on the product with the empty pBI121-GUS (pGUS). After digestion is complete, purify the product, ligate the two digested products obtained at 22°C for 2 h, after ligation, transfer them into DH5α Escherichia coli competent cells, perform colony PCR verification, extract the positive plasmid and perform digestion verification, transfer the successfully verified plasmid into Agrobacterium for genetic transformation, and genetically transform it into Nicotiana benthamiana; the specific amplification primers are shown in Table 7;

[0091] Table 7

[0092] Primer Name Primer Sequence GUS-PromterDfCAD16-F CCCAAGCTTtccgccatccctaccactt GUS-PromterDfCAD16-R CGCGGATCCagcagcccatgccaaataaact

[0093] (2) The subcloning reaction system of pGUS-Promoter DfCAD16 is shown in Table 8;

[0094] Table 8

[0095] TaKaRa LA MIX 25μL GUS-PromterDfCAD16-F 1μL GUS-PromterDfCAD16-R 1μL <![CDATA[PMD19-T-Promoter DfCAD16 > 2μL <![CDATA[ddH2O]]> Make up to 50μL

[0096] (3) The subcloning reaction procedure of pGUS-Promoter DfCAD16 is: 95°C for 3 min, 95°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 30 cycles, 72°C for 10 min, after the program is completed, keep the temperature at 4°C for storage;

[0097] (4) The subcloning digestion reaction system of Promoter is shown in Table 9; DfCAD16 Table 9

[0098] Table 9

[0099] HindIII 2μL BamHI 2μL <![CDATA[Promoter DfCAD16 Purified product]]> 30μL 10X Enzyme digestion Buffer 5μL <![CDATA[ddH2O]]> Make up to 50μL

[0100] (5) The pGUS digestion reaction system is shown in Table 10;

[0101] Table 10

[0102] HindIII 2μL BamHI 2μL pGUS empty vector 20μL 10X Enzyme digestion Buffer 5μL <![CDATA[RNase-Free ddH2O]]> Make up to 50μL

[0103] (6) Promoter DfCAD16The ligation system of the subcloned and recovered product with pGUS is shown in Table 11;

[0104] Table 11

[0105] <![CDATA[10X T4 DNA ligase]]> 1μL <![CDATA[T4 ligase]]> 1μL <![CDATA[Promoter DfCAD16 Subcloned and recovered product]]> 30μL pGUS vector (10ng / μL) 10μL <![CDATA[ddH2O]]> Make up to 50μL

[0106] (7) pGUS - Promoter DfCAD16 The enzyme digestion verification reaction system is shown in Table 12;

[0107] Table 12

[0108] HindIII 2μL BamHI 2μL <![CDATA[pGUS-Promoter DfCAD16 > 10μL 10X Enzyme digestion Buffer 5μL <![CDATA[ddH2O]]> Make up to 50μL

[0109] (8) pGUS - Promoter DfCAD16 Agrobacterium tumefaciens EHA105 genetic transformation: Take out the Agrobacterium competent cells from -80°C, place them on ice to dissolve, add 2 μL of plasmid, and mix well; then immediately place them on ice for 10 min, quick-freeze them in liquid nitrogen for 2 min, incubate them in a 37°C water bath for 5 min, add LB (Rif) liquid medium in a laminar flow hood, shake them in a shaker at 28°C for about 3 h until it becomes visibly turbid, aspirate 500 μL, spread it evenly on the LB (Rif + Kana) solid medium, and incubate it upside down at 28°C for 2 - 3 days; Select 4 visibly visible colonies from the LB (Rif + Kana) solid medium, add LB (Rif + Kana) liquid medium in a laminar flow hood, shake them in a shaker at 28°C at 180 rpm for 3 h. When it becomes visibly turbid, perform colony PCR identification. After identifying the positive ones, add glycerol to preserve the positive strains; Among them, the Agrobacterium colony PCR reaction program is the same as the amplification program, and the Agrobacterium colony PCR reaction system is shown in Table 13;

[0110] Table 13

[0111] TaKaRa LA MIX 25μL GUS-PromterDfCAD16-F 1μL GUS-PromterDfCAD16-R 1μL Bacterial solution 2μL <![CDATA[ddH2O]]> Make up to 50μL

[0112] 5. pGUS - Promoter DfCAD16 Infection of tobacco by the leaf disc method

[0113] (1) In a laminar flow hood, take 1 mL of the positive strain, add 5 mL of LB (Rif + Kana) liquid medium, and shake it in a shaker at 28°C at 180 rpm for 12 h;

[0114] (2) Take out the shaken bacterial liquid for 12 h, add 100 mL of LB (Rif + Kana) liquid medium, shake it in a shaker at 28°C at 180 rpm for 1 day, wait for OD 600 = 0.5, and let it stand at room temperature for 3 h;

[0115] (3) Centrifuge at 5000 rpm for 10 min, discard the supernatant, collect the thalli, resuspend the thalli with sterile MS0 liquid medium (containing 100 μmol / L AS), and let it stand for 2 h at room temperature in the dark. Adjust OD 600 = 0.5 to obtain the infection solution;

[0116] (4) Remove the veins from the tobacco leaves, cut the leaves into pieces of 1 cm 2 in size, soak them in the infection solution with shaking for 10 min, blot the residual infection solution on the leaves with sterile filter paper, place the leaves face up on the co-culture medium, and culture them in the dark at room temperature for 2 days;

[0117] (5) After 2 days, transfer them to the callus induction medium, culture them at 25 °C under the conditions of 16 h light and 8 h darkness until small pieces of callus grow out, cut off the callus and transfer it to a new callus induction medium, continue to culture it at 25 °C under the conditions of 16 h light and 8 h darkness until small buds grow out from the callus, cut out the small buds, place them in the rooting medium, and transplant them into the soil when they grow into seedlings;

[0118] (6) pGUS-Promoter DfCAD16 Verification of transgenic tobacco: Extract the DNA of transgenic tobacco and verify it with the Promoter DfCAD16 gene primers (Table 3);

[0119] (7) GUS tissue activity staining: Take 10.4 mg of X-Gluc solid, add it to 1 mL of DMF solution, dissolve it, and store it at -20 °C in the dark. Place the transgenic tobacco in the GUS staining solution, incubate it at 37 °C overnight, and gradually decolorize it with 95%, 75%, 50% ethanol and distilled water in sequence after staining;

[0120] Among them, the tobacco co-culture medium: 4.74 g of MS powder, 2 mL of 6-BA, 200 μL of NAA, 30 g of sucrose, made up to 1 L with distilled water, pH = 5.8, 8 g of agar, sterilized at 121 °C for 20 min;

[0121] Tobacco callus induction medium: 4.74 g of MS powder, 2 mL of 6-BA, 200 μL of NAA, 30 g of sucrose, made up to 1 L with distilled water, pH = 5.8, 8 g of agar, sterilized at 121 °C for 20 min. After sterilization, add 4 mL of Cef and 10 mg / mL HYG;

[0122] Tobacco rooting medium: 4.74 g of MS powder, 2 mL of 6-BA, 30 g of sucrose, made up to 1 L with distilled water, pH = 5.8, 8 g of agar, sterilized at 121 °C for 20 min. After sterilization, add 4 mL of Cef and 10 mg / mL HYG;

[0123] Phosphate buffer: 0.2M Na2HPO4, 0.2M NaH2PO4, pH = 7;

[0124] GUS buffer: 80 mL of phosphate buffer, 0.744 g of EDTA, 0.1 mL of Trition X, 16.4 mg of potassium ferricyanide, 21.1 mg of potassium ferrocyanide, supplemented to 100 mL with RNase-Free ddH2O;

[0125] GUS staining solution: 50 μL of X-Gluc, 1 mL of GUS buffer.

[0126] As Figure 2 shown, A is the GUS staining comparison of CK and Promoter DfCAD16 ::GUS positive plants, B is the staining result of CK plants, C is the GUS staining result of transgenic tobacco, D is the magnification of the shoot tip part in C, E is the magnification of the root part in C, and the scale bar is 2 cm for all. The results show that DfCAD16 is specifically expressed in the plant vascular system, indicating that DfCAD16 may be involved in the construction of the vascular system (xylem and phloem) during the rapid growth of Dendrocalamus farinosus.

[0127] Example 3

[0128] Phenotypic analysis of DfCAD16 transgenic tobacco

[0129] 1. Amplification of DfCAD16 gene from Dendrocalamus farinosus

[0130] (1) Using the cDNA of the fifth section of Dendrocalamus farinosus bamboo shoots extracted as a template, perform PCR amplification, and the amplification primers are shown in Table 14;

[0131] Table 14

[0132] Primer Name Primer Sequence DfCAD16-F ATGGCTGCTGCATGCGA DfCAD16-R CTAGTTGAAAGAGGCCTCTATG

[0133] (2) The reaction system for DfCAD16 gene amplification is shown in Table 15;

[0134] Table 15

[0135] TaKaRa LA MIX 25μL DfCAD16-F 1μL DfCAD16-R 1μL cDNA 2μL <![CDATA[RNase-Free ddH2O]]> Make up to 50μL

[0136] (3) The DfCAD16 amplification reaction program is: 95°C for 3 min, 95°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 30 cycles, 72°C for 10 min, and after the program is completed, keep the temperature at 4°C for storage;

[0137] (4) Recovery of DfCAD16 gene product: After the PCR product electrophoresis is completed, cut the tape of the target band, and use the TIANGEN purification and recovery kit to recover the target band;

[0138] (5) Construction of pMD19-T-DfCAD16 vector: The method is the same as that in Example 2. Among them, the ligation system is shown in Table 16, and the bacterial liquid PCR reaction system is shown in Table 17.

[0139] Table 16

[0140] <![CDATA[10X T4 DNA ligase]]> 1μL <![CDATA[T4 ligase]]> 1μL DfCAD16 recovery product 6μL pMD19-T vector (10ng / μL) 2μL

[0141] Table 17

[0142] TaKaRa LA MIX 10μL DfCAD16-F 0.5μL DfCAD16-R 0.5μL Bacterial solution 1μL <![CDATA[RNase-Free ddH2O]]> Make up to 20μL

[0143] 2. pCM1307-flag-DfCAD16 transgenic tobacco

[0144] (1) Use Snapgene bioinformatics software to query available restriction enzyme sites, amplify using the pMD19-T-DfCAD16 plasmid as a template, purify the PCR product. After purification, double-digest the product with pCM1307-flag empty vector. After digestion, purify the product. Ligate the two digested products at 22°C for 2 h. After ligation, transfer them into DH5α Escherichia coli competent cells for colony PCR verification. Extract the positive plasmid and perform enzyme digestion verification to construct the pCM1307-flag-DfCAD16 recombinant vector. Genetically transform the pCM1307-flag-DfCAD16 recombinant plasmid into Agrobacterium tumefaciens EHA105 and genetically transform it into wild-type W38 tobacco. The amplification primers are shown in Table 18.

[0145] Table 18

[0146] Primer Name Primer Sequence DfCAD-flag-F ACGCGTCGACATGGCTGCTGCATGCGA DfCAD-flag-R CGGGGTACCCTAGTTGAAAGAGGCCTCTATG

[0147] (2) The pCM1307-flag-DfCAD16 subcloning reaction system is shown in Table 19.

[0148] Table 19

[0149] TaKaRa LA MIX 25 μL DfCAD-flag-F 1 μL DfCAD-flag-R 1 μL pMD19-T-DfCAD16 2 μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0150] (3) The pCM1307-flag-DfCAD16 subcloning reaction program is: 95°C for 3 min, 95°C for 30 s, 55°C for 30 s, 72°C for 1.5 min, 30 cycles, 72°C for 10 min. After the program is completed, keep the temperature at 4°C for storage.

[0151] (4) The subcloning double-digestion reaction system is shown in Tables 20 - 21.

[0152] Table 20

[0153] SaⅠⅠ 2 μL KpnⅠ 2 μL Purified product of DfCAD16 30 μL 10X Restriction Enzyme Buffer 5 μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0154] Table 21

[0155] SaⅠⅠ 2 μL KpnⅠ 2 μL Empty vector of pCM1307-flag 20 μL 10X Restriction Enzyme Buffer 5 μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0156] (5) The ligation system of the DfCAD16 subcloned and recovered product and pCM1307-flag is shown in Table 22;

[0157] Table 22

[0158]

[0159]

[0160] (6) The restriction enzyme digestion verification reaction system of pCM1307-flag-DfCAD16 is shown in Table 23;

[0161] Table 23

[0162] SaⅠⅠ 2 μL KpnⅠ 2 μL pCM1307-flag-DfCAD16 10 μL 10X Restriction Enzyme Buffer 5 μL <![CDATA[ddH2O]]> Make up to 50 μL

[0163] (7) Agrobacterium genetic transformation of pCM1307-flag-DfCAD16: Take out the Agrobacterium competent cells from -80 °C, place them on ice to dissolve, add 2 μL of plasmid, and mix well; then immediately place them on ice for 10 min, quickly freeze them in liquid nitrogen for 2 min, water bath at 37 °C for 5 min, and add LB (Rif) liquid medium in the ultra-clean workbench; shake in a shaker at 28 °C for about 3 h until it becomes visibly turbid, and pipette 500 μL; evenly spread it on the LB (Rif+Kana) solid medium, and incubate it upside down at 28 °C for 2 - 3 days; Select 4 visibly visible colonies from the LB (Rif+Kana) solid medium, and add LB (Rif+Kana) liquid medium in the ultra-clean workbench, shake at 180 rpm in a shaker at 28 °C for 3 h until it becomes visibly turbid, then perform colony PCR identification. After identifying the positive ones, add glycerol to preserve the positive strains; among them, the Agrobacterium colony PCR reaction program is the same as the amplification program, and the Agrobacterium colony PCR reaction system is shown in Table 24;

[0164] Table 24

[0165] TaKaRa LA MIX 25 μL DfCAD-flag-F 1 μL DfCAD-flag-R 1 μL Bacterial solution 2 μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0166] (8) Tobacco infection by the leaf disc method with pCM1307-flag-DfCAD16: In the ultra-clean workbench, take 1 mL of the positive strain, add 5 mL of LB (Rif+Kana) liquid medium, shake at 180 rpm in a shaker at 28 °C for 12 h; Take out the shaken bacterial liquid for 12 h, add 100 mL of LB (Rif+Kana) liquid medium, and shake at 180 rpm in a shaker at 28 °C until OD 600= 0.5, leave it standing at room temperature for 3 h; centrifuge at 5000 rpm for 10 min, discard the supernatant, collect the thalli, resuspend the thalli with sterilized MS0 liquid medium (containing 100 μmol / L AS), and leave it standing for 2 h under dark conditions at room temperature, adjust OD 600 = 0.5 to obtain the infection solution; remove the leaf veins from the tobacco leaves, and cut the leaves into pieces of 1 cm 2 in size, soak and oscillate in the infection solution for 10 min, blot dry the residual infection solution on the leaves with sterilized filter paper, place the leaves face up on the co-culture medium, and culture them in the dark at room temperature for 2 days; transfer them to the callus induction medium after 2 days, and culture them under the conditions of 25 °C, 16 h light and 8 h dark until small pieces of callus grow out, cut off the callus and transfer it to a new callus induction medium, continue to culture it under the conditions of 25 °C, 16 h light and 8 h dark until small buds grow out from the callus, cut out the small buds, place them in the rooting medium, and transplant them into the soil when they grow into seedlings;

[0167] (9) Verification of pCM1307-flag-DfCAD16 transgenic tobacco: The obtained transgenic tobacco is positive transgenic tobacco screened by kanamycin (Kan) resistance. Extract the RNA of transgenic tobacco and reverse transcribe it into cDNA, and verify the expression level of DfCAD16 by real-time fluorescence quantitative PCR with DfCAD16 gene quantitative primers (Table 1). The internal reference primers used are Tublin-F / Tublin-R. Select three lines with different DfCAD16 expression levels, namely OX-1, OX-2 and OX-3, for downstream experiments;

[0168] (10) Determination of lignin content: Dry the fresh samples of mature tobacco leaves to a constant weight, select a sieve with a pore size of 0.2 mm, and crush and filter them; weigh 0.3 g of the filtered sample and record it as W0, and put it into a pre-dried conical flask; add 30 mL of 72% H2SO4 to the conical flask and water bath at 30 °C for 1 h; add 600 mL of water to the conical flask during the 1 h water bath, sterilize it at high temperature, and keep it at 120 °C for 1 h; filter the sterilized liquid with a sand star crucible; dry the filtered substance in an oven and weigh it. Record the weight of the crucible as m0, and the weight of the crucible plus the substance as m1; put the dried substance into a muffle furnace and incinerate it at 525 °C for 3 h. After cooling, weigh it and record it as m2; lignin mass = m2 - m1, ash mass = m2 - m0;

[0169] (11) Phloroglucinol staining: Make a hand section of the stem of the tobacco plant about 5 cm away from the root, drop 50% HCL on the sample after sectioning, soak it for 3 minutes, add 2% phloroglucinol solution, wait for the red color to appear, when it can be observed with the naked eye, suck out the excess liquid, and place it under an inverted microscope for photographing;

[0170] (12) Paraffin sectioning: Take the tobacco stem and place it in Carnoy's fixative for overnight immersion. Remove the sample from the fixative and perform gradient elution in 50% ethanol, 70% ethanol, 95% ethanol, and absolute ethanol. Take out the sample from 100% alcohol. Immerse the taken-out sample in 2 / 3 absolute ethanol + 1 / 3 xylene, 1 / 2 absolute ethanol + 1 / 2 xylene, 1 / 3 absolute ethanol + 2 / 3 xylene, and xylene. Melt the paraffin in a paraffin embedding machine, pour out half of the xylene in the sample, add half of the liquid paraffin, and repeat this operation three times, waiting for it to be completely soaked in paraffin. Place the sample vertically in an embedding cassette, add liquid paraffin, and wait for the paraffin to solidify. Cut the solidified paraffin into regular shapes, fix it on a white box with melted paraffin, section it on a microtome, and the thickness is 10 mm. Apply an adhesive on a glass slide in advance, dry it in an oven, place the section on the dried slide, and drop the adhesive. Spread the section at 40 °C for 5 min, soak the slide in xylene for 2 h, perform dewaxing by soaking in absolute ethanol for 15 min, and take photos under an inverted microscope;

[0171] (13) Measurement of xylem thickness: Use ImageJ software to process the images of the sections and collect the average thickness of different parts of the xylem.

[0172] Figure 3 For the verification of DfCAD16 transgenic tobacco, A shows the morphological phenotype analysis of the control and three transgenic tobacco lines, B shows the plant heights of the control and three transgenic tobacco lines, and C shows the relative expression of the DfCAD16 gene in transgenic tobacco. It can be seen that among the transgenic tobaccos, the expression of the OX-2 line is the highest, which is 3.3 times that of the control; the expression level of OX-3 is the second, about 3 times that of the control; the expression level of DfCAD16 in the OX-1 line is the lowest, which is 2 times that of the control. At the seedling stage, the overexpressing plants already showed the phenomenon of delayed growth and development; as the plants grew, this delay became more obvious. After 100 days of sowing, the plant heights of the OX-2 and OX-3 lines were less than half of the control group.

[0173] After removing all the leaves of the control and overexpressing tobacco, it can be observed that the overexpressing tobacco has fewer nodes than the control. Through statistical analysis, it is found that the reduction in the number of nodes of the plants overexpressing DfCAD16 is significant ( Figure 4 A and C), and the length of each internode also shows a significant reduction ( Figure 4 A and B).

[0174] After sectioning and phloroglucinol staining of the bases of the stems of the control and overexpressing plants, it can be seen that the xylem in the transgenic plants is wider ( Figure 5 A, B), and the arrangement of the xylem is also more compact ( Figure 5C). Detecting the lignin content in the stems of control and overexpressing plants ( Figure 5 D), the lignin content of all transgenic plants was significantly higher than that of the control. Among them, the lignin content of OX-1 was 3 times that of the control, the lignin content of OX-3 was more than 4 times that of the control, while the lignin content of the OX-2 line with the highest DfCAD16 expression reached more than 7 times that of the control, and the xylem of OX-2 was the thickest ( Figure 5 E), about 1.5 times that of the control. In the OX-2 line, the content of G-type lignin monomers increased to 10 times that of the control, but the total content of S-type lignin monomers was only 2 times that of the control ( Figure 5 F, G).

[0175] In summary, the DfCAD16 gene of Bambusa emarginata disclosed in the present invention is specifically expressed in the vascular tissues of plants, and its expression is proportional to the accumulation of lignin in plants. Heterologous overexpression of DfCAD16 in tobacco (N.t) can increase the lignin content and the content of G-type lignin monomers in the stems of plants, and the phenomenon of plant growth retardation is caused by the accumulation of lignin.

[0176] Although the embodiments of the present invention have been disclosed as above, it is not limited to the applications listed in the specification and embodiments. It can be fully applied to various fields suitable for the present invention. For those familiar with the field, other modifications can be easily achieved. Therefore, without departing from the general concept defined by the claims and the equivalent scope, the present invention is not limited to the specific details and the examples shown and described here.

Claims

1. A Dendrocalamus farinosus CAD gene, characterized in that, The CAD gene of Dendrocalamus farinosus is the DfCAD16 gene, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The Bambusa emarginata McClure CAD gene according to claim 1, wherein The amino acid sequence encoded by the DfCAD16 gene is shown in SEQ ID NO.

2.

3. The Bambusa emarginata CAD gene according to claim 1, characterized in that, The coding sequence of the DfCAD16 gene is shown in SEQ ID NO.

4.

4. A recombinant vector, characterized in that, It includes the DfCAD16 gene described in claim 1.

5. The recombinant vector according to claim 4, characterized in that, The recombinant vector is pCM1307-flag-DfCAD16.

6. Use of the Dendrocalamus farinosus CAD gene as described in claim 1 in increasing the lignin content of plants, characterized in that, Overexpressing the CAD gene of Dendrocalamus farinosus is used to increase the lignin content in the plant stem, increase the proportion of G-type lignin monomers, make the plant xylem wider, and the arrangement of the xylem is also more compact; wherein, the plant is Dendrocalamus farinosus or tobacco.

7. Use of the recombinant vector according to claim 5 in increasing the lignin content of plants, characterized in that, The plant is Dendrocalamus farinosus or tobacco.

8. Use of the Dendrocalamus farinosus CAD gene as described in claim 6 in increasing the lignin content of plants, characterized in that, It includes: Step 1, construct the pCM1307-flag-DfCAD16 recombinant vector; Step 2, transform Agrobacterium tumefaciens; Step 3, select the positive strain in Step 2 and infect tobacco by the leaf disc method.

9. Use of the Dendrocalamus farinosus CAD gene as described in claim 8 in increasing the lignin content of plants, characterized in that, In Step 3, the specific method of infecting tobacco by the leaf disc method is: (1) In the ultra-clean workbench, take 1 mL of the positive strain and add 5 mL of LB (Rif+Kana) liquid medium, and shake it at 180 rpm on a shaker at 28 °C for 10-16 h; (2) Take out the bacterial solution after shaking for 10 - 16 h, add 100 mL of LB (Rif + Kana) liquid medium, shake at 180 rpm on a shaker at 28 °C for 1 day, and wait for OD 600 = 0.3 - 0.6, and let it stand at room temperature for 2 - 3 h; (3) Centrifuge at 5000 rpm for 10 min, discard the supernatant, collect the bacterial cells, resuspend the bacterial cells, and let them stand in the dark at room temperature for 2 - 3 h to adjust OD 600 = 0.3 - 0.6 to obtain the infection solution; (4) Remove the veins from the tobacco leaves and cut the leaves into pieces of 0.8 - 1.2 cm 2 in size. Immerse them in the infection solution and shake for 10 min. Blot the residual infection solution on the leaves with a sterilized filter paper, place the leaves face up in the co - culture medium, and incubate them in the dark at room temperature for 2 days; (5) After 2 days, transfer it to the callus induction medium, and culture it at 25 °C under 16 hours of light and 8 hours of darkness until small pieces of callus grow out. Cut off the callus and transfer it to a new callus induction medium, and continue to culture it at 25 °C under 16 hours of light and 8 hours of darkness until small buds grow out from the callus. Cut out the small buds and place them in the rooting medium. When they grow into seedlings, transplant them into the soil.

Images