A method and culture medium for promoting adipogenic differentiation of stem cells in vitro

Abstract

The present invention provides a method and culture medium for promoting adipogenic differentiation of stem cells in vitro, and belongs to the field of stem cell technology. The present invention inhibits the expression of ENST00000566297.1 gene by designing specific siRNA, thereby significantly promoting the adipogenic differentiation of adipose-derived mesenchymal stem cells (ADSCs). The experimental results show that after transfection of siRNA, the intracellular lipid droplet content is significantly increased, and the adipogenic differentiation efficiency is significantly improved. In addition, the present invention also provides an optimized culture medium formula, including transfection culture medium, adipogenic induction liquid A and adipogenic induction liquid B. This culture medium can better support the adipogenic differentiation process of adipose-derived mesenchymal stem cells, thereby providing new strategies and technical support for adipose tissue engineering and regenerative medicine.

Description

Technical Field

[0001] The invention belongs to the technical field of stem cells, and in particular relates to a method and culture medium for promoting adipogenic differentiation of stem cells in vitro. Background Art

[0002] As modern people's demand for beauty and health continues to grow, fat transplantation and fat filling have become hot technologies in the medical beauty industry. These technologies transfer autologous fat from one part to another to achieve the effects of facial rejuvenation, body shaping and skin repair. However, the acquisition of autologous fat requires liposuction surgery, which is limited by the amount of fat in the donor site, and sometimes it is difficult to obtain enough fat for transplantation. At the same time, during the liposuction process, fat cells may be mechanically damaged, resulting in a decrease in their survival rate. Transplanted fat cells are easily absorbed, affecting the final effect.

[0003] Therefore, by culturing adipose-derived mesenchymal stem cells in vitro and inducing their adipogenic differentiation, the above problems can be effectively solved, providing a stable, efficient and safe source of fat cells. However, most current research focuses on how to efficiently promote the osteogenic differentiation of stem cells, while relatively few studies have focused on the adipogenic differentiation of adipose-derived stem cells. Therefore, it is of great significance to develop new methods to promote the adipogenic differentiation of adipose-derived stem cells.

[0004] During adipogenesis (adipogenic differentiation), ADSCs differentiate into mature adipocytes, a process that is finely regulated by multiple genes and signaling pathways. As an important molecule for gene expression regulation, long non-coding RNA (lncRNA) affects cell differentiation, development, and metabolism through multiple mechanisms. Studies have shown that some lncRNAs have a regulatory role in adipocyte differentiation, but the specific mechanism and potential application are still unclear. Summary of the invention

[0005] The purpose of the present invention is to provide a method and culture medium for promoting adipogenic differentiation of stem cells in vitro, thereby improving the adipogenic differentiation efficiency.

[0006] First, the present invention provides a method for promoting adipogenic differentiation of stem cells, the method comprising the following steps:

[0007] (1) Inoculate stem cells into a cell culture dish and culture until the cell confluence reaches 80-90%;

[0008] (2) using a transfection reagent to transfect siRNA targeting the ENST00000566297.1 gene into stem cells;

[0009] (3) 24-48 hours after transfection, add adipogenic induction solution A and place the cell incubator for further culture;

[0010] (4) After 3 days of culture, the cells were replaced with adipogenic induction medium B and placed in a cell culture incubator for further culture;

[0011] (5) After 3 days of culture, the medium was replaced with adipogenic induction medium A again, and then the medium was replaced every 3 days. After 14-21 days, the culture was terminated to obtain adipocytes.

[0012] Preferably, the cells are adipose-derived mesenchymal stem cells.

[0013] Preferably, the sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3;

[0014] The sequences of the siRNA are shown in SEQ ID NO.10 and SEQ ID NO.11, and the target sequence of the siRNA is shown in SEQ ID NO.12.

[0015] Preferably, the adipogenesis induction solution A consists of the following components: DMEM culture medium, 10% fetal bovine serum, 0.5 mM IBMX, 1 μM dexamethasone, 10 μg / mL insulin and 200 μM indomethacin.

[0016] Preferably, the adipogenesis induction fluid B consists of the following components: DMEM culture medium, 10% fetal bovine serum and 10 μg / mL insulin.

[0017] Secondly, the present invention provides a culture medium for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells, the culture medium consisting of a transfection culture medium, adipogenic induction liquid A and adipogenic induction liquid B;

[0018] Among them, the transfection medium consists of Opti-MEM medium, transfection reagent and siRNA;

[0019] Adipogenic induction solution A consisted of the following components: DMEM medium, 10% fetal bovine serum, 0.5 mM IBMX, 1 μM dexamethasone, 10 μg / mL insulin, and 200 μM indomethacin;

[0020] Adipogenic induction fluid B consisted of the following components: DMEM medium, 10% fetal bovine serum and 10 μg / mL insulin.

[0021] Preferably, for every 400 μL of Opti-MEM medium, the corresponding amount of transfection reagent added is 5 μL, the corresponding amount of siRNA added is 5 μL, and the concentration of the siRNA is 10 μM.

[0022] Preferably, the siRNA is siRNA of ENST00000566297.1 gene;

[0023] The sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3, the sequence of the siRNA is shown in SEQ ID NO.10 and SEQ ID NO.11, and the target sequence of the siRNA is shown in SEQ ID NO.12.

[0024] Secondly, the present invention provides an application of siRNA in preparing a culture medium for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells, wherein the siRNA is an siRNA of the ENST00000566297.1 gene.

[0025] Preferably, the sequence of the ENST00000566297.1 gene is shown as SEQ ID NO.3, the sequence of the siRNA is shown as SEQ ID NO.10 and SEQ ID NO.11, and the target sequence of the siRNA is shown as SEQ ID NO.12.

[0026] Secondly, the present invention provides an application of siRNA in preparing an expression promoter of PPARγ and C / EBPα, key regulatory factors for adipogenic differentiation of adipose-derived mesenchymal stem cells, wherein the siRNA is an siRNA of the ENST00000566297.1 gene;

[0027] The sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3, the sequence of the siRNA is shown in SEQ ID NO.10 and SEQ ID NO.11, and the target sequence of the siRNA is shown in SEQ ID NO.12.

[0028] The beneficial effects of the present invention are:

[0029] 1. By inhibiting the expression of ENST00000566297.1 gene, the present invention significantly promotes the adipogenic differentiation process of adipose mesenchymal stem cells. The experimental results show that after using siRNA to inhibit the gene, the intracellular lipid droplet content is significantly increased, indicating that the adipogenic differentiation efficiency is improved.

[0030] 2. The culture method provided by the present invention can significantly upregulate the expression of PPARγ and C / EBPα, the key regulatory factors of adipogenic differentiation. These two factors play a vital role in the formation and function of adipocytes, and the increase in their expression levels directly accelerates the adipogenic differentiation process.

[0031] 3. The present invention discovered and verified for the first time the negative regulatory role of the ENST00000566297.1 gene in the adipogenic differentiation of adipose-derived mesenchymal stem cells, providing a new regulatory target for adipose tissue engineering and regenerative medicine research.

[0032] 4. The method provided by the present invention is simple to operate and can achieve inhibition of the target gene through siRNA transfection without the need for complex gene editing technology, and is easy to promote in laboratory and clinical applications.

[0033] 5. The present invention also provides an optimized culture medium formula, including transfection culture medium, adipogenic induction liquid A and liquid B, which can better support the adipogenic differentiation process of adipose mesenchymal stem cells.

[0034] 6. The present invention provides a new approach to solving the problem of insufficient sources of fat cells in autologous fat transplantation, and is expected to be applied to fat filling technology in the medical beauty industry, as well as other regenerative medicine fields that require a large number of fat cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0036] Figure 1 is the relative expression level of ENST00000558010.1 gene at 14 and 21 days of adipogenesis induction;

[0037] Figure 2 is the relative expression level of ENST00000564199.1 gene at 14 and 21 days of adipogenesis induction;

[0038] Figure 3 is the relative expression level of ENST00000566297.1 gene at 14 and 21 days of adipogenesis induction;

[0039] Figure 4 The effect of siRNA in inhibiting the expression of ENST00000566297.1 gene;

[0040] Figure 5 is the relative lipid droplet content of adipose-derived mesenchymal stem cells after siRNA transfection;

[0041] Figure 6 The gene expression levels of adipogenic differentiation regulatory factors PPARγ and C / EBPα after transfection of siRNA. DETAILED DESCRIPTION

[0042] The optional embodiments of the present invention will be described in more detail below. Although the optional embodiments of the present invention have been described, it should be understood that the present invention can be implemented in various forms and should not be limited to the specific embodiments described herein. On the contrary, these embodiments are provided to make the present invention more thorough and complete, and to fully convey the scope of the present invention to those skilled in the art.

[0043] Example 1

[0044] Detection of gene expression differences before and after adipogenesis induction

[0045] 1) Cell treatment

[0046] (a) Adipose-derived mesenchymal stem cells were seeded into a 6-well cell culture plate, shaken and mixed, and then placed in a cell culture incubator at 37° C. and 5% CO2;

[0047] (b) When the adipose-derived mesenchymal stem cells reached 80-90% confluence, adipogenic induction solution A (DMEM medium, 10% fetal bovine serum, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 μM dexamethasone, 10 μg / mL insulin, 200 μM indomethacin) was added;

[0048] (c) After 3 days of culture, adipogenic induction medium A was removed and replaced with adipogenic induction medium B (DMEM medium, 10% fetal bovine serum, 10 μg / mL insulin);

[0049] (d) After 3 days of culture, the medium was replaced with adipogenic induction medium A, and then the medium was replaced every 3 days until the 21st day, when the culture was terminated;

[0050] 2) RNA extraction

[0051] (a) Three groups of cells were selected for the experiment: the control group without adipogenesis induction, the group after adipogenesis induction for 14 days, and the group after adipogenesis induction for 21 days. The culture medium was removed, the cells were washed with PBS, TRIzol reagent was added, the cells were fully lysed, and then transferred to an RNase-free centrifuge tube;

[0052] (b) Add 200 μL of chloroform, shake vigorously for 15 seconds, then let stand for 2-3 minutes, centrifuge at 12,000 × g at 4°C for 15 minutes, and carefully transfer the aqueous phase to a new centrifuge tube, avoiding the middle and lower layers;

[0053] (c) Add an equal volume of isopropanol, mix gently, let stand for 10 min, and centrifuge at 12,000 × g for 10 min at 4°C to precipitate RNA;

[0054] (d) removing the supernatant, washing the RNA precipitate with 75% anhydrous ethanol, centrifuging at 7,500 × g for 5 min at 4°C, and removing the supernatant;

[0055] (e) Repeat the wash step once, remove the ethanol, air-dry the RNA pellet, and mix by gently pipetting.

[0056] 3) Reverse transcription and differential gene expression detection (qPCR)

[0057] (a) Mix the following components in a PCR tube:

[0058] Total RNA: 1 μg, oligo dT primer: 1 μL, dNTP mixture (10 mM): 1 μL, reverse transcription buffer: 4 μL, reverse transcriptase: 1 μL, RNase inhibitor: 0.5 μL, add RNase-free water to 20 μL;

[0059] (b) react according to the following reaction procedure:

[0060] Incubate at 25°C for 10 min, 42°C for 60 min, and 85°C for 5 min, cool on ice, and store at -20°C.

[0061] 3) Differential gene expression detection (qPCR)

[0062] (a) Through previous studies, the present invention selected three genes that may be related to miRNA or related genes involved in the adipogenic differentiation process: ENST00000558010.1 (SEQ ID NO.1), ENST00000564199.1 (SEQID NO.2), and ENST00000566297.1 (SEQ ID NO.3).

[0063] The primers designed according to SEQ ID NO.1 are as follows:

[0064] Upstream primer: CTCCTTGCAACAAGAGGCCT, SEQ ID NO. 4;

[0065] Downstream primer: TGCTTGGGATACATGGGCAG, SEQ ID NO.5;

[0066] The primers designed according to SEQ ID NO.2 are as follows:

[0067] Upstream primer: GGGAGGAACTGGACAAGAGC, SEQ ID NO.6;

[0068] Downstream primer: CATGGTGGGAGGTGGATGTC, SEQ ID NO.7;

[0069] The primers designed according to SEQ ID NO.3 are as follows:

[0070] Upstream primer: AAGAACAAAGGGAGGCTCCG, SEQ ID NO. 8;

[0071] Downstream primer: GCGTTGGTTGTGGAGTAGGA, SEQ ID NO.9;

[0072] (b) Mix the following components in a PCR tube: SYBR Green Master Mix: 10 μL, upstream primer (10 μM): 0.5 μL, downstream primer (10 μM): 0.5 μL, template cDNA: 2 μL, and make up to 20 μL with RNase-free water.

[0073] (c) Use 2 -ΔΔCt Methods The relative gene expression levels were calculated, and GAPDH was selected as the internal reference gene.

[0074] according to Figure 1 The results showed that at 14 and 21 days of adipogenic induction, there was no significant difference in the relative expression level of gene ENST00000558010.1 compared with the control group. This indicates that during the adipogenic induction process, the expression level of gene ENST00000558010.1 remained stable without significant changes. This result suggests that ENST00000558010.1 may not be a key regulatory factor in the adipogenic differentiation process.

[0075] Figure 2 The results showed that at 21 days of adipogenic induction, the relative expression level of gene ENST00000564199.1 decreased compared with the control group, but this decrease was not statistically significant. However, further analysis showed that at 21 days of adipogenic induction, the decrease in the expression of ENST00000564199.1 reached the statistically significant requirement. This indicates that during the adipogenic induction process, the expression level of gene ENST00000564199.1 will decrease to a certain extent in the late stage, suggesting that it may have a certain regulatory role in the late stage of adipogenic differentiation.

[0076] Figure 3The results showed that the relative expression level of gene ENST00000566297.1 decreased significantly compared with the control group at 14 and 21 days of adipogenic induction. This significant downward trend was observed at both time points, indicating that gene ENST00000566297.1 may play an inhibitory role in the adipogenic differentiation process. This result suggests that ENST00000566297.1 may play an important negative regulatory role in the adipogenic differentiation process of adipose-derived mesenchymal stem cells.

[0077] Example 2

[0078] Through the results of Example 1, we found that gene ENST00000566297.1 can play an important negative regulatory role in the adipogenic differentiation of adipose-derived mesenchymal stem cells. Therefore, we speculate that inhibiting the expression of gene ENST00000566297.1 can promote the adipogenic differentiation of adipose-derived mesenchymal stem cells.

[0079] First, the present invention detects the effect of the inhibitory gene ENST00000566297.1 on adipogenic differentiation

[0080] 1) Design siRNA and detect its inhibitory effect by PCR and electrophoresis

[0081] (a) First, siRNA was designed according to the sequence of gene ENST00000566297.1 (SEQ ID NO. 3). The sequence of the siRNA designed by the present invention is as follows:

[0082] Sense strand of siRNA: UUUUGUUCUAUAACAAUCCCA, SEQ ID NO. 10;

[0083] Antisense strand of siRNA: GGAUUGUUAUAGAACAAAACG, SEQ ID NO.11;

[0084] The target sequence of siRNA is: TGGGATTGTTATAGAACAAAACG, SEQ ID NO.12; (the sequence was synthesized by RiboBio, and NC-siRNA was provided by the company)

[0085] (b) Adipose-derived mesenchymal stem cells (ADSCs) were seeded into a 6-well culture plate, and an appropriate amount of cells (about 5 × 10 5 cells), and cultured until the cell confluence reached 70-80%;

[0086] (c) using 200 μL of serum-free Opti-MEM medium to dilute 5 μL of NC-siRNA (10 μM), 5 μL of siRNA and 5 μL of transfection reagent (Lip2000), respectively, gently mixing the diluted NC-siRNA, siRNA and transfection reagent, and standing at room temperature for 15-20 minutes to form a siRNA-transfection reagent complex;

[0087] (d) Add the siRNA-transfection reagent complex to the cell culture wells and gently shake the culture plate to ensure even distribution. After culturing the cells at 37°C for 4-6 hours, replace with complete medium containing serum and continue culturing for 48 hours;

[0088] (e) RNA extraction and reverse transcription steps are the same as those in Example 1;

[0089] (f) According to the following overall reaction system, configure the components:

[0090] Template cDNA: 2 μL, upstream primer (10 μM): 0.5 μL, downstream primer (10 μM): 0.5 μL, dNTP mixture (10 mM): 0.4 μL, 10× PCR buffer: 2 μL, MgCl2 (25 mM): 1.2 μL, Taq DNA polymerase: 0.1 μL, RNase-free water: make up to 20 μL;

[0091] The PCR reaction was performed according to the following PCR program:

[0092] Pre-denaturation: 95°C, 3 minutes; PCR cycle (35 times): denaturation: 95°C, 30 seconds, annealing: 60°C, 30 seconds, extension: 72°C, 1 minute; extension: 72°C, 5 minutes;

[0093] (g) Prepare 1.5% agarose gel, mix the PCR product with DNA loading buffer, add it to the gel wells, and run electrophoresis at 100 V for about 30 minutes;

[0094] (f) Use gel imaging equipment for detection and photography.

[0095] from Figure 4 From the results, it can be seen that compared with NC-siRNA, the siRNA provided by the present invention can significantly reduce the expression level of gene ENST00000566297.1 in adipose mesenchymal stem cells, indicating that the siRNA provided by the present invention can effectively inhibit the expression of gene ENST00000566297.1 and can be used for subsequent research.

[0096] Example 3

[0097] Oil red O staining was used to detect whether inhibition of ENST00000566297.1 could accelerate the adipogenic transformation of adipose-derived mesenchymal stem cells

[0098] (a) Adipose-derived mesenchymal stem cells were seeded into a 6-well cell culture plate. When the confluence reached 80-90%, 5 μL NC-siRNA (10 μM), 5 μL siRNA and 5 μL transfection reagent were diluted with 200 μL serum-free Opti-MEM medium, and the diluted NC-siRNA, siRNA and transfection reagent were gently mixed and allowed to stand at room temperature for 15-20 minutes to form a siRNA-transfection reagent complex;

[0099] (b) Add the siRNA-transfection reagent complex to the cell culture wells, gently shake the culture plate to ensure uniform distribution, culture the cells at 37°C for 4-6 hours, replace with complete medium containing serum, and continue culturing for 48 hours;

[0100] (c) Add adipogenesis induction solution A (DMEM medium, 10% fetal bovine serum, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 μM dexamethasone, 10 μg / mL insulin, 200 μM indomethacin);

[0101] (d) After 3 days of culture, adipogenic induction medium A was removed and replaced with adipogenic induction medium B (DMEM medium, 10% fetal bovine serum, 10 μg / mL insulin);

[0102] (e) After 3 days of culture, the medium was replaced with adipogenic induction medium A, and then the medium was replaced every 3 days. After 14 days of culture, the culture was terminated;

[0103] (f) After washing the cells twice with PBS, 4% fixative was added to fix the cells at room temperature for 30 min. After washing with PBS three times, 60% isopropanol was added to treat the cells for 5 min.

[0104] (g) Add Oil Red O working solution and stain for 15 min at room temperature. After washing with PBS three times, the staining results were observed and photographed under an inverted microscope.

[0105] (h) Add the same volume of isopropanol to each well and incubate at room temperature for 10 min to dissolve the Oil Red O in the cells. Gently shake the culture plate to completely dissolve the Oil Red O in the isopropanol and collect the solution in each well into a new centrifuge tube.

[0106] (i) The collected solution was added to a 96-well plate, 200 μL per well, and the absorbance was measured at a wavelength of 510 nm using an ELISA reader to calculate the relative lipid droplet content = average absorbance of the experimental group / average absorbance of the control group.

[0107] The experimental results are as follows Figure 5 By comparing the relative lipid droplet content in adipose-derived mesenchymal stem cells (ADSCs) transfected with siRNA to inhibit ENST00000566297.1 and transfected with NC-siRNA (negative control), the following conclusions can be drawn:

[0108] from Figure 5 It can be seen that the relative lipid droplet content of ADSCs transfected with siRNA to inhibit ENST00000566297.1 was significantly higher than that of the control group transfected with NC-siRNA. This result shows that inhibiting the expression of ENST00000566297.1 gene can effectively promote the adipogenic differentiation of adipose-derived mesenchymal stem cells.

[0109] Specifically, by staining with Oil Red O and quantitatively measuring the content of lipid droplets, it can be clearly observed that after transfection with the siRNA provided by the present invention, the formation of lipid droplets in ADSCs increased significantly. Compared with the control group, the amount of lipid droplets in the cells of the experimental group showed a significant upward trend, indicating that the intervention of siRNA has a positive effect on promoting adipogenic transformation.

[0110] The experimental results fully demonstrate that ENST00000566297.1 plays a negative regulatory role in the adipogenic differentiation process. By transfecting the siRNA sequence designed by the present invention, the expression of the ENST00000566297.1 gene can be effectively inhibited, and its inhibition on adipogenic differentiation can be relieved, thereby accelerating the adipogenic transformation of adipose mesenchymal stem cells. This provides a new idea and theoretical basis for the further development of siRNA-based adipose tissue engineering and regenerative medicine applications.

[0111] Example 4

[0112] PPARγ is the main regulator of adipocyte differentiation. It promotes adipocyte formation and lipid accumulation by regulating the expression of multiple downstream genes.

[0113] C / EBPα is also an important regulatory factor for adipocyte differentiation. It works together with PPARγ to coordinately regulate the expression of adipogenesis-related genes.

[0114] Therefore, in this embodiment, the present invention uses fluorescent quantitative PCR experiments to detect the effects of the siRNA provided by the present invention on the main regulatory factors of adipogenic differentiation after inhibiting the ENST00000566297.1 gene.

[0115] (a) The cell treatment process is the same as in Example 3;

[0116] (b) The steps of RNA extraction, reverse transcription, and fluorescence quantitative PCR detection were the same as those in Example 1. The primer sequences of PPARγ and C / EBPα were as follows:

[0117] Upstream primer of PPARγ: AGAGCCTTCCAACTCCCTCA, SEQ ID NO. 13;

[0118] Downstream primer of PPARγ: TCTCCGGAAGAAACCCTTGC, SEQ ID NO.14;

[0119] Upstream primer of C / EBPα: TCGGTGGACAAGAACAGCAA, SEQ ID NO.15;

[0120] Downstream primer of C / EBPa: GTCAGCTCCAGCACCTTCTG, SEQ ID NO.16.

[0121] The experimental results are as follows Figure 6 As shown. Figure 6 It can be seen that compared with adipose-derived mesenchymal stem cells (ADSCs) transfected with NC-siRNA (negative control), the expression levels of key adipogenic differentiation regulatory factors in adipose-derived mesenchymal stem cells transfected with siRNA inhibiting ENST00000566297.1 changed significantly.

[0122] The specific results are as follows: the relative expression of PPARγ: 1.936, standard error: 0.069; the relative expression of C / EBPα: 2.441, standard error: 0.076.

[0123] From the above results, it can be seen that compared with the control group transfected with NC-siRNA only, the expression levels of adipogenic differentiation regulatory factors PPARγ and C / EBPα in ADSCs transfected with siRNA inhibiting ENST00000566297.1 were significantly increased. Among them, the expression of C / EBPα increased more significantly, indicating that it has a stronger effect on promoting adipogenic differentiation.

[0124] In summary, by inhibiting the ENST00000566297.1 gene, the expression of PPARγ and C / EBPα, the key regulatory factors of adipogenic differentiation, can be significantly upregulated, thereby accelerating and enhancing the adipogenic differentiation of adipose-derived mesenchymal stem cells. This discovery provides new ideas and experimental basis for the application of siRNA-based gene regulation strategies in adipose tissue engineering and the treatment of related diseases.

[0125] Example 5

[0126] A method for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells in vitro

[0127] (a) Adipose-derived mesenchymal stem cells were inoculated into a cell culture dish, and when the cell confluence reached 80-90%, siRNA of the ENST00000566297.1 gene was transferred into the adipose-derived mesenchymal stem cells using the lip2000 reagent;

[0128] (b) 24-48 h after transfection, adipogenic induction solution A (DMEM medium, 10% fetal bovine serum, 0.5 mM IBMX, 1 μM dexamethasone, 10 μg / mL insulin, 200 μM indomethacin) was added;

[0129] (c) After 3 days of culture, adipogenic induction medium A was removed and replaced with adipogenic induction medium B (DMEM medium, 10% fetal bovine serum, 10 μg / mL insulin);

[0130] (d) After 3 days of culture, the medium was replaced with adipogenic induction medium A, and then the medium was replaced every 3 days. On the 14th to 21st day, the culture was terminated to obtain adipocytes.

[0131] Example 6

[0132] A culture medium for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells

[0133] The culture medium consists of a transfection medium, an adipogenesis induction liquid A and an adipogenesis induction liquid B.

[0134] The transfection medium consists of: Opti-MEM, transfection reagent, and siRNA.

[0135] Adipogenesis induction medium A consisted of DMEM medium, 10% fetal bovine serum, 0.5 mM IBMX, 1 μM dexamethasone, 10 μg / mL insulin, and 200 μM indomethacin.

[0136] Adipogenesis induction medium B consisted of DEMM medium, 10% fetal bovine serum, and 10 μg / mL insulin.

Claims

1. A method for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells, characterized in that: The method comprises the following steps: (1) Inoculate stem cells into a cell culture dish and culture until the cell confluence reaches 80-90%; (2) using a transfection reagent to transfect siRNA targeting the ENST00000566297.1 gene into stem cells; (3) 24-48 hours after transfection, add adipogenic induction solution A and place the cell incubator for further culture; (4) After 3 days of culture, replace the cells with adipogenic induction medium B and place them in a cell culture incubator for further culture; (5) After 3 days of culture, the medium was replaced with adipogenic induction medium A again, and then the medium was replaced every 3 days. After 14-21 days, the culture was terminated to obtain adipocytes; The sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3; The sense strand and antisense strand sequences of the siRNA are shown in SEQ ID NO.10 and SEQ ID NO.11, respectively, and the target sequence of the siRNA is shown in SEQ ID NO.12; The adipogenic induction solution A consists of the following components: DMEM medium, 10% fetal bovine serum, 0.5 mM IBMX, 1 μM dexamethasone, 10 μg / mL insulin and 200 μM indomethacin; The adipogenesis induction solution B consists of the following components: DMEM culture medium, 10% fetal bovine serum and 10 μg / mL insulin.

2. A culture medium for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells, characterized in that: The culture medium consists of a transfection culture medium, an adipogenesis induction liquid A and an adipogenesis induction liquid B; Among them, the transfection medium consists of Opti-MEM, transfection reagent and siRNA; Adipogenic induction medium A consisted of the following components: DMEM medium, 10% fetal bovine serum, 0.5 mM IBMX, 1 μM dexamethasone, 10 μg / mL insulin, and 200 μM indomethacin; Adipogenic induction solution B consisted of the following components: DMEM medium, 10% fetal bovine serum, and 10 μg / mL insulin; The siRNA is the siRNA of the ENST00000566297.1 gene; The sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3, the sense strand and antisense strand sequences of the siRNA are shown in SEQ ID NO.10 and SEQ ID NO.11 respectively, and the target sequence of the siRNA is shown in SEQ ID NO.

12.

3. Use of siRNA in preparing a culture medium for promoting adipogenic differentiation of adipose-derived mesenchymal stem cells, characterized in that: The siRNA is the siRNA of the ENST00000566297.1 gene; The sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3, the sense strand and antisense strand sequences of the siRNA are shown in SEQ ID NO.10 and SEQ ID NO.11 respectively, and the target sequence of the siRNA is shown in SEQ ID NO.

12.

4. An application of siRNA in the preparation of an expression promoter of PPARγ and C / EBPα, key regulatory factors for adipogenic differentiation of adipose-derived mesenchymal stem cells, characterized in that: The siRNA is the siRNA of the ENST00000566297.1 gene; The sequence of the ENST00000566297.1 gene is shown in SEQ ID NO.3, the sense strand and antisense strand sequences of the siRNA are shown in SEQ ID NO.10 and SEQ ID NO.11 respectively, and the target sequence of the siRNA is shown in SEQ ID NO.12.

Images