Application of overexpressed LncRNA SNHG16 lentiviral vector in repairing engineering materials

Abstract

The invention provides an application of an overexpression LncRNA SNHG16 lentiviral vector in repairing engineering materials. In particular to application of the overexpressed LncRNA SNHG16 lentiviral vector in an engineering material for repairing tissue defects and application of adipose-derived stem cells containing the overexpressed LncRNA SNHG16 lentiviral vector in the engineering material for repairing the tissue defects. The overexpressed LncRNA SNHG16 lentiviral vector is utilized to transfect the adipose-derived stem cells, the obtained adipose-derived stem cells containing the overexpressed LncRNA SNHG16 lentiviral vector can promote adipose-derived stem cell proliferation and adipogenic differentiation to form tissue engineering fat, and the tissue engineering fat is used as an implant material to be filled to tissue defect parts to repair tissue defects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of a lentiviral vector overexpressing LncRNA SNHG16 in repair engineering materials. Background Art

[0002] Skin soft tissue injury can be caused by a variety of factors such as trauma, tumor resection, congenital malformations, etc., and has always been a common disease in the field of surgery; and with the development of my country's infrastructure and the aging of the population, the incidence of soft tissue injuries caused by industrial production accidents, traffic accidents, chronic systemic diseases, etc. has remained high, with many types and long courses of disease. However, the current methods for repairing large-area soft tissue defects are still relatively limited, including autologous transplantation and material implantation, both of which have problems such as low transplantation efficiency and poor long-term stability. In autologous tissue transplantation, adipose tissue is considered to be an ideal material for repairing and reconstructing soft tissue defects, but its efficacy is limited by problems such as high postoperative absorption rate and concomitant infection. In recent years, the emergence of adipose tissue engineering has been considered to be a new treatment strategy with great potential, which has strong plasticity in implant function and graft survival rate.

[0003] Adipose-derived stem cells (ADSCs) are adult stem cells with mesenchymal stem cell characteristics in adipose tissue. They have the advantages of high proliferation activity, multidirectional differentiation potential, low immunogenicity, and abundant sources. They are the core elements of tissue engineering. Adipose stem cells loaded on scaffolds form tissue-engineered fat under the induction of various cytokines. Therefore, inducing ADSCs proliferation and adipogenic differentiation is a key scientific issue in achieving fat regeneration. However, from the current research status at home and abroad, the adipogenic differentiation mechanism of ADSCs is still unclear. Although it has been confirmed that some cytokines or chemicals can promote their adipogenic differentiation, such as BMP-4 and MLL3, it is difficult to solve how to promote cell proliferation at the same time.

[0004] Long non-coding RNA (lncRNA) is a non-coding RNA with a length of more than 200 nucleotides, which can act as a signal RNA to respond to intracellular and extracellular stimuli. In recent years, reports have confirmed that lncRNA can affect the proliferation and differentiation of stem cells at multiple levels of gene expression. Differently located lncRNAs exert their effects in different ways. In the cell nucleus, lncRNA can regulate gene expression at the epigenetic, pre-transcriptional and transcriptional levels, such as affecting the methylation level of gene promoter regions, or binding to RNA binding proteins, transcription factor proteins, etc. to regulate the expression of functional genes. lncRNA in the cytoplasm can act as a competitive endogenous RNA (ceRNA) to target a variety of miRNAs, affecting the expression or stability of target genes. In addition, lncRNA from the cell itself or other surrounding cells' exosomes can enter the target cell through endocytosis and perform corresponding functions. Summary of the invention

[0005] The purpose of the present invention is to modify adipose stem cells by using a lentiviral vector overexpressing LncRNA SNHG16, promote the proliferation and adipogenic differentiation of adipose stem cells, form tissue-engineered fat, and use it as an implant material to repair tissue defects.

[0006] The present invention provides an application of a lentiviral vector overexpressing LncRNA SNHG16 in an engineering material for repairing tissue defects.

[0007] In a specific embodiment, the tissue defect is a skin soft tissue defect.

[0008] In a specific embodiment, the LncRNA SNHG16 overexpression lentiviral vector is a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven by the CMV promoter, the CDGA-2A-PURO gene is driven by the EF1A promoter, and has green fluorescence and puromycin resistance.

[0009] In a specific embodiment, the sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is shown in SEQ ID NO.1.

[0010] In a specific embodiment, the method for constructing the LncRNA SNHG16 overexpressing lentiviral vector comprises the following steps:

[0011] Screening of LncRNA SNHG16;

[0012] The linearized PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector was obtained by enzyme digestion;

[0013] The PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector was constructed by homologous recombination, in which the SNHG16 insertion sequence was the full length of the gene.

[0014] The present invention also provides an application of adipose-derived stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 in engineering materials for repairing tissue defects.

[0015] In a specific embodiment, the LncRNA SNHG16 overexpression lentiviral vector is a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven by the CMV promoter, the CDGA-2A-PURO gene is driven by the EF1A promoter, and has green fluorescence and puromycin resistance.

[0016] In a specific embodiment, the sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is shown in SEQ ID NO.1.

[0017] In a specific embodiment, a method for preparing adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 comprises the following steps:

[0018] Step (1), constructing a lentiviral vector overexpressing LncRNA SNHG16;

[0019] Step (2), transfecting adipose stem cells with the LncRNA SNHG16 overexpression lentiviral vector constructed in step (1) to obtain adipose stem cells containing the LncRNA SNHG16 overexpression lentiviral vector.

[0020] In a specific embodiment, the virus transfection multiplicity MOI in step (2) is 50.

[0021] The beneficial effects of the present invention include at least:

[0022] 1. The present invention uses a lentiviral vector overexpressing LncRNA SNHG16 to transfect adipose stem cells. The obtained adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 can promote the proliferation and adipogenic differentiation of adipose stem cells to form tissue engineering fat, which can be used as an implant material to fill the tissue defect site and repair the tissue defect.

[0023] 2. Compared with plasmid vectors, lentiviruses can effectively introduce and integrate exogenous genes into the target cell genome through in vitro infection and in vivo injection. They have a stronger ability to infect cells and can achieve long-term expression of exogenous genes in dividing and non-dividing cells without causing toxicity and immune response. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Comparison of CCK-8 cell proliferation activity among the control group, adipose stem cell exosome group, and adipose tissue exosome group at 0, 1, 3, and 5 days;

[0025] Figure 2 This is a comparison of images under the microscope of Oil Red O staining of the control group, adipose stem cell exosome group, and adipose tissue exosome group on the 5th day;

[0026] Figure 3 This is a heat map of high-throughput sequencing of lncRNA in adipose tissue exosomes;

[0027] Figure 4 This is the GO enrichment analysis diagram of lncRNA in adipose tissue exosomes;

[0028] Figure 5 This is a comparison chart of the expression levels of lncRNA SNHG16 in adipose stem cell exosomes and adipose tissue exosomes;

[0029] Figure 6 Schematic diagram of the SNHG16 overexpression plasmid structure;

[0030] Figure 7 The fluorescence expression content of cells at different lentiviral infection multiplicity MOI values;

[0031] Figure 8 Comparison of intracellular SNHG16 expression levels in adipose-derived stem cells, adipose-derived stem cells transfected with empty SNHG16 lentivirus group, and adipose-derived stem cells transfected with SNHG16 overexpression lentivirus group;

[0032] Fig. 9 Comparison of CCK-8 cell proliferation activity in the adipose-derived stem cell transfected empty SNHG16 lentivirus group and the adipose-derived stem cell transfected SNHG16 overexpression lentivirus group;

[0033] Fig.10 This is the cell cycle fitting diagram after adipose stem cells were transfected with SNHG16 empty lentivirus;

[0034] Fig.11 This is the cell cycle fitting diagram after adipose stem cells were transfected with SNHG16 overexpression lentivirus;

[0035] Fig.12This is a comparison of the RT-qPCR results of Ki67 and PCNA mRNA expression in the adipose stem cell transfected with empty SNHG16 lentivirus group and the adipose stem cell transfected with SNHG16 overexpression lentivirus group;

[0036] Fig.13 The Western blot corresponding band diagram of Ki67 and PCNA protein expression in the adipose stem cell transfected with empty SNHG16 lentivirus group and the adipose stem cell transfected with SNHG16 overexpression lentivirus group;

[0037] Fig.14 This is a comparison chart of the gray value analysis of the corresponding bands of Western blot of Ki67 and PCNA protein expression in the adipose stem cell transfected with empty SNHG16 lentivirus group and the adipose stem cell transfected with SNHG16 overexpression lentivirus group;

[0038] Fig.15 This is a comparison of images of the adipose stem cell transfected with empty SNHG16 lentivirus group and the adipose stem cell transfected with SNHG16 overexpression lentivirus group under Oil Red O staining microscope on the 5th day;

[0039] Fig.16 This is a comparison chart of the absorbance values ​​at 520 nm after Oil Red O staining and isopropanol extraction in the adipose stem cell transfection empty SNHG16 lentivirus group and the adipose stem cell transfection SNHG16 overexpression lentivirus group on the 5th day;

[0040] Fig.17 This is a comparison of the RT-qPCR results of PPAR-γ and CEBP-α mRNA expression in the adipose stem cell transfected with empty SNHG16 lentivirus group and the adipose stem cell transfected with SNHG16 overexpression lentivirus group;

[0041] Fig.18 The corresponding band diagram of Western blot of PPAR-γ and CEBP-α protein expression in the adipose stem cell transfected with empty SNHG16 lentivirus group and adipose stem cell transfected with SNHG16 overexpression lentivirus group;

[0042] Fig.19 This is a comparison chart of the gray value analysis of the corresponding bands of Western blot of PPAR-γ and CEBP-α protein expression in the adipose stem cell transfected empty SNHG16 lentivirus group and the adipose stem cell transfected SNHG16 overexpression lentivirus group;

[0043] Fig. 20 The green fluorescence expression of cells under the microscope in the adipose stem cell transfection empty SNHG16 plasmid group and the adipose stem cell transfection SNHG16 overexpression plasmid group;

[0044] Fig.21The green fluorescence expression of cells under the microscope in the adipose stem cell transfected empty SNHG16 lentivirus group and the adipose stem cell transfected SNHG16 overexpression lentivirus group. DETAILED DESCRIPTION

[0045] The present invention is described in detail below with reference to the accompanying drawings and embodiments, but the present invention can be implemented in many different ways as limited and covered by the claims.

[0046] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Specifically:

[0047] The culture medium MEM-α, penicillin-streptomycin (100x), DPBS, special grade fetal bovine serum, and trypsin were purchased from VivaCell; the CCK-8 kit was purchased from Bioss; the Oil Red O staining kit, insulin, propidium iodide PI solution, RNaseA ribonuclease A, and RIPA cell lysis buffer were purchased from solarbio; the adipogenic induction medium was purchased from apexgene; the reverse transcription kit and PCR kit were purchased from Vazyme; the polyacrylamide gel (SDS.PAGE) was purchased from ACE; the BCA detection kit and protein ladder were purchased from Bioss; anti-Ki67 (WL01384a), anti-PCNA (WL02208), anti-PPAR-γ (WL01800), and anti-CEBP-α (WL01899) were purchased from Wanlei; HRPGoat anti Rabbit IgG (HL) was purchased from AntGene; TBST, ECL chemiluminescent solution, and PVDF membrane were purchased from ECOTOP; GAPDH, Ki67, PCNA, PPAR-γ, and CEBP primers were purchased from Shanghai Bioengineering Corporation.

[0048] The specific operation steps of CCK-8, Oil Red O staining, flow cell cycle PI staining, RT-qPCR, and Western blot in the present invention are as follows:

[0049] CCK-8: 2×10 3 Adipose stem cells were inoculated into 96-well plates and cultured for 1-5 days, with the medium changed every 2 days. During the test, 10 μl of CCK-8 reagent was added to each well of the original culture medium, mixed and placed in a 37°C constant temperature incubator for 30 minutes. The OD value was read at 450nm using an enzyme-linked immunosorbent assay.

[0050] Oil Red O staining: 7.5 × 10 4Adipose stem cells were seeded into 6-well plates, cultured in adipogenic induction medium for 2 days, cultured in medium containing 10 μg / ml insulin for 1 day, and cultured in alternating cycles until the 5th day, and stained with Oil Red O staining kit.

[0051] Flow cytometry PI staining: Digest adipose stem cells with trypsin, collect cells by centrifugation at 1000 rpm for 5 minutes, resuspend and fix cells in 75% alcohol, incubate at 4°C overnight, remove alcohol by centrifugation at 1000 rpm for 5 minutes, add 200 μl PBS, 10 μl RNaseA, and 200 μl propidium iodide PI solution, incubate at 37°C for 30 minutes, mix thoroughly, pass through a 200-mesh cell sieve, and transfer to a 5 ml flow cytometer for flow cytometry detection.

[0052] RT-qPCR: Total RNA was prepared using TRIzol reagent, reversed into cDNA using a reverse transcription kit, and amplified using a PCR kit and a fluorescent qPCR instrument (QuantStudio 3). The primer sequences are shown in the corresponding contents of each example.

[0053] Western blot: RIPA cell lysis buffer was used to extract total cell protein, and the protein concentration was determined using a BCA kit. 20 μg of protein was loaded, and 12% polyacrylamide gel electrophoresis (SDS.PAGE) was performed, and the membrane was wet-transferred to a PVDF membrane at 400 mA x 0.5 h. The membrane was blocked with blocking solution at room temperature for 1 h. After elution with TBST, the primary antibody was added and incubated overnight at 4 ° C. The membrane was washed 3 times with TBST, each for 5 min, and incubated with the corresponding secondary antibody at room temperature for 1 h, and then washed 3 times, each for 5 min. The antigen-antibody complex was displayed using enhanced chemiluminescence (ECL), and the darkroom X-ray film was exposed and scanned. Protein quantification was performed by gray value analysis of the target band, and the relative expression of the target protein was expressed by the gray value of the target band / the gray value of the internal reference band.

[0054] Example 1

[0055] SNHG16 screening

[0056] Experimental studies have found that adipose tissue exosomes (AT-Exo) have a stronger ability to promote the proliferation and adipogenic differentiation of adipose stem cells (ADSCs) than adipose stem cell exosomes (ADSCs-Exo). Further high-throughput sequencing of lncRNA in AT-Exo was performed, and SNHG16, which was more highly expressed in AT-Exo than ADSCs-Exo, was screened by RT-qPCR.

[0057] 1.1 Experiments on adipose tissue exosomes and adipose stem cell exosomes promoting adipose stem cell proliferation and adipogenic differentiation

[0058] A) CCK-8 proliferation activity assay: 30 μg / ml AT-Exo or ADSCs-Exo were co-incubated with ADSCs for 0-5 days, and the proliferation activity of ADSCs at different time points was detected. The results are detailed in Figure 1 As shown, Figure 1 Comparison of CCK-8 cell proliferation activity of the control group (Control), adipose stem cell exosome group (ADSCs-Exo), and adipose tissue exosome group (AT-Exo) at 0, 1, 3, and 5 days. Figure 1 It can be seen that compared with the control group (no intervention), the proliferation activity of the AT-Exo group and the ADSCs-Exo group increased more significantly, and the proliferation activity of the AT-Exo group was slightly higher than that of the ADSCs-Exo group.

[0059] B) Oil Red O staining: 30 μg / ml AT-Exo or ADSCs-Exo were co-incubated with ADSCs for 5 days for adipogenic differentiation. The results are shown in Figure 2 , Figure 2 (a) is the Oil Red O staining result of the control group. Figure 2 (b) is the Oil Red O staining result of AT-Exo group. Figure 2 (c) is the Oil Red O staining result of ADSCs-Exo group. Figure 2 It can be seen that compared with the control group (no intervention), the AT-Exo group and the ADSCs group have stronger adipogenic differentiation levels, and the AT-Exo group has stronger adipogenic differentiation ability than the ADSCs group.

[0060] 1.2 High-throughput sequencing of lncRNA in AT-Exo

[0061] lncRNA high-throughput sequencing: Arraystar LncRNA Array method (see below), found that AT-Exo has a large number of lncRNAs

[0062] The Arraystar LncRNA Array method is as follows: The exosomes obtained were treated with reagents, and the quantity and quality of RNA were assessed using NanoDrop ND-1000 (Thermo Fisher Scientific, USA). RNA integrity was assessed by standard denaturing gel electrophoresis. Sample labeling and chip hybridization were performed according to the Agilent One-Color Microarray Gene Expression Analysis Protocol (Agilent Technologies). Each sample was amplified and transcribed into fluorescent cDNA using the random primer method, and the labeled cDNA was purified using the RNeasyMini Kit (Qiagen), and the concentration and activity were detected using NanoDrop ND-1000. The hybridization solution was dispensed onto the mat glass, assembled onto the lncRNA expression microarray slide, and the hybridization chip was washed, fixed, and scanned using the Agilent DNA Microarray Scanner (Part No. G2505C).

[0063] The results of lncRNA high-throughput sequencing are detailed in Figure 3 As shown, from Figure 3 It can be seen that the two adipose tissue exosome samples subjected to high-throughput sequencing contained multiple lncRNAs.

[0064] 1.3 GO enrichment analysis of all lncRNAs revealed that these lncRNAs were related to cell cycle regulation and lipid metabolism regulation

[0065] GO enrichment analysis was performed on all lncRNAs. The analysis results are detailed in Figure 4 As shown, from Figure 4 It can be seen that the top 15 lncRNA functions contained in the two adipose tissue exosome samples subjected to high-throughput sequencing include cell cycle, cell biogenesis, cell lipid metabolism, etc.

[0066] 1.4 RT-qPCR verification that SNHG16 is expressed at a higher level in AT-Exo than in ADSCs-Exo

[0067] RT-qPCR analysis of adipose tissue exosomes (AT-Exo) and adipose stem cell exosomes (ADSCs-Exo) showed that the expression level of SNHG16 in AT-Exo was significantly higher than that in ADSCs-Exo. Figure 5 shown.

[0068] The RT-qPCR detection method is described above, and the primer sequences used for amplification are shown in Table 1.

[0069] Table 1 Amplification primers for RT-qPCR detection of SNHG16 expression in AT-Exo and ADSCs-Exo

[0070] Primer name Primer number Primer sequences GAPDH-F SEQ ID NO.2 5'-ACAGCCTCAAGATCATCAGC-3' GAPDH-R SEQ ID NO.3 5'-GGTCATGAGTCCTTCCACGAT-3' SNHG16-F SEQ ID NO.4 5'-TGGTTGTTTCGTTTCTGGTGACTGAG-3' SNHG16-R SEQ ID NO.5 5'-GCAAGAGACTTCCTGAGGCACATC-3'

[0071] Example 2

[0072] Construction of lentiviral vector overexpressing LncRNA SNHG16

[0073] The present invention constructs the human LncRNA SNHG16 sequence into the PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector.

[0074] The build steps include:

[0075] Screening of LncRNA SNHG16.

[0076] The linearized PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector was obtained by enzyme digestion.

[0077] Homologous recombination was used to construct a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, which is a lentiviral vector overexpressing LncRNA SNHG16.

[0078] In the lentiviral vector overexpressing LncRNA SNHG16, PLVX is a lentiviral vector, and LncRNA SNHG16 is driven by the CMV promoter for expression; the CDGA-2A-PURO gene is driven by the EF1a promoter for expression, and has green fluorescence and puromycin resistance.

[0079] Specifically:

[0080] 1) Gene information: Homo sapiens small nucleolar RNA host gene 16 (SNHG16), transcript variant 2, long non-coding RNA, Sequence ID: NR_038109.1 (human LncRNA SNHG16, transcription splicing 2), the proposed insertion sequence is the full length of the gene.

[0081] 2) Lentivirus: The present invention uses pSPAX2 and pMD2.G packaging systems to package lentiviral vector plasmids, which can infect adipose mesenchymal stem cells (ADSCs).

[0082] 3) Promoter: The promoter used in the present invention is CMV, which can promote the expression of exogenous genes in ADSCs.

[0083] 4) Plasmid map, see Figure 6 shown.

[0084] 5) The sequence (plasmid sequence) of the lentiviral vector overexpressing LncRNA SNHG16 is shown in SEQ ID NO.1, wherein:

[0085] SEQ ID NO.1:

[0086] gaattc ctcgag catcatgtcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagataagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagt

[0087] It should be noted that the sequence represented by capital letters in the above plasmid sequence is the complete inserted SNHG16 sequence.

[0088] Example 3

[0089] Preparation of ADSCs cell line overexpressing LncRNA SNHG16

[0090] 3.1 Infection method

[0091] After the lentiviral vector plasmid overexpressing LncRNA SNHG16 was successfully constructed, the pSPAX2 and pMD2.G packaging systems were used for virus packaging, and then adipose stem cells were transfected to prepare ADSCs cell lines overexpressing LncRNA SNHG16. The specific operations are as follows: On the first day: group cells and plate them, and the number of cells is expected to reach the ideal adhesion rate (about 30-40%) in the second day of the experiment; On the second day: let the frozen virus solution stand on ice to thaw; calculate the volume of virus solution required for each well, dilute it in the required volume of culture medium for the well, and make the infection solution; add a certain volume ratio of polybrene (final concentration: 2-10μg / mL) to enhance the infection effect; aspirate the culture medium in the well and add the infection solution; culture overnight; On the third day: replace fresh culture medium and continue to culture in a 37℃, 5% CO2 incubator. Observe the green fluorescence expression on the fourth and fifth days under a fluorescence microscope, and take pictures to determine the efficiency of lentiviral infection. When the cells expressing green fluorescence reach more than 80%, collect the cells for relevant experimental detection.

[0092] In this embodiment, the MOI values ​​of the infection experiment are set to 0, 20, 50, 80 and 100, and the volume of the virus solution used is V (μL) = N×MOI / T, where N is the number of cells and T is the virus titer (TU / ml).

[0093] 3.2 Infection efficiency identification results

[0094] The fluorescence expression levels of adipose-derived stem cells transfected with lentivirus at different MOI values ​​are detailed in Figure 7 As shown, Figure 7 a, b, c, and d are the photos corresponding to MOI values ​​of 20, 50, 80, and 100, respectively. Figure 7 e, f, g, and h are the images under fluorescence microscope corresponding to MOI values ​​of 20, 50, 80, and 100, respectively.

[0095] The present invention determines the optimal MOI value of the experiment according to the amount of green fluorescence after transfection. Figure 7 It can be seen that when MOI=50, the infection efficiency is the highest.

[0096] 3.3 Verification of high expression of LncRNA SNHG16 in ADSCs by RT-qPCR

[0097] RT-qPCR analysis was performed on the expression of LncRNA-SNHG16 in the blank control group (ADSCs) of uninfected adipose-derived stem cells, SNHG16-16 empty lentivirus, and the negative control group (SNHG16 overexpression lentivirus) transfected with the LncRNA SNHG16 lentivirus vector. The results showed that the negative control group highly expressed LncRNA-SNHG16. For details, see Figure 8 shown.

[0098] The specific detection steps are as follows: extract total RNA from cells after transfection, reverse transcribe it into cDNA, prepare an amplification system, and place it in a PCR instrument for reaction. The PCR amplification primers are as follows:

[0099] The sequence of the forward primer F is shown in SEQ ID NO.6, and the sequence of the reverse primer R is shown in SEQ ID NO.7.

[0100] SEQ ID NO.6:

[0101] 5'-GTGGATCCGAGCTCGGTACCGCGTTCTTTCGAGGTCGGCCGCGTGG-3'.

[0102] SEQ ID NO.7:

[0103] 5'-ATATTTTATTACCGGTTTAATTAATGACGGTAGTTTCCCAAGTTTATTGTAAG-3'.

[0104] Example 4

[0105] Evaluation of proliferation activity of ADSCs cell lines overexpressing LncRNA SNHG16

[0106] After preparing the ADSCs cell line overexpressing SNHG16, CCK-8 and flow cytometry PI staining were used to evaluate the cell proliferation activity. The results are detailed in Figures 9 to 13 shown.

[0107] Fig. 9 This is the result of CCK-8 detection of cell proliferation activity after overexpression of SNHG16; Fig.10 This is the cell cycle fitting diagram after adipose stem cells were transfected with SNHG16 empty lentivirus. Fig.11 Adipose stem cells are the cell cycle fitting diagram after transfection with SNHG16 overexpression lentivirus; Fig.12 The results are from RT-qPCR detection of Ki67 and PCNA mRNA expression levels after transfection; Fig.13 This is the band diagram of Ki67 and PCNA proteins detected by Western blot after transfection; Fig.14The results of semi-quantitative gray value analysis of Ki67 and PCNA protein expression levels. (n=3, ** indicates P<0.01, *** indicates P<0.001)

[0108] from Fig. 9 It can be seen that after transfection with the SNHG16 overexpression vector, the proliferation activity of cells increased on days 5 and 7; Fig.10 and Fig.11 It can be seen that flow cell cycle PI staining showed that the number of cells in the S phase (proliferation phase) increased after overexpression of SNHG16; Fig.12 It can be seen that RT-qPCR showed that the expression levels of key cell cycle regulatory genes Ki67 and PCNA increased after transfection. Fig.13 and Fig.14 It can be seen that Western blot showed that the expression levels of key cell cycle proteins Ki67 and PCNA increased after transfection.

[0109] The RT-qPCR detection method is described above, and the primer sequences used for amplification are shown in Table 2.

[0110] Table 2 Amplification primers for RT-qPCR detection of Ki67 and PCNA mRNA expression levels after transfection

[0111] Primer name Primer number Primer sequences Ki67-F SEQ ID NO.8 5'-CAGGAAGTGGCAGAGGTAGGAC-3' Ki67-R SEQ ID NO.9 5'-GCTTGGTGGAATACTGAGACTGATG-3' PCNA-F SEQ ID NO.10 5'-GGTCTGGTGGAAGTGATGCTAATAG-3' PCNA-R SEQ ID NO.11 5'-TGAGACAGGAGAATTGCTTGAACC-3'

[0112] Example 5

[0113] Evaluation of adipogenic differentiation level of ADSCs cell lines overexpressing LncRNA SNHG16

[0114] After preparing the ADSCs cell line overexpressing SNHG16, Oil Red O staining, RT-qPCR, and Western blot were used to evaluate the adipogenic differentiation level of the cells. The results are detailed in Figure 15 to Figure 19 .

[0115] Fig.15 The results of Oil Red O staining to detect the lipid formation level in adipose stem cells after lentivirus transfection, where a and c are the Oil Red O staining in cells under a microscope at 100 times magnification, and b and d are the Oil Red O staining in cells under a microscope at 200 times magnification; Fig.16 It is the absorbance value at 520 nm after the cells were extracted with isopropanol and stained with Oil Red O; Fig.17 The results of RT-qPCR detection of PPAR-γ and CEBP-α mRNA expression levels after transfection; Fig.18 The band diagram of PPAR-γ and CEBP-α proteins after transfection was detected by Western blot; Fig.19The results of semi-quantitative gray value analysis of PPAR-γ and CEBP-α protein expression levels (n=3, * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001).

[0116] from Fig.15 It can be seen that after transfection with the SNHG16 overexpression vector, the number of intracellular lipid droplets increased; Fig.16 It can be seen that the level of lipid formation in transfected cells increased; Fig.17 It can be seen that RT-qPCR showed that the expression levels of PPAR-γ and CEBP-α, key regulatory genes for adipogenic differentiation, increased after transfection. Fig.18 and Fig.19 It can be seen that Western blot showed that the expression levels of PPAR-γ and CEBP-α, key proteins for adipogenic differentiation, increased after transfection.

[0117] The RT-qPCR detection method is described above, and the primer sequences used in PCR amplification are shown in Table 3.

[0118] Table 3 Amplification primers for RT-qPCR detection of PPAR-γ and CEBP-α mRNA expression levels after transfection

[0119]

[0120]

[0121] Example 6

[0122] Comparative experiment of plasmid transfection of ADSCs and lentivirus transfection of ADSCs

[0123] 1) Infection method:

[0124] About the plasmid infection method: Day 1: Group cells and plate them. The cell number is expected to reach the ideal adhesion rate (about 70-80%) in the experiment on the second day. Day 2: Vortex an appropriate amount of plasmid and serum-free culture medium in a centrifuge tube, add plasmid transfection reagent E-trans, vortex gently, leave at room temperature for 5-10 minutes, add dropwise to the cell culture dish, mix gently and place the cells in the incubator. After 24-48 hours, observe the green fluorescence expression under a fluorescence microscope and take pictures to determine the efficiency of plasmid infection.

[0125] Regarding the lentiviral infection method: see Example 3

[0126] 2) Identification of infection results:

[0127] The fluorescence expression level of plasmid-transfected adipose-derived stem cells under the microscope is detailed in Fig. 20 . Fig. 20a and b in the figure respectively show the conditions of cells under natural light and blue light (exciting green fluorescence) after transfection with SNHG16 empty plasmid under a microscope, and c and d respectively show the conditions of cells under natural light and blue light (exciting green fluorescence) after transfection with SNHG16 overexpression plasmid under a microscope.

[0128] The fluorescence expression level of lentiviral transfected adipose-derived stem cells under the microscope is detailed in Fig.21 . Fig.21 a and b in the figure respectively show the conditions of cells under natural light and blue light (exciting green fluorescence) after transfection with SNHG16 empty lentivirus under a microscope, and c and d respectively show the conditions of cells under natural light and blue light (exciting green fluorescence) after transfection with SNHG16 overexpression lentivirus under a microscope.

[0129] The present invention compares the transfection efficiency of plasmid and lentivirus by measuring the ratio of green fluorescence after transfection. Fig. 20 It can be seen that the proportion of cells expressing green fluorescence after SNHG16 empty-loaded and over-expressed plasmids were transfected into adipose-derived stem cells was less than 1%. Fig.21 It can be seen that after the SNHG16 empty-loaded and over-expressing lentivirus constructed in the present invention transfected adipose stem cells, the proportion of cells expressing green fluorescence was greater than 80%.

[0130] The above content is a further detailed description of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions and substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention.

Claims

1. Application of a lentiviral vector overexpressing LncRNA SNHG16 in engineering materials for repairing tissue defects.

2. The use according to claim 1, characterized in that: The tissue defect is a skin soft tissue defect.

3. The use according to claim 1, characterized in that: The LncRNA SNHG16 overexpression lentiviral vector is a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven to express by a CMV promoter, and the CDGA-2A-PURO gene is driven to express by an EF1A promoter, and has green fluorescence and puromycin resistance.

4. The use according to claim 3, characterized in that: The sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is shown in SEQ ID NO.

1.

5. The use according to any one of claims 1 to 4, characterized in that: The method for constructing the LncRNA SNHG16 overexpressing lentiviral vector comprises the following steps: Screening of LncRNA SNHG16; The linearized PLVX-EF1A-CDGA-2A-PURO-CMV-MCS vector was obtained by enzyme digestion; The PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector was constructed by homologous recombination, in which the SNHG16 insertion sequence was the full length of the gene.

6. Application of adipose-derived stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 in engineering materials for repairing tissue defects.

7. The use according to claim 6, characterized in that: The LncRNA SNHG16 overexpression lentiviral vector is a PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector, wherein PLVX is a lentiviral vector, SNHG16 is driven to express by a CMV promoter, and the CDGA-2A-PURO gene is driven to express by an EF1A promoter, and has green fluorescence and puromycin resistance.

8. The use according to claim 7, characterized in that: The sequence of the PLVX-EF1A-CDGA-2A-PURO-CMV-SNHG16 vector is shown in SEQ ID NO.

1.

9. The use according to claim 6, characterized in that: A method for preparing adipose stem cells containing a lentiviral vector overexpressing LncRNA SNHG16 comprises the following steps: Step (1), constructing a lentiviral vector overexpressing LncRNA SNHG16; Step (2), transfecting adipose stem cells with the LncRNA SNHG16 overexpression lentiviral vector constructed in step (1) to obtain adipose stem cells containing the LncRNA SNHG16 overexpression lentiviral vector.

10. The use according to claim 9, characterized in that: In the step (2), the MOI of lentiviral transfection is 50.

Images