A recombinant yeast for biosynthesizing inositol and its construction method and application

By integrating and knocking out specific genes in the Saccharomyces cerevisiae genome and combining it with CRISPR technology, we constructed an efficient recombinant Saccharomyces cerevisiae and used cheap glucose fermentation to produce inositol, solving the problems of high cost, low yield and environmental pollution in traditional methods and achieving efficient and safe inositol production.

CN118599687BActive Publication Date: 2025-09-05SHANGHAI RECOM BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202410682392.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-29
Publication Date
2025-09-05
Estimated Expiration
2044-05-29

AI Technical Summary

Technical Problem

The existing methods for producing inositol have problems such as high cost, low yield, environmental pollution and enzyme instability. Traditional hydrolysis and enzyme catalysis methods are difficult to meet the needs of green and sustainable production, and the inositol production by fermentation needs to be improved.

Method used

CRISPR gene editing technology was used to integrate the hexokinase gene hxk, inositol-3-phosphate synthase gene ino, and inositol monophosphatase gene suhb into the Saccharomyces cerevisiae genome, knock out the transcriptional repressor opi1 of inositol-3-phosphate synthase and the glucose-6-phosphate dehydrogenase gene zwf1, and integrate the inositol efflux protein genes ompf and ompc, so that inositol can be produced by fermentation using cheap glucose as a substrate.

Benefits of technology

The production efficiency and carbon source yield of inositol are improved, the production cost is reduced, the safety and high yield of the product are ensured, and green and sustainable inositol production is achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118599687B_ABST
    Figure CN118599687B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant saccharomyces cerevisiae for efficiently biosynthesizing inositol and its construction method and application, and belongs to the field of microbial genetic engineering. The recombinant saccharomyces cerevisiae of the present invention strengthens the expression of hexokinase gene hxk, inositol 3-phosphate synthase gene ino, inositol monophosphatase gene suhb, and realizes the rearrangement of glucose metabolism by knocking out the transcriptional repressor opi1 of inositol 3-phosphate synthase (Ino1) and glucose 6-phosphate dehydrogenase gene zwf1, and relieves feedback inhibition; In addition, the present invention further increases the yield of inositol by screening inositol external emission protein gene ompf, ompc and knocking out inositol internal transport protein gene itr1, itr2. The present invention realizes the efficient production of inositol (yield is as high as 195.7g / L), with good industrialization prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial genetic engineering, and in particular relates to a recombinant saccharomyces cerevisiae capable of efficiently biosynthesizing inositol, a construction method thereof and an application thereof. Background Art

[0002] Inositol, also known as cyclohexanehexaol and vitamin B8, is a water-soluble vitamin with multiple physiological functions. It is widely present in various foods, such as beans, meat, fish, eggs, and whole grain products. It serves as a growth factor for animals and microorganisms, and almost all organisms contain inositol in either free or bound form. In the pharmaceutical field, inositol is directly formulated into tablets for the treatment of diseases such as chronic interstitial hepatitis, fatty liver disease, and cirrhosis. In the food industry, inositol is often used in food supplements and nutritional fortifiers, and has been widely used in infant formula and health products. In the feed industry, inositol is an essential micronutrient for salmon, carp, tilapia, and shrimp, especially juvenile fish. The addition of inositol to fish and crustacean feed is considered safe and non-toxic at doses. Furthermore, adding appropriate amounts of inositol to cattle and sheep feed can promote milk synthesis and secretion, increasing milk production. In the cosmetics industry, inositol promotes cell growth and inhibits aging, while also brightening the skin. Products like SK-II's Ultra-Light, Olay's Illuminating Whitening Cream, and Shiseido's Lifting Eye and Face Cream all feature inositol as a star ingredient. Furthermore, as an essential vitamin, the body cannot synthesize it on its own and must obtain it through food or supplements. A deficiency in inositol can lead to health problems such as anemia and nervous system disorders. Therefore, maintaining an adequate inositol intake is crucial for maintaining good health.

[0003] The traditional method for producing inositol is pressurized acid hydrolysis of phytate. However, although the hydrolysis method for synthesizing inositol is mature and resource-rich, it has the disadvantages of high cost and low yield, and the acid-base reagents used will cause certain pollution to the environment. At present, many pathways for synthesizing inositol by in vitro enzymatic catalysis have been reported. For example, by designing multi-layer microalgae capsules to immobilize the five-step enzyme from maltodextrin to inositol, the half-life of the enzyme is greatly delayed, and the accumulation of 210g / L inositol is achieved within 216 hours (Chemical Engineering Journal, 2023, 461: 141946.). In addition, a three-enzyme cascade reaction consisting of polyphosphoglucokinase (PPGK) from Arthrobacter brucei, inositol 1-phosphate synthase (IPS) from Trypanosoma brucei, and inositol monophosphatase (IMP) from Escherichia coli can convert glucose into inositol with a yield of 90% and a yield of 110g / L (Enzyme & Microbial Technology, 2018, 112: 1-5.). However, while in vitro enzymatic synthesis of inositol offers high titers and yields, it suffers from issues such as enzyme instability and complex separation processes. Therefore, utilizing advanced biotechnology to synthesize inositol via fermentation offers a promising alternative to traditional hydrolysis and enzymatic methods, offering a green and sustainable alternative.

[0004] Patent application number 202210870907.8 discloses a recombinant yeast strain H that improves the production of inositol synthesis, and discloses a method for producing inositol by fermenting recombinant yeast strain H using non-food low-carbon carbon sources such as acetic acid, methanol, ethanol, propanol, and glycerol. The construction method of the recombinant yeast strain H is as follows: a) knocking out the genes encoding glucokinase and related hexokinase isozymes in Saccharomyces cerevisiae / methanol yeast to obtain a recombinant yeast strain A that is defective in glucose utilization and has the ability to secrete glucose; the recombinant yeast strain A optionally knocks out the isozyme gene of hexokinase, overexpresses glucose phosphatase and HAD4 of Escherichia coli, Alternatively, HAD4 of Escherichia coli is overexpressed to obtain a recombinant yeast strain E with increased glucose synthesis yield; b) the endogenous yeast gene reg1 is knocked out from the recombinant yeast strain B to obtain a recombinant yeast strain F with increased glucosamine synthesis yield; c) the glucose pyrophosphorylase GlgC mutant and UGP1 are inserted into the recombinant yeast strain C to increase the precursor substances ADP-Glc and UDP-Glc, respectively, to obtain a recombinant yeast strain G with increased sucrose synthesis yield; d) the recombinant yeast strain D is knocked out of phosphofructokinase 1 and phosphofructokinase 2 and overexpressed glutamate transhydrogenase GDH1 to obtain a recombinant yeast strain H with increased inositol synthesis yield. However, on the one hand, the low-carbon non-food carbon source substrates used in the above methods, either photoelectrocatalytically or synthesized by traditional chemical methods, are all non-natural chemical products, and the steps for preparing the substrates are cumbersome and energy-intensive; on the other hand, the yield of inositol obtained by fermentation using the above methods is only 228.71 mg / L, and the yield needs to be further improved. Summary of the Invention

[0005] In order to solve the above problems existing in the prior art, the purpose of the present invention is to provide a recombinant Saccharomyces cerevisiae for efficient biosynthesis of inositol and a construction method and application thereof.

[0006] The invention provides a recombinant yeast of cerevisiae, which is obtained by taking yeast of cerevisiae as a host and integrating and expressing a hexokinase gene hxk, an inositol-3-phosphate synthase gene ino and an inositol monophosphatase gene suhb on the genome.

[0007] Furthermore, the hxk and ino are derived from Saccharomyces cerevisiae, and suhb is derived from Escherichia coli. The nucleotide sequence of hxk is shown in SEQ ID NO.1, the nucleotide sequence of ino is shown in SEQ ID NO.2, and the nucleotide sequence of suhb is shown in SEQ ID NO.3.

[0008] Furthermore, the integrated expression number of hxk is 1 copy, and the integrated expression number of ino and suhb is 1-6 copies, preferably 5 copies.

[0009] Furthermore, it also knocked out the transcriptional repressor opi1 of inositol-3-phosphate synthase and the glucose-6-phosphate dehydrogenase gene zwf1 in the genome;

[0010] and / or, it also knocks out the inositol transporter genes itr1 and itr2 in the genome;

[0011] And / or, it further integrates and expresses the inositol efflux protein genes ompf and ompc on the genome.

[0012] Furthermore, the nucleotide sequence of opi1 is shown in SEQ ID NO.6, and the nucleotide sequence of zwf1 is shown in SEQ ID NO.7;

[0013] and / or, the nucleotide sequence of itr1 is shown as SEQ ID NO.8, and the nucleotide sequence of itr2 is shown as SEQ ID NO.9;

[0014] And / or, the ompf and ompc are derived from Escherichia coli, the nucleotide sequence of ompf is shown as SEQ ID NO.4, and the nucleotide sequence of ompc is shown as SEQ ID NO.5.

[0015] Furthermore, the integrated expression number of ompf and ompc is 1-3 copies, preferably 2 copies.

[0016] The present invention also provides a method for constructing the above-mentioned recombinant Saccharomyces cerevisiae, which comprises the following steps: using Saccharomyces cerevisiae as a host, integrating, expressing and / or knocking out the above-mentioned corresponding genes in the genome to obtain recombinant Saccharomyces cerevisiae.

[0017] Furthermore, the integrated expression and / or knockout method is CRISPR gene editing technology.

[0018] The present invention also provides the use of the recombinant cerevisiae yeast in biosynthesis of inositol.

[0019] The present invention also provides a method for biosynthesizing inositol, which comprises utilizing the recombinant cerevisiae yeast to ferment and produce inositol.

[0020] Furthermore, the method comprises the following steps: 1. seed liquid OD 600 When the seed solution is between 6 and 8, inoculate 5%-20% into the second-level seed bottle. The second-level seed solution OD 600 At 20-30°C, inoculate 5%-20% of the inositol into a fermentation tank containing fermentation medium, add antibiotics and trace elements, and collect inositol after fermentation.

[0021] Preferably, the formula of the fermentation medium is: 4-8 g / L Na2HPO4, 2-4 g / L KH2PO4, 0.5-1.5 g / L NaCl, 8-16 g / L (NH4)2SO4, 60-100 g / L glucose, 10-30 g / L yeast extract, 5-20 g / L corn steep liquor powder, and 1-2 g / L citric acid;

[0022] The formula of the trace elements is: 0.01-0.1 mg / L H3BO3, 0.1-1 mg / L CuCl2, 0.1-1 mg / L Na2EDTA, 0.1-1 mg / L CoCl2, 0.5-2 mg / L ZnCl2, 1-3 mg / L MnCl2, 1-4 mg / L FeCl2;

[0023] The formula of the antibiotics is: 0.01-0.1 mg / L hygromycin, 0.01-0.1 mg / L geneticin;

[0024] The fermentation conditions are as follows: temperature of 28-33°C, pH of 5-6, dissolved oxygen of 30%-40%, and tank pressure of 0-5 Pa;

[0025] During the fermentation process, the glucose concentration was controlled below 20 g / L, and 4 g / L (NH4)2SO4 was added every 24 h during the fermentation process;

[0026] The total fermentation time is within 150 hours, preferably 60-96 hours.

[0027] The beneficial effects achieved by the present invention are:

[0028] (1) The present invention uses Saccharomyces cerevisiae as the production host. Saccharomyces cerevisiae is a recognized food safety strain, which ensures the safe application of inositol in the fields of food, feed, etc.

[0029] (2) The present invention uses cheap glucose as a substrate, thereby reducing production costs.

[0030] (3) The present invention greatly promotes the production of inositol by enhancing the expression of the hexokinase gene hxk, the inositol-3-phosphate synthase gene ino, and the inositol monophosphatase gene suhb.

[0031] (4) The inositol efflux protein genes ompf and ompc screened by the present invention have never appeared in any reports related to inositol production. This is a unique and innovative application and has groundbreaking significance for the industrial production of inositol.

[0032] (5) The present invention effectively increases the production of inositol and the carbon source yield by knocking out the transcriptional repressor opi1 of inositol-3-phosphate synthase (Ino1), the glucose-6-phosphate dehydrogenase gene zwf1, and the inositol transporter genes itr1 and itr2.

[0033] (6) The inositol production method provided by the present invention has the advantages of low cost, high output, and high carbon source yield, laying a foundation for the industrial production of inositol.

[0034] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0035] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 : Schematic diagram of the inositol production pathway. DETAILED DESCRIPTION

[0037] The raw materials and equipment used in the present invention are all known products and are obtained by purchasing commercially available products.

[0038] The nucleotide sequences involved in the following examples are as follows:

[0039] Gene hxk nucleotide sequence (SEQ ID NO.1):

[0040]

[0041] Gene ScINO1 (abbreviated as ino) nucleotide sequence (SEQ ID NO.2):

[0042]

[0043] Nucleotide sequence of gene EcsuhB (abbreviation suhb) (SEQ ID NO.3):

[0044] ATGCATCCGATGCTGAACATCGCCGTGCGCGCAGCGCGCAAGGCGGGTAATTTAATTGCCAAAAACTATGAAACCCCGGACGCTGTAGAAGCGAGCCAGAAAGGCAGTAACGATTTCGTGACCAACGTAGATAAAGCTGCCGAAGCGGTGATTATCGACACGATTCGTAAATCTTACCCACAGCACACCATCATCACCGAAGAAAGCGGTGAACTTGAAGGTACTGATCAGGATGTTCAATGGGTTATTGATCCACTGGATGGCACTACCAACTTTATCAAACGTCTGCCGCACTTCGCGGTATCTATCGCCGTTCGTATCAAAGGCCGCACCGAAGTTGCTGTGGTATACGATCCTATGCGTAACGAACTGTTCACCGCCACTCGCGGTCAGGGCGCACAGCTGAACGGCTACCGTCTGCGCGGCAGCACCGCTCGCGATCTCGACGGTACTATTCTGGCGACCGGCTTCCCGTTCAAAGCAAAACAGTACGCCACTACCTACATCAACATCGTCGGCAAACTGTTCAACGAATGTGCAGACTTCCGTCGTACCGGTTCTGCGGCGCTGGATCTGGCTTACGTCGCTGCGGGTCGCGTTGACGGTTTCTTTGAAATCGGTCTGCGCCCGTGGGACTTCGCCGCAGGCGAGCTGCTGGTTCGTGAAGCGGGCGGCATCGTCAGCGACTTCACCGGTGGTCATAACTACATGCTGACCGGTAACATCGTTGCTGGTAACCCGCGCGTTGTTAAAGCCATGCTGGCGAACATGCGTGACGAGTTAAGCGACGCTCTGAAGCGTTAA

[0045] Nucleotide sequence of gene ompf (SEQ ID NO.4):

[0046]

[0047] Gene ompc nucleotide sequence (SEQ ID NO.5):

[0048] ATGAAAGTTAAAGTACTGTCCCTCCTGGTCCCAGCTCTGCTGGTAGCAGGCGCAGCAAACGCTGCTGAAGTTTACAACAAAGACGGCAACAAATTAGATCTGTACGGTAAAGTAGACGGCCTGCACTATTTCTCTGACAACAAAGATGTAGATGGCGACCAGACCTACATGCGTCTTGGCTTCAAAGGTGAAACTCAGGTTACTGACCAGCTGACCGGTTACGGCCAGTGGGAATATCAGATCCAGGGCAACAGCGCTGAAAACGAAAACAACTCCTGGACCCGTGTGGCATTCGCAGGTCTGAAATTCCAGGATGTGGGTTCTTTCGACTACGGTCGTAACTACGGCGTTGTTTATGACGTAACTTCCTGGACCGACGTACTGCCAGAATTCGGTGGTGACACCTACGGTTCTGACAACTTCATGCAGCAGCGTGGTAACGGCTTCGCGACCTACCGTAACACTGACTTCTTCGGTCTGGTTGACGGCCTGAACTTTGCTGTTCAGTACCAGGGTAAAAACGGCAACCCATCTGGTGAAGGCTTTACTAGTGGCGTAACTAATAACGGTCGTGACGCACTGCGTCAAAACGGCGACGGCGTCGGCGGTTCTATCACTTATGATTACGAAGGTTTCGGTATCGGTGGTGCGATCTCCAGCTCCAAACGTACTGATGCTCAGAACACCGCTGCTTACATCGGTAACGGCGACCGTGCTGAAACCTACACTGGTGGTCTGAAATACGACGCTAACAACATCTACCTGGCTGCTCAGTACACCCAGACCTACAACGCAACTCGCGTAGGTTCCCTGGGTTGGGCGAACAAAGCACAGAACTTCGAAGCTGTTGCTCAGTACCAGTTCGACTTCGGTCTGCGTCCGTCCCTGGCTTACCTGCAGTCTAAAGGTAAAAACCTGGGTCGTGGCTACGACGACGAAGATATCCTGAAATATGTTGATGTTGGTGCTACCTACTACTTCAACAAAAACATGTCCACCTACGTTGACTACAAAATCAACCTGCTGGACGACAACCAGTTCACTCGTGACGCTGGCATCAACACTGATAACATCGTAGCTCTGGGTCTGGTTTACCAGTTCTAA

[0049] Nucleotide sequence of gene opi1 (SEQ ID NO.6):

[0050]

[0051] Gene zwf1 nucleotide sequence (SEQ ID NO.7):

[0052] ATGAGTGAAGGCCCCGTCAAATTCGAAAAAAATACCGTCATATCTGTCTTTGGTGCGTCAGGTGATCTGGCAAAGAAGAAGACTTTTCCCGCCTTATTTGGGCTTTTCAGAGAAGGTTACCTTGATCCATCTACCAAGATCTTCGGTTATGCCCGGTCCAAATTGTCCATGGAGGAGGACCTGAAGTCCCGTGTCCTACCCCACTTGAAAAAACCTCACGGTGAAGCCGATGACTCTAAGGTCGAACAGTTCTTCAAGATGGTCAGCTACATTTCGGGAAATTACGACACAGATGAAGGCTTCGACGAATTAAGAACGCAGATCGAGAAATTCGAGAAAAGTGCCAACGTCGATGTCCCACACCGTCTCTTCTATCTGGCCTTGCCGCCAAGCGTTTTTTTGACGGTGGCCAAGCAGATCAAGAGTCGTGTGTACGCAGAGAATGGCATCACCCGTGTAATCGTAGAGAAACCTTTCGGCCACGACCTGGCCTCTGCCAGGGAGCTGCAAAAAAACCTGGGGCCCCTCTTTAAAGAAGAAGAGTTGTACAGAATTGACCATTACTTGGGTAAAGAGTTGGTCAAGAATCTTTTAGTCTTGAGGTTCGGTAACCAGTTTTTGAATGCCTCGTGGAATAGAGACAACATTCAAAGCGTTCAGATTTCGTTTAAAGAGAGGTTCGGCACCGAAGGCCGTGGCGGCTATTTCGACTCTATAGGCATAATCAGAGACGTGATGCAGAACCATCTGTTACAAATCATGACTCTCTTGACTATGGAAAGACCGGTGTCTTTTGACCCGGAATCTATTCGTGACGAAAAGGTTAAGGTTCTAAAGGCCGTGGCCCCCATCGACACGGACGACGTCCTCTTGGGCCAGTACGGTAAATCTGAGGACGGGTCTAAGCCCGCCTACGTGGATGATGACACTGTAGACAAGGACTCTAAATGTGTCACTTTTGCAGCAATGACTTTCAACATCGAAAACGAGCGTTGGGAGGGCGTCCCCATCATGATGCGTGCCGGTAAGGCTTTGAATGAGTCCAAGGTGGAGATCAGACTGCAGTACAAAGCGGTCGCATCGGGTGTCTTCAAAGACATTCCAAATAACGAACTGGTCATCAGAGTGCAGCCCGATGCCGCTGTGTACCTAAAGTTTAATGCTAAGACCCCTGGTCTGTCAAATGCTACCCAAGTCACAGATCTGAATCTAACTTACGCAAGCAGGTACCAAGACTTTTGGATTCCAGAGGCTTACGAGGTGTTGATAAGAGACGCCCTACTGGGTGACCATTCCAACTTTGTCAGAGATGACGAATTGGATATCAGTTGGGGCATATTCACCCCATTACTGAAGCACATAGAGCGTCCGGACGGTCCAACACCGGAAATTTACCCCTACGGATCAAGAGGTCCAAAGGGATTGAAGGAATATATGCAAAAACACAAGTATGTTATGCCCGAAAAGCACCCTTACGCTTGGCCCGTGACTAAGCCAGAAGATACGAAGGATAATTAG

[0053] Nucleotide sequence of gene itr1 (SEQ ID NO.8):

[0054]

[0055] Gene itr2 nucleotide sequence (SEQ ID NO.9):

[0056]

[0057] The molecular biology experimental procedures involved in the Examples and Experimental Examples of the present invention include gene synthesis (Qingke Biotechnology), PCR, enzyme digestion, ligation, chemical transformation, enzyme digestion verification, electroporation, and fermentation. DNA polymerase, DNA restriction endonuclease, plasmid construction DNA ligase, and homologous recombination enzyme were used for plasmid vector construction and were purchased from Thermo Fisher Scientific. Plasmid miniprep kits and gel recovery kits were purchased from Novozymes Biotech Co., Ltd.

[0058] The HPLC detection of inositol and glucose in the embodiments of the present invention and the experimental examples is to use a high performance liquid chromatography equipped with a Waters Sugar-PakTMI chromatographic column (300mm×6.5mm) and a refractive index detector to analyze and quantify inositol and glucose. Standards and samples are centrifuged at 12000rpm for 2min, and the supernatant is filtered through a 0.22μm organic filter membrane. Detection method: The mobile phase is ultrapure water, the flow rate is 0.4ml / min, and the column temperature is set to 70°C. The elution times of inositol and glucose are 15.97 and 12.25min, respectively.

[0059] Example 1: Construction of recombinant Saccharomyces cerevisiae

[0060] The initial brewer's yeast used in the experiment was a brewer's yeast in which the expression of hxk had been enhanced, and the method used to enhance the expression of hxk was CRISPR gene editing technology.

[0061] Using the original Saccharomyces cerevisiae with enhanced expression of hxk as the host, five copies of the ino and suhb genes were integrated into the genome to obtain recombinant Saccharomyces cerevisiae.

[0062] The gene editing method used in this experiment is CRISPR gene editing technology. The specific steps are as follows:

[0063] 1. Take 25 mL of the initial Saccharomyces cerevisiae culture solution (OD600 = 0.8-1.0) and centrifuge (2500-3000 rpm, 4°C, 3 min).

[0064] 2. Wash the cells with 20 mL of ice-cold sorbitol and centrifuge.

[0065] 3. Resuspend the cells in 16 mL of 1 M sorbitol, 2 mL of 10× TE, and 2 mL of 10× LiOAc.

[0066] 4. Place the 50 mL centrifuge tube incubated at 30°C, 200 rpm, with shaking for 30 min.

[0067] 5. Add 200 μL 1 M DTT and incubate at 30°C, 200 rpm, with shaking for 15 min.

[0068] 6. Centrifuge (2500-3000 rpm, 4°C, 3 min).

[0069] 7. Wash the cells twice with 20 mL of ice-cold sorbitol.

[0070] 8. Remove the supernatant and remove the remaining liquid with a pipette, then add 500 μL of iceberg sorbitol to resuspend the cells.

[0071] 9. Take 100 μL of competent cells and add 1-1.5 μg of plasmid carrying the cas9 gene and 2.5-4 μg of the gene fragment DNA to be integrated (the upstream and downstream homology arms and reading frames are recombined together through overlap technology to form a linear DNA fragment). The volume of DNA added should not exceed 10 μL.

[0072] 10. Use a 0.2 cm electroporation cuvette at 1.5 kV. Immediately after electroporation, add 500 μL of iceberg sorbitol to the cuvette. Transfer the cells to a sterile centrifuge tube and resuspend them at 30°C, 200 rpm for 1 hour.

[0073] 11. Directly aspirate 200 μL or take 100 μL of competent cells after centrifugation and spread them on the screening plate.

[0074] Example 2: Construction of recombinant Saccharomyces cerevisiae with high inositol production

[0075] The zwf1 and opi1 genes were knocked out from the genome of the recombinant Saccharomyces cerevisiae constructed in Example 1 to obtain a recombinant Saccharomyces cerevisiae. The knockout method was similar to the CRISPR gene editing technology in Example 1, except that the target linear DNA fragment was different.

[0076] Example 3: Construction of recombinant Saccharomyces cerevisiae with high inositol production

[0077] The itr1 and itr2 genes were knocked out from the genome of the recombinant Saccharomyces cerevisiae constructed in Example 2 to obtain a recombinant Saccharomyces cerevisiae. The knockout method was similar to the CRISPR gene editing technology in Example 1, except that the target linear DNA fragment was different.

[0078] Example 4: Construction of recombinant Saccharomyces cerevisiae with high inositol production

[0079] One copy of the ompf and ompc genes was integrated into the genome of the recombinant Saccharomyces cerevisiae constructed in Example 3 to obtain a recombinant Saccharomyces cerevisiae. The integration method was similar to the CRISPR gene editing technology in Example 1, except that the target linear DNA fragment was different.

[0080] Example 5: Construction of recombinant Saccharomyces cerevisiae with high inositol production

[0081] Two copies of the ompf and ompc genes were integrated into the genome of the recombinant Saccharomyces cerevisiae constructed in Example 3 to obtain a recombinant Saccharomyces cerevisiae. The integration method was similar to the CRISPR gene editing technology in Example 1, except that the target linear DNA fragment was different.

[0082] Example 5: Synthesis of inositol by fed-batch fermentation in a 3 L fermenter

[0083] The recombinant Saccharomyces cerevisiae strain with high inositol production obtained in Example 4 was used to biosynthesize inositol in a 3 L fermenter. The initial volume of the fermentation medium was 2 L, the fermentation temperature was 33°C, the pH was 6, the dissolved oxygen was 40%, and the tank pressure was 5 Pa. The OD value of the first-stage seed solution was 0.01. 600 At 8 o'clock, inoculate 20% into the second-level seed bottle, and the second-level seed liquid OD 600 At 30:00, 20% of the fermentation mixture was inoculated into the fermenter, along with the appropriate antibiotics and trace elements. During the fermentation process, the glucose concentration was controlled below 20 g / L, and samples were taken every 12 hours for HPLC analysis. Every 24 hours during the fermentation process, 4 g / L (NH₄)₂SO₄ was added, with the total fermentation time being controlled within 150 hours.

[0084] The trace element formula is: 0.1mg / L H3BO3, 1mg / L CuCl2, 1mg / LNa2EDTA, 1mg / L CoCl2, 2mg / LZnCl2, 3mg / LMnCl2, 4mg / LFeCl2.

[0085] The fermentation medium formula is: 8g / LNa2HPO4, 4g / LKH2PO4, 1.5g / LNaCl, 16g / L(NH4)2SO4, 100g / L glucose, 30g / L yeast extract, 20g / L corn steep liquor powder, and 2g / L citric acid.

[0086] The antibiotic formula is: 0.1 mg / L hygromycin, 0.1 mg / L G418 (Geneticin).

[0087] As shown in Table 1, the OD values ​​of the Saccharomyces cerevisiae strains were 600It reached 277.9, and the production of inositol reached 195.7g / L, which is the highest yield reported so far through biosynthesis. At the same time, the yield of the carbon source reached 42.3% in 96 hours, indicating that most of the substrate glucose was metabolized to the inositol pathway after being used for biomass synthesis. It is worth mentioning that during the fermentation process, the carbon source yield was as high as 46.8% at 72 hours, and gradually decreased in subsequent fermentations. At the same time, according to the HPLC test results, after 72 hours, acetic acid began to accumulate in the fermentation broth, indicating that in the later fermentation, the inositol synthesis pathway was weaker than that of glucose to acetic acid, resulting in the accumulation of acetic acid and a decrease in the carbon source yield.

[0088] Table 1 Fed-batch biosynthesis of inositol

[0089] Time (h) <![CDATA[OD 600 ]]> Inositol yield g / L Carbon source yield% 0 0.8 0 0 6 3.6 1.2 26.9% 12 15.2 8.3 32.2% 24 45.6 20.5 36.8% 36 72.4 47.4 39.9% 48 118.4 80.8 43.1% 60 163.1 121.8 45.5% 72 239.8 163.4 46.8% 84 271.7 188.6 46.4% 96 277.9 195.7 42.3%

[0090] In this example, a method for synthesizing inositol by fed-batch fermentation in a fermenter using a recombinant inositol-producing Saccharomyces cerevisiae strain was used to achieve an inositol yield of 195.7 g / L, the highest yield to date.

[0091] The beneficial effects of the present invention are demonstrated by experimental examples below.

[0092] Experimental Example 1: Optimization of the Inositol Biosynthesis Pathway Flux in Saccharomyces cerevisiae

[0093] This experiment first tested the inositol production performance of a naive strain of Saccharomyces cerevisiae (enhanced HXK expression) in shake flasks. The shake flask medium consisted of 10 g / L yeast extract, 20 g / L peptone, 40 g / L glucose, and 5 g / L NaCl. The culture conditions were 30°C, 220 rpm, and 72 hours. As shown in Table 2, the naive strain (group MI0, enhanced HXK expression) produced only a negligible amount of inositol (2 mg / L) after 72 hours. This result suggests that although Saccharomyces cerevisiae is a natural inositol producer and has enhanced the conversion of glucose to glucose-6-phosphate, its native pathway is still weak and requires further molecular biological modification.

[0094] To enhance inositol synthesis, this experiment compared three inositol-3-phosphate synthases: ScINO1 (Saccharomyces cerevisiae), SsINO1 (Pichia stipitis), and KmINO1 (Kluyveromyces marxianus). Furthermore, three inositol monophosphatases: ScINM1 or ScINM2 (Saccharomyces cerevisiae) and EcsuhB (E. coli) were also compared. These six different enzymes were integrated into the genome and overexpressed. Their effects on inositol production were then verified through shake flask fermentation experiments (using the same fermentation conditions as group MIO). As shown in Table 2, ScINO1, endogenous to S. cerevisiae, exhibited superior inositol-3-phosphate synthase activity compared to SsINO1 (Pichia stipitis) and KmINO1 (Kluyveromyces marxianus), producing 52 mg / L of inositol. In contrast, the inositol-3-phosphate synthases derived from SsINO1 (Pichia stipitis) and KmINO1 (Kluyveromyces marxianus) produced 38 mg / L and 27 mg / L, respectively. Comparison of three inositol monophosphatases, ScINM1, ScINM2, and EcsuhB, revealed that EcsuhB exhibited superior inositol monophosphatase activity compared to ScINM1 and ScINM2, producing 35 mg / L of inositol, compared to only 17 mg / L and 22 mg / L of inositol produced by ScINM1 and ScINM2, respectively. This result not only provides the optimal inositol biosynthesis enzyme, but also suggests that enhancing the expression of the inositol biosynthesis pathway is a powerful approach to promote efficient inositol synthesis.

[0095] According to the above experiments, ScINO1 from Saccharomyces cerevisiae and EcsuhB from Escherichia coli were co-expressed. As shown in Table 2, after integrating one copy of ScINO1-EcsuhB, S. cerevisiae produced 433 mg / L of inositol in a shake flask. Therefore, to enhance inositol production, multiple copies of ScINO1-EcsuhB were integrated. After integrating a total of five copies, the shake flask yield of inositol reached 3627 mg / L. Unfortunately, although a sixth copy was subsequently integrated, inositol production actually decreased (to 3415 mg / L), indicating that after integrating five copies of ScINO1-EcsuhB, it was not the strength of the inositol pathway that limited inositol production.

[0096] Table 2 Optimization of inositol biosynthesis flux in Saccharomyces cerevisiae

[0097]

[0098] The above experimental results show that using the initial Saccharomyces cerevisiae with enhanced HXK expression as the host and integrating 5 copies of ScINO1 and EcsuhB genes into the genome, the recombinant Saccharomyces cerevisiae (group MI11) can significantly increase inositol production.

[0099] Experimental Example 2 Effect of Glucose Metabolic Flux Rearrangement on Inositol Production in Saccharomyces cerevisiae

[0100] Based on the recombinant Saccharomyces cerevisiae (group MI11) obtained in Experimental Example 1, this experiment further knocked out the 6-phosphoglucose isomerase gene pgi1 and the glucose-6-phosphate dehydrogenase gene zwf1 to redirect glucose metabolism toward the inositol pathway. Shake flask fermentation experiments (using the same fermentation conditions as group MI0) were then conducted to verify the effects on inositol production.

[0101] The results are shown in Table 3. Knockout of the 6-phosphoglucose isomerase gene pgi1 not only did not increase the production of inositol, but reduced its yield (1842 mg / L). The reason is that the knockout of the 6-phosphoglucose isomerase gene pgi1 seriously affected the growth of Saccharomyces cerevisiae. The OD value of the 6-phosphoglucose isomerase gene was 1842 mg / L after 72 hours. 600 Only 15, compared with strain MI11 (OD 600 36), the growth decreased by 58.3%. However, knockout of the glucose-6-phosphate dehydrogenase gene zwf1 had no effect on the growth of the Saccharomyces cerevisiae strain. The OD 600 The inositol production reached 4732 mg / L, which was 30.5% higher than that of strain MI11. This result indicates that rearrangement of glucose metabolic flux is crucial for the production of inositol.

[0102] To relieve the inhibitory effect of OPI1 on inositol production, this experiment further knocked out the opi1 gene. The effect on inositol production was then verified through shake flask fermentation experiments (using the same conditions as group MI0). As shown in Table 3, knocking out the opi1 gene significantly increased inositol production, reaching 6281 mg / L in 72 hours.

[0103] Table 3 Effects of glucose metabolic flux rearrangement on inositol production in Saccharomyces cerevisiae

[0104]

[0105] The above experimental results show that knocking out the zwf1 and opi1 genes in the genome of the recombinant Saccharomyces cerevisiae (group MI11) constructed in Experimental Example 1 can further significantly increase the inositol production in the resulting recombinant Saccharomyces cerevisiae (group MI15).

[0106] Experimental Example 3 Effect of inositol transporter on inositol production

[0107] The transporter genes itr1 and itr2 in Saccharomyces cerevisiae encode the inositol internal transporters ITR1 and ITR2. These two channel proteins transport inositol from the extracellular space into the cell, thereby increasing the intracellular concentration of inositol. This can further inhibit the inositol biosynthesis pathway or increase the biotoxicity of inositol. Therefore, knocking out the itr1 and itr2 genes may release feedback inhibition and eliminate biotoxicity, thereby promoting inositol production.

[0108] On the basis of the recombinant saccharomyces cerevisiae (group MI15) obtained in experimental example 2, the transporter genes itr1 and itr2 in the genome were knocked out respectively, and then the impact on inositol production was verified by shake flask fermentation experiments (shake flask fermentation conditions were the same as group MI0). As shown in Table 4, the production of inositol was further enhanced, and 6828mg / L and 7108mg / L inositol were synthesized in 72 hours, respectively, which were increased by 8.7% and 13.2% respectively compared to strain MI15. Further, after knocking out genes itr1 and itr2 together, strain MI18 produced 8335mg / L inositol in 72 hours, which was increased by 32.7% compared to strain MI15. This result shows that excessive inositol concentration in the cell will seriously affect the production performance of the strain, and the possible mechanism is product feedback inhibition or biological toxicity.

[0109] In view of this, in order to further reduce the concentration of intracellular inositol, the expression of inositol external emission proteins is an effective strategy. The present invention screened out the cell membrane channel protein genes ompf and ompc from Escherichia coli through a large number of experiments. After the genes ompf and ompc were respectively integrated into the Saccharomyces cerevisiae genome, shake flask fermentation verification was carried out (shake flask fermentation conditions were the same as those of group MI0). As shown in Table 4, the integration of genes ompf and ompc effectively enhanced the production of inositol, with inositol yields reaching 8946mg / L and 8715mg / L respectively. Further, the genes ompf and ompc were integrated together. When one copy was integrated, the production of inositol reached 9273mg / L, an increase of 11.3% compared to strain MI18. When two copies were integrated, the production of inositol reached 9884mg / L, an increase of 18.6% compared to strain MI18. Unfortunately, after the third copy number was integrated, inositol production did not increase significantly (9873 mg / L), indicating that the transport capacity of the inositol transporter was already greater than its production capacity. These results indicate that increasing inositol excretion and reducing inositol internalization are effective methods for increasing inositol production.

[0110] Table 4 Effect of inositol transporters on inositol production

[0111]

[0112] The above experimental results show that knocking out the itr1 and itr2 genes and integrating the ompf and ompc genes in the genome of the recombinant Saccharomyces cerevisiae constructed in Experimental Example 2 (group MI15) significantly increased inositol production. In particular, when two copies of the ompf and ompc genes were integrated (group MI22), inositol production was the highest.

Claims

1. A recombinant saccharomyces cerevisiae for biosynthesis of inositol, characterized in that: The invention uses Saccharomyces cerevisiae as a host, integrates and expresses a hexokinase gene hxk, an inositol-3-phosphate synthase gene ino, and an inositol monophosphatase gene suhb in the genome, knocks out an inositol-3-phosphate synthase transcriptional inhibitor opi1 and a glucose-6-phosphate dehydrogenase gene zwf1 in the genome, knocks out inositol internal transporter genes itr1 and itr2 in the genome, and integrates and expresses inositol external emission protein genes ompf and ompc in the genome; the integrated expression number of hxk is 1 copy, the integrated expression number of ino and suhb is 5 copies, and the integrated expression number of ompf and ompc is 2 copies; The hxk and ino are derived from Saccharomyces cerevisiae, and suhb is derived from Escherichia coli. The nucleotide sequence of hxk is shown in SEQ ID NO.1, the nucleotide sequence of ino is shown in SEQ ID NO.2, and the nucleotide sequence of suhb is shown in SEQ ID NO.3; The nucleotide sequence of opi1 is shown in SEQ ID NO.6, and the nucleotide sequence of zwf1 is shown in SEQ ID NO.7; The nucleotide sequence of itr1 is shown in SEQ ID NO.8, and the nucleotide sequence of itr2 is shown in SEQ ID NO.9; The ompf and ompc are derived from Escherichia coli, the nucleotide sequence of ompf is shown in SEQ ID NO.4, and the nucleotide sequence of ompc is shown in SEQ ID NO.

5.

2. A method for constructing the recombinant Saccharomyces cerevisiae according to claim 1, characterized in that: The method comprises the following steps: using Saccharomyces cerevisiae as a host, integrating, expressing and knocking out the corresponding gene according to claim 1 on the genome to obtain recombinant Saccharomyces cerevisiae.

3. Use of the recombinant Saccharomyces cerevisiae according to claim 1 in the biosynthesis of inositol.

4. A method for biosynthesizing inositol, characterized in that: The method is to produce inositol by fermentation using the recombinant cerevisiae yeast according to claim 1.

5. The method according to claim 4, characterized in that: The method comprises the following steps:

1. seed liquid OD 600 When the seed solution is between 6 and 8, inoculate 5%-20% into the second-level seed bottle. The second-level seed solution OD 600 At 20-30°C, 5%-20% of the inositol is inoculated into a fermentation tank containing a fermentation medium, and antibiotics and trace elements are added at the same time. After the fermentation is completed, the inositol is collected.

6. The method according to claim 5, characterized in that: The formula of the fermentation medium is: 4-8g / L Na2HPO4, 2-4g / L KH2PO4, 0.5-1.5g / L NaCl, 8-16g / L (NH4)2SO4, 60-100g / L glucose, 10-30g / L yeast extract, 5-20g / L corn steep liquor powder, and 1-2g / L citric acid; The formula of the trace elements is: 0.01-0.1 mg / L H3BO3, 0.1-1 mg / L CuCl2, 0.1-1 mg / L Na2EDTA, 0.1-1 mg / L CoCl2, 0.5-2 mg / L ZnCl2, 1-3 mg / L MnCl2, 1-4 mg / L FeCl2; The formula of the antibiotics is: 0.01-0.1 mg / L hygromycin, 0.01-0.1 mg / L geneticin; The fermentation conditions are as follows: temperature of 28-33°C, pH of 5-6, dissolved oxygen of 30%-40%, and tank pressure of 0-5 Pa; During the fermentation process, the glucose concentration was controlled below 20 g / L, and 4 g / L (NH4)2SO4 was added every 24 h during the fermentation process; The total fermentation time is within 150 hours.

7. The method according to claim 6, characterized in that: The total fermentation time is 60-96 hours.

Citation Information

Patent Citations

  • Method for producing glucose and derivatives thereof through biotransformation of recombinant yeast

    CN116064262A

  • Modified membrane permeability

    CN108368477A

  • Pichia pastoris engineering bacteria for producing inositol and fermentation method

    CN112961792A

  • Construction method of high-yield inositol saccharomyces cerevisiae engineering bacteria

    CN113913316A