Method and kit for identification of restriction enzyme digestion for overlapping PCR
By employing the overlap PCR digestion-linked (DOPCR) method and utilizing universal primers and restriction endonucleases, the high cost and time consumption issues of SNP and short InDel identification in existing technologies have been resolved. This method enables rapid and low-cost SNP/InDel identification, with strong applicability and suitability for conventional electrophoresis.
Patent Information
- Application Number
- CN202410874931.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-02
- Publication Date
- 2026-01-20
- Estimated Expiration
- 2044-07-02
AI Technical Summary
Existing technologies require expensive specialized equipment and time for the identification of SNPs and short InDels, and ordinary electrophoresis is difficult to identify the differences in fragments produced by enzyme digestion, resulting in high costs, long processing times and low applicability.
The overlap PCR digestion-linked (DOPCR) method is used, which utilizes universal primers and restriction endonucleases to design specific primers for amplification and digestion. SNPs/InDels are identified by conventional electrophoresis, avoiding dependence on restriction sites, increasing the difference in digested fragments, and has strong applicability.
It enables rapid and low-cost SNP/InDel identification, has strong applicability, avoids dependence on professional equipment, reduces detection costs and time, and eliminates the need for PAGE electrophoresis, resulting in high detection efficiency.
Smart Images

Figure CN118599973B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a method and a kit for identifying digestion after overlapping PCR. BACKGROUND
[0002] In production practice and scientific research, it is often necessary to identify SNP (Single Nucleotide Polymorphism) and short InDel (Insertion and Deletion), such as identifying single-base mutation genetic disease genes, confirming plant and animal variety information, determining the genotypes of EMS mutant materials, and determining molecular markers in map-based cloning.
[0003] At present, the identification of SNP and short InDel is mostly carried out by sequencing after PCR, which requires professional equipment, is relatively high in cost, and is time-consuming. In addition, the method of creating an enzyme digestion site by PCR combined with subsequent enzyme digestion can also be used to identify SNP, but this method has strict requirements for SNP sites and upstream and downstream sequences, and therefore can only be used for SNP identification in some cases. Another important point is that the fragment size difference produced by enzyme digestion is only about 20 bp, and it is difficult to complete subsequent identification by using ordinary electrophoresis. PAGE electrophoresis, as a special electrophoresis technology, usually requires the use of special gel medium (such as polyacrylamide gel) and corresponding electrophoresis equipment, but the use of PAGE electrophoresis analysis for identification will be more time-consuming and laborious, and the cost will increase. SUMMARY
[0004] The purpose of the present application is to provide a method and a kit for identifying digestion after overlapping PCR (DOPCR) to solve the above problems.
[0005] The present application achieves the above-mentioned purpose by the following technical solutions:
[0006] The present application provides a method for identifying digestion after overlapping PCR (DOPCR) for detecting SNP / InDel molecular markers, and the specific steps are as follows:
[0007] Step one: according to the position and mutation form of the SNP / InDel molecular marker, assuming X / Y is the first base of SNP site base or InDel difference, X / Y and the previous 5 bases can be expressed as N1N2N3N4N5X or N1N2N3N4N5Y; taking N4N5X or N4N5Y as the last three bases of the introduced enzyme cutting site, selecting the corresponding restriction endonuclease, if there is no corresponding restriction endonuclease, then taking N5X or N5Y as the last two bases of the introduced enzyme cutting site, selecting the corresponding restriction endonuclease;
[0008] Step two: using the universal fragment to design universal primers UF and UR, and using the universal primers UF and UR to amplify the universal fragment to obtain the universal fragment primary PCR product, wherein the universal fragment primary PCR product does not contain the enzyme cutting site;
[0009] The structure of the universal primers UF and UR is:
[0010] Universal primer UF: 5'-fixed sequence 1+universal fragment upstream amplification sequence-3',
[0011] Universal primer UR: 5'-fixed sequence 2+universal fragment downstream amplification sequence-3';
[0012] Step three: designing MP primers and AP primers according to the restriction endonuclease selected in step one and the universal primers designed in step two, and using the MP primers and the AP primers to amplify the template to be tested where the SNP / InDel molecular marker is located to obtain the template to be tested primary PCR product;
[0013] The structure of the MP primers and the AP primers is:
[0014] When the restriction endonuclease is selected according to the last three bases, the MP primer is: 5'-fixed sequence 2 reverse complement sequence+template to be tested upstream amplification sequence+enzyme cutting site E1E2E3E4E5-3';
[0015] When the restriction endonuclease is selected according to the last two bases, the MP primer is: 5'-fixed sequence 2 reverse complement sequence+template to be tested upstream amplification sequence+enzyme cutting site E1E2E3E4E5E6-3';
[0016] Wherein, E1, E2, E3, E4, E5, E6 are the 1-6 bases of the enzyme cutting site, and the template to be tested upstream amplification sequence is the part of the template to be tested sequence before the N1 base.
[0017] The AP primer is: 5'-fixed sequence 1+template to be tested downstream amplification sequence-3';
[0018] Step four: using OP primer to carry out overlap PCR on the universal fragment primary PCR product obtained in step two and the template primary PCR product obtained in step three, and amplifying a final product, wherein the OP primer is 5'-fixed sequence 1-3';
[0019] Step five: using the restriction endonuclease selected in step one to carry out enzyme cutting on the final product obtained in step five to obtain an enzyme cutting product, and judging the SNP / InDel type of the sample to be tested according to the enzyme cutting result.
[0020] As a further optimization scheme of the present application, the restriction endonuclease is selected from BstBI, ApaLI, SalI, HpaI, PstI, XhoI, ClaI, Bc11, FspI, BamHI, KpnI, EagI, BglII, StuI, XbaI, NruI, SphI, SmaI, SacII, MluI, SpeI, Eco1051, EcoRI, EcoRV, SacI, BsaI, NdeI, PvuII, HindIII or SspI.
[0021] As a further optimization scheme of the present application, the length of the universal fragment primary PCR product is 300±100 bp, and the length of the template primary PCR product is 200-800 bp.
[0022] As a further optimization scheme of the present application, the sequence of the fixed sequence 1 is AAGCAGTGGTATCAACGCAGAGT, and the sequence of the fixed sequence 2 is AGTGCTTCTCATCCACA.
[0023] As a further optimization scheme of the present application, the length of the upstream / downstream amplification sequence of the template / universal fragment is 20-28 bp.
[0024] As a further optimization scheme of the present application, the universal fragment is derived from AmpR gene.
[0025] The present application also provides a kit for detecting SNP / InDel molecular markers by using the above overlap PCR enzyme cutting method, comprising: a restriction endonuclease, an OP primer, and a universal fragment primary PCR product or a universal fragment for amplifying the universal fragment primary PCR product, universal primers UF and UR.
[0026] The present application has the following beneficial effects:
[0027] 1) The present application uses DOPCR method to identify SNP / InDel, compared with the existing sequencing method, the scheme of the present application does not need expensive professional sequencing equipment, only relies on ordinary PCR and enzyme cutting, and can quickly detect SNP and short InDel site, saves time, cost is low, and the requirement for SNP / InDel and upstream and downstream sequences is low, and the applicability is strong.
[0028] 2) The present application uses DOPCR method to identify SNP / InDel, compared with the existing method of creating enzyme cutting site, the step of overlap PCR is added, the enzyme cutting fragment is significantly different, and ordinary electrophoresis can be used to complete the detection, and the flux is high, the cost is low and fast.
[0029] 3) The present application finds that when the last base of the primer does not match the template, the weak 3'-5' exonuclease enzyme activity of ordinary Taq enzyme is enough to remove the base and synthesize a new chain with the template base, and the detection sequence is fully covered by relying on the discovery and using the last two bases N5X or N5Y for primer design, so as to realize the detection sequence. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 The sequence structure diagram of the allele sequence, enzyme cutting site general sequence and primer design sequence for identifying SNP / InDel by DOPCR method, wherein, Figure 1 A is the allele sequence and enzyme cutting site general sequence for identifying SNP / InDel by DOPCR method; Figure 1 B-C is the sequence structure diagram of primer design using the last three bases and the last two bases;
[0031] Figure 2 The optional enzyme cutting site information chart for identifying SNP / InDel by DOPCR method;
[0032] Figure 3 The principle diagram for identifying SNP / InDel by DOPCR method, wherein, Figure 3 A is the primer general structure for identifying SNP / InDel by DOPCR method; Figure 3 B is the flow principle diagram for identifying SNP / InDel by DOPCR method;
[0033] Figure 4 The sequence difference comparison diagram of HBB gene of healthy people and sickle cell disease patients;
[0034] Figure 5 The agarose gel electrophoresis typing diagram of DOPCR method for identifying carriers, healthy people and sickle cell disease patients;
[0035] Figure 6Figure 1 shows a sequence comparison chart of OsSpo11 gene of wild type rice (WT) and its CAS9 knockout mutant;
[0036] Figure 7 Figure 4 shows an agarose gel electrophoresis typing chart of wild type, heterozygote and homozygote rice plants identified by DOPCR method. DETAILED DESCRIPTION
[0037] It is necessary to point out here that the following detailed description is only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.
[0038] The methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.
[0039] Example 1, method for identifying SNP / InDel by DOPCR method
[0040] As shown in Figure 1, the principle of identifying SNP / InDel by DOPCR method includes the following steps: Figure 3
[0041] (1) According to the information of two different allelic sequences on the template to be tested of the sample to be tested, confirm the position and mutation form of SNP or InDel (as shown in Figure 2A) ; Figure 1
[0042] First, according to N4N5X or N4N5Y as the last three bases of the introduced enzyme cutting site, select the corresponding restriction enzyme in the list of candidate enzyme cutting sites as shown in Figure 2B (as shown in Figure 2C) ; Figure 2 Figure 1
[0043] If there is no corresponding restriction enzyme to select, through N5X or N5Y as the last two bases of the introduced enzyme cutting site, select the corresponding restriction enzyme in the list of candidate enzyme cutting sites as shown in Figure 2D (in theory, this method can cover all base cases). When designing primers according to the last two bases, rely on the weak 3'-5' exonuclease activity of ordinary Taq enzyme. Among them, one allele as a template will be cut off by Taq enzyme because the primer does not match the last base of the template, so the product does not contain the enzyme cutting site (as shown in Figure 2E) ; Figure 2 Figure 1
[0044] (2) using the universal fragment to design universal primers UF, UR, and using the universal primers UF, UR to amplify the universal fragment to obtain a universal fragment primary PCR product, the length of the universal fragment primary PCR product is preferably 300±100 bp, and the universal fragment primary PCR product does not contain a restriction enzyme cutting site;
[0045] The structure of the universal primers UF, UR is:
[0046] The universal primer UF is 5'-fixed sequence 1+universal fragment upstream amplification sequence-3',
[0047] The universal primer UR is 5'-fixed sequence 2+universal fragment downstream amplification sequence-3';
[0048] Further, the sequence of the fixed sequence 1 is AAGCAGTGGTATCAACGCAGAGT, and the sequence of the fixed sequence 2 is AGTGCTTCTCATCCACA; the template for amplifying the universal fragment can be any DNA sequence, and taking the AmpR gene and the universal fragment primary PCR product with a length of 300 bp as an example, the universal primers UF, UR are as shown in SEQ ID NO. 1-2:
[0049] SEQ ID NO. 1: UF: 5'-AAGCAGTGGTATCAACGCAGAGT+CACCCAGAAACGCT GGTGAAAGT-3';
[0050] SEQ ID NO. 2: UR: 5'-AGTGCTTCTCATCCACA+TCCGTAAGATGCTTTTCTGTG AC-3';
[0051] The universal fragment primary PCR product obtained by amplification can be stored at -20℃ for a long time and used as a universal overlapping template fragment for identifying any SNP / InDel in the DOPCR method.
[0052] (3) designing MP primers and AP primers according to the restriction endonuclease selected in step (1) and the universal primers designed in step (2), and using the MP primers and the AP primers to amplify the template to be detected where the SNP / InDel molecular marker is located to obtain a template to be detected primary PCR product, wherein the length of the MP / AP primer pair amplification product is 200-800 bp;
[0053] The structure of the MP primers and the AP primers is:
[0054] When the restriction endonuclease is selected according to the last three bases, the MP primer is 5'-TGTGGATGAGAAGCACT+N1 site base before the partial template sequence (about 25 bp)+E1E2E3E4E5.
[0055] MP primer: 5'-TGTGGATGAGAAGCACT+ part of the template sequence to be detected before the base at position N1 (~25 bp) + E1E2E3E4E5E6
[0056] The AP primer structure is consistent in both cases:
[0057] AP primer: 5'-AAGCAGTGGTATCAACGCAGAGT + downstream amplification sequence of the template to be detected (~25 bp) - 3'; the downstream amplification sequence of the template to be detected is the sequence complementary to the downstream sequence of the template to be detected.
[0058] (4) The amplification system of the primary PCR product of the fragment to be detected and the primary PCR product of the universal fragment of the present application is as follows:
[0059] Table 1. Primary PCR amplification system
[0060]
[0061] The PCR amplification program is: 95℃ for 3 min; 95℃ for 20 s, 55℃ for 20 s, 72℃ for 20 s, 31 cycles; 72℃ for 5 min.
[0062] (5) Take 0.5 μl of the primary PCR product of the fragment to be detected as a template, add it to the overlap PCR reaction solution, and use the primer OP to perform overlap PCR according to the following overlap PCR amplification system and amplification program to amplify the final product;
[0063] SEQ ID NO. 3: OP: 5'-AAGCAGTGGTATCAACGCAGAGT-3'.
[0064] Table 2. Overlap PCR amplification system
[0065]
[0066] The PCR amplification program is: 95℃ for 3 min; 95℃ for 20 s, 55℃ for 20 s, 72℃ for 45 s, 32 cycles; 72℃ for 5 min.
[0067] (6) Directly add the enzyme digestion reaction solution (3 μl of 10×buffer, 0.3 μl of the restriction enzyme selected in step 2.1.2 above, and 11.7 μl of dH2O) to the overlap PCR product, mix well, and then perform enzyme digestion at 37℃ for 1 h. Take 20 μl of the enzyme digestion product to perform 1% agarose gel electrophoresis. According to the enzyme digestion result, the SNP / InDel type of the sample to be detected can be determined.
[0068] Example 2, Case of DOPCR identification of single base SNP
[0069] Sickle cell disease (SCD), an autosomal recessive genetic disease, is caused by the mutation of the 6th amino acid codon GAG of the HBB gene expressing β-globin to GTG (as shown in Figure 4 Sickle cell disease patients will have symptoms including anemia, severe acute and chronic pain, immune deficiency, multiple organ failure, and even early death. The disease is one of the key objects of fetal genetic disease screening, and is currently screened and confirmed using PCR sequencing. Using DOPCR, the presence or absence of the mutation can be detected by electrophoresis in a simple and intuitive manner, without relying on expensive first-generation sequencers and taking less time.
[0070] SEQ ID NO. 4: Healthy: 5'-... CACTAGCAACCTCAAACAGACACCATGGTGCACCTG ACTCCT GA G GAGAAGTCTGCCGTTACTGCCCTGTG...-3';
[0071] SEQ ID NO. 5: Sickle: 5'-... CACTAGCAACCTCAAACAGACACCATGGTGCACCTG ACTCCT GT G GAGAAGTCTGCCGTTACTGCCCTGTG...-3'.
[0072] (1) The last three bases at the SNP of the two alleles are TGA / TGT, and there is no corresponding enzyme cutting site in Table 1. When the last two bases are searched, GA corresponds to the XbaI enzyme cutting site, so this enzyme cutting site is selected for subsequent primer design and verification. The initial PCR product is about 600 bp.
[0073] SEQ ID NO. 6: MP: TGTGGATGAGAAGCACTACAGACACCATGGTGCACCTG Actctaga;
[0074] SEQ ID NO. 7: AP: AAGCAGTGGTATCAACGCAGAGTCTAAAACGATCCTGAG ACTTCCAC
[0075] (2) The company synthesized the cDNA sequences of the HBB gene corresponding to healthy and sickle cell disease. Using the MP / AP primer pair to amplify the initial PCR fragment to be detected, and using the UF / UR primer pair to amplify the universal fragment using pGADT7 as the template, with the healthy cDNA sequence template and the sickle cell disease cDNA sequence template mixed as a carrier (equivalent to a carrier).
[0076] (3) Mix the primary PCR product to be detected and the universal fragment primary PCR product, and use the OP primer to perform overlapping PCR to extend the fragment;
[0077] (4) Perform enzyme digestion on the PCR product using XbaI, and perform subsequent electrophoresis.
[0078] The results are shown in Figure 5 The number of bands of healthy people is two, and the number of bands of sickle cell disease patients is one. The bands are clear and visible, and the difference is obvious.
[0079] Example 3, case of identifying InDel by DOPCR
[0080] In addition to identifying single-base SNPs, DOPCR can also be extended to identify a small number of base insertions or deletions of InDel differences. These small numbers of InDel differences cannot be effectively identified by traditional methods.
[0081] The rice OsSpo11 gene (LOC_Os03g54091, nucleotide sequence as shown in SEQ ID NO. 8) was subjected to CAS9 knockout (Cas9 sgRNA target sequence is TGTACTCTCGCTCCTCCACC), and one mutant strain was obtained, which was a double-allele mutation, as shown in Figure 6 The mutant form of allele 1 is TCCTCC deletion (does not cause frame shift mutation and does not lose function), and allele 2 is C deletion (frame shift mutation, loss of function). The mutant strain loses function and can grow normally but cannot produce fertile pollen and cannot set seeds, so it can only be propagated by heterozygotes. After propagation, homozygotes need to be re-identified from offspring for subsequent experiments. The identification by PCR sequencing method is time-consuming and costly. At this time, DOPCR can be used for identification and analysis.
[0082] The mutant form information of the mutant strain is as follows:
[0083] SEQ ID NO. 9: WT: CCGGTGGGCACAGATGTACTCTCGC TCCTCC ACCGGGGCTCCCACGCCTCCCGGCTCA;
[0084] SEQ ID NO. 10: Allele 1: CCGGTGGGCACAGATGTACTCTCGC ------ ACCGGGCTCCCACGCCTCCCGGCTCA;
[0085] SEQ ID NO. 11: Allele 2: CCCGTGGGCACAGATGTACTCTCGCTCCTC-ACCGGGGCTCCCACGCCTCCCGGCTCA.
[0086] The "A" and "T" bases are the first bases differing in InDel, therefore the N4N5X / N4N5Y mutation corresponds to GCA / GCT, where GCA is the last three bases of the endonuclease Fsp1 (TGCGCA). The primer sequence designed based on this is as follows:
[0087] SEQ ID NO.12: MP primer: TTGTGGATGAGAAGCACTCCCGTGGGCACAGATGTAC Ttgcgc
[0088] SEQ ID NO.13: AP primer: AAGCGTGGTATCAACGCAGAGTGCATGGAACCTATG CAGACCTTGG.
[0089] The initial PCR products of both the target fragment and the universal fragment are approximately 300 bp in size, and the heterozygotes show two bands after enzyme digestion.
[0090] After initial PCR and overlap PCR, the product was digested with Fsp1 enzyme, and the electrophoresis results are as follows: Figure 7 (Primary PCR, overlap PCR, and Fsp1 digestion correspond to...) Figure 7 As shown in the left, middle, and right groups, heterozygous and homozygous plants are distinguished by two bands for heterozygous plants and one band for homozygous plants. The bands are clearly visible and easy to distinguish.
[0091] The above-described embodiments are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. A non-disease diagnostic method for identifying SNP / InDel molecular markers using overlapping PCR enzyme digestion, characterized in that, The specific steps are as follows: Step 1: Based on the location and mutation form of the SNP / InDel molecular marker, select the corresponding restriction endonuclease by using N4N5X or N4N5Y as the last three bases of the introduced restriction site. If no corresponding restriction endonuclease is available, select the corresponding restriction endonuclease by using N5X or N5Y as the last two bases of the introduced restriction site. Where X / Y is the first base of the SNP site or the InDel difference, and N4 / N5 are the first two bases of X / Y, corresponding to the 4th / 5th base of the enzyme cleavage site; Step 2: Design universal primers UF and UR using the universal fragment, and amplify the universal fragment using the universal primers UF and UR to obtain the initial PCR product of the universal fragment. The initial PCR product of the universal fragment does not contain enzyme digestion sites. The structures of the universal primers UF and UR are as follows: Universal primer UF: 5'-fixed sequence 1 + universal fragment upstream amplification sequence - 3', Universal primer UR: 5'-fixed sequence 2 + universal fragment downstream amplification sequence - 3'; Step 3: Based on the restriction endonuclease selected in Step 1 and the universal primers designed in Step 2, design MP primers and AP primers, and use MP primers and AP primers to amplify the test template containing the SNP / InDel molecular marker to obtain the initial PCR product of the test template. The structures of the MP primers and AP primers are as follows: When selecting restriction endonucleases based on the last three bases, the MP primers are: 5'-the reverse complementary sequence of fixed sequence 2 + the upstream amplified sequence of the template to be tested + the restriction site E1E2E3E4E5-3'; When selecting restriction endonucleases based on the last two bases, the MP primers are: 5'-the reverse complementary sequence of fixed sequence 2 + the upstream amplified sequence of the template to be tested + the restriction site E1E2E3E4E5E6-3'; In this sequence, E1, E2, E3, E4, E5, and E6 are the 1st to 6th bases of the restriction enzyme site, respectively. The upstream amplified sequence of the template to be tested is the part of the template sequence to be tested before the N1 base, where N1 is the 5th base before the X / Y position. The AP primers are: 5'-fixed sequence 1 + downstream amplification sequence of the template to be tested - 3'; Step 4: Design OP primers using universal primers UF, and perform overlap PCR on the universal fragment primary PCR product obtained in Step 2 and the test template primary PCR product obtained in Step 3 using OP primers to amplify the final product. The OP primers are: 5'-fixed sequence 1-3'. Step 5: Use the restriction endonuclease selected in Step 1 to digest the final product obtained in Step 4 to obtain the digested product. Determine the SNP / InDel type of the sample to be tested based on the digestion results.
2. The identification method for non-disease diagnostic purposes using overlapping PCR enzyme digestion according to claim 1, characterized in that, The restriction endonuclease is selected from BstBI, ApaLI, SalI, HpaI, PstI, XhoI, ClaI, Bc11, FspI, BamHI, KpnI, EagI, BglII, StuI, XbaI, NruI, SphI, SmaI, SacII, MluI, SpeI, Eco1051, EcoRI, EcoRV, SacI, BsaI, NdeI, PvuII, HindIII, or SspI.
3. The identification method for non-disease diagnostic purposes using overlapping PCR enzyme digestion according to claim 1, characterized in that, The length of the initial PCR product of the universal fragment is 300±100bp, and the length of the initial PCR product of the template to be tested is 200~800bp.
4. The identification method for non-disease diagnostic purposes using overlapping PCR enzyme digestion according to claim 1, characterized in that, The sequence of fixed sequence 1 is: AAGCGTGGTATCAACGCAGAGT, and the sequence of fixed sequence 2 is: AGTGCTTCTCATCCACA.
5. The identification method for non-disease diagnostic purposes using overlapping PCR enzyme digestion according to claim 1, characterized in that, The upstream / downstream amplification sequences of the template to be tested are 20~28bp in length.
6. The identification method for non-disease diagnostic purposes using overlapping PCR enzyme digestion according to claim 1, characterized in that, The universal fragment is derived from the AmpR gene.
Citation Information
Patent Citations
Method and kit for detecting rs1801131 polymorphic site genotype in MTHFR (5,10-methylenetetrahydrofolate reductase) gene
CN107058478A
Detection of nucleic acid differences using endonuclease cleavage / ligase resealing reactions and capillary electrophoresis or microarrays
US20090123913A1