A molecular marker C9-28 closely linked to lagenaria leucantha gene, detection method and application thereof
By providing the molecular marker C9-28, which is closely linked to the flower color gene of loofah, and its detection method, and using PCR amplification and gel electrophoresis analysis, the problem of unclear inheritance patterns of flower color in loofah has been solved, enabling rapid and accurate flower color identification and breeding.
Patent Information
- Application Number
- CN202410871402.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-01
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2044-07-01
AI Technical Summary
The genetic patterns and gene mapping of loofah flower color have not been reported in existing technologies, making it difficult to efficiently and accurately select and breed loofah flower color genes using molecular marker technology.
A molecular marker C9-28 closely linked to the flower color gene of loofah is provided, along with its detection method. PCR amplification and polyacrylamide gel electrophoresis analysis using primer pairs C9-28-F and C9-28-R are used to identify the flower color type of the plant.
This method enables rapid and accurate identification of homozygous and heterozygous individuals for flower color in loofah during the seedling stage, improving the efficiency and accuracy of selection breeding and solving the problems of time-consuming and costly phenotypic identification. It has broad application prospects.
Smart Images

Figure CN118653002B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a molecular marker C9-28 closely linked to the flower color gene of loofah, its detection method, and its application, belonging to the field of vegetable molecular genetics and breeding technology. Background Technology
[0002] Loofah is an important multi-functional vegetable used both as food and medicine. It has a soft, sweet taste and is considered cooling in nature, making it ideal for summer consumption. It is believed to have heat-clearing, blood-cooling, detoxifying, and lung-benefiting effects. Loofah is rich in nutrients, containing protein, fat, carbohydrates, calcium, phosphorus, iron, vitamin B1, vitamin C, as well as saponins, plant mucilage, xylose gum, loofah bitter substances, citrulline, and more. In recent years, with increasing emphasis on nutrition and health, the cultivation area of loofah has expanded significantly. It grows in provinces from the Pearl River Basin in the south to the Yellow River Basin in the north, making it a common daily vegetable in my country.
[0003] Flower color is one of the important agronomic traits of loofah, easily observed and genetically stable. As a visual signal, flower color has a significant impact on attracting insects or birds for pollination. Different colored flowers attract different pollinators, such as insects and birds. Different types of pollinators have different color preferences. For example, butterflies usually prefer brightly colored flowers, while bees are more interested in blue and yellow flowers. Plants use flower color to attract suitable pollinators, thereby promoting efficient pollination and reproduction. Loofah flowers are typically yellow. In recent years, there has been interest in the diversity of loofah flower colors, with the hope of cultivating loofah varieties with more colors. However, existing research reports have not yet revealed the genetic patterns and gene mapping of loofah flower color.
[0004] In recent years, with the development of molecular marker technology, many researchers have used molecular markers closely linked to QTLs or genes of target traits for germplasm-assisted selection. This method is unaffected by gene expression and environmental factors, allows for early selection, and is simple to operate, greatly improving the speed and accuracy of selection. Among them, InDel (Insertion and Deletion) molecular markers are one of the most widely used molecular marker technologies. Due to their wide distribution, high density, stability, high polymorphism, ease of detection, good reproducibility, and low requirements for DNA quality, they can be used efficiently and accurately for genetic mapping and gene localization, and for assisted selection breeding using molecular markers closely linked to target traits.
[0005] Based on the above objectives, this invention discloses a loofah material with pale yellow flowers and conducts research on the genetic rules and gene mapping of loofah flower color. Using the yellow-flowered inbred line 'SP55' as the female parent and the pale yellow-flowered inbred line 'SP48' as the male parent, an F2 population containing 184 lines was constructed. Gene mapping analysis of the loofah flower color gene was performed using the F2 population, and the molecular marker C9-28, which is closely linked to the loofah flower color gene, was screened. This marker can serve as an efficient and practical molecular marker for marker-assisted selection breeding of loofah flower color. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a molecular marker C9-28 closely linked to the flower color gene of loofah, a detection method and its application. The aim is to provide a foundation for subsequent cloning and functional research of the loofah flower color gene, as well as the creation of new loofah flower color materials, and to accelerate the breeding of superior new loofah varieties and the research process of gene function.
[0007] To solve the above-mentioned technical problems, the present invention is implemented using the following technical solution:
[0008] This invention provides a molecular marker C9-28 that is closely linked to the flower color gene of loofah. The primer pair of the molecular marker C9-28 consists of the forward primer C9-28-F: 5′AACGCTAAATGGATGGTTGG 3′ and the reverse primer C9-28-R: 5′TCACTTTTATTAATGTTTGGTCAAATG 3′.
[0009] The application of the molecular marker C9-28 in marker-assisted breeding of loofah.
[0010] Application of the molecular marker C9-28 in the localization or identification of flower color genes in loofah.
[0011] This invention also provides a method for detecting the flower color gene of loofah using the molecular marker C9-28, the detection method comprising the following steps:
[0012] Step 1: Using the DNA of the loofah material to be identified as a template, PCR amplification was performed using primers with molecular marker C9-28. Specifically, the PCR amplification reaction system was: 5.0 μL of 2×Taq Master Mix, 2.0 μL of ddH2O, 1.0 μL of forward primer, 1.0 μL of reverse primer, and 1.0 μL of genomic template DNA at 50 ng / μL. More specifically, the PCR amplification program was: 95℃ pre-denaturation for 5 min; each cycle consisted of 95℃ pre-denaturation for 30 s, 50℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 10 min, and storage at 4℃.
[0013] Step 2: Separate and analyze the amplification products by polyacrylamide gel electrophoresis. Specifically, take 3.5 μL of the amplification product sample and perform electrophoresis on a 6% non-denaturing polyacrylamide gel; turn on the electrodes and electrophores at a constant voltage of 130V for 2.1 hours, then turn off the power; remove the gel and stain it with silver nitrate.
[0014] If only a single 141bp band is displayed, it is a homozygote with pale yellow flowers;
[0015] If only a single 152bp band is displayed, it is a homozygous strain with yellow flowers;
[0016] If two bands are displayed at 141bp and 152bp, it is a heterozygote with yellow flowers.
[0017] Compared with the prior art, the beneficial effects achieved by the present invention are as follows:
[0018] 1. This invention provides a molecular marker C9-28 that is closely linked to the flower color gene of loofah. By screening, a molecular marker C9-28 closely linked to the flower color gene of loofah is obtained, laying the foundation for molecular marker-assisted selection breeding and gene cloning. Using the molecular marker C9-28 closely linked to the flower color gene of loofah in this invention, the flower color gene of loofah was identified. The selection efficiency of 20 yellow-flowered individual plants and 20 pale yellow-flowered individual plants in F2 was 100%, which has a good prospect for application and promotion.
[0019] 2. The method for detecting the flower color gene of loofah using the molecular marker C9-28 provided by this invention can amplify plants with a specific single band of 141 bp that produce pale yellow flowers, plants with a specific single band of 152 bp that produce yellow flowers, and plants with double bands of both 141 bp and 152 bp that produce yellow flowers. Applying the molecular marker C9-28 to the localization or identification of loofah flower color genes offers advantages such as high accuracy, good repeatability, and convenient identification. Those skilled in the art can determine the flower color phenotype of plants during the seedling stage using the aforementioned molecular marker detection method, effectively solving the problems of time-consuming, costly, and difficult phenotypic identification results, providing a simple and rapid solution.
[0020] 3. The molecular marker C9-28 provided by this invention can be widely used in molecular marker-assisted selection breeding for molecular detection of flower color genes in loofah, realizing industrialized molecular breeding of genes, and has the advantages of high efficiency, few restrictions, and accuracy. Attached Figure Description
[0021] Figure 1 Flower color performance of 'SP55', F1 (SP55×SP48) and 'SP48' under normal field planting conditions;
[0022] In the autumn of 2023, flower color identification was performed on 'SP55' (left flower), F1 (middle flower) and 'SP48' (right flower). It was found that 'SP55' had yellow flowers, 'SP48' had pale yellow flowers, and F1 (SP55×SP48) had yellow flowers.
[0023] Figure 2 Genetic mapping of the flower color gene fc in loofah was performed using 184 F2 populations.
[0024] Using linkage diagrams from 184 F2 populations and statistical results of sponge gourd flower color phenotypes, the sponge gourd flower color gene fc was located on chromosome 9 between C9-28 and SEC9-1. The genetic distance between the two markers was 0.982 cM, and the physical distance was 3.94 MB. Molecular marker C9-28 was closely linked to the flower color gene fc.
[0025] Figure 3 Identification results of C9-28 in yellow-flowered and pale yellow-flowered individual plants in both parents, F1 and F2 populations;
[0026] Using DNA from yellow-flowered and pale yellow-flowered plants in the 'SP55', F1 (SP55×SP48), 'SP48', and F2 populations as templates, PCR amplification was performed using the marker primers of this invention, C9-28-F / C9-28-R. The results showed that a single band of 152 bp was amplified in 11 yellow-flowered plants (lanes 6-8, 11, 14-16, 18-20, 24) in the 'SP55' (lane 2) and F2 populations; double bands of 141 bp and 152 bp were amplified in 9 yellow-flowered plants (lanes 5, 9-10, 12-13, 17, 21-23) in the F1 (lane 3) and F2 populations; and a single band of 141 bp was amplified in 20 pale yellow-flowered plants (lanes 25-44) in the 'SP48' (lane 4) and F2 populations.
[0027] Note: Lane 1: 500bp marker; Lane 2: SP55; Lane 3: F1; Lane 4: SP48; Lanes 5-24: yellow-flowered individual plants in the F2 population; Lanes 25-44: pale yellow-flowered individual plants in the F2 population. Detailed Implementation
[0028] The present invention will be further described below with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and should not be used to limit the scope of protection of the present invention.
[0029] Unless otherwise specified, the experimental methods used in the following examples are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0030] This invention provides a molecular marker C9-28 that is closely linked to the flower color gene of loofah. The primer pair of the molecular marker C9-28 consists of the forward primer C9-28-F: 5′AACGCTAAATGGATGGTTGG 3′ and the reverse primer C9-28-R: 5′TCACTTTTATTAATGTTTGGTCAAATG 3′.
[0031] This invention also provides a method for detecting flower color genes in loofah using the molecular marker C9-28, comprising the following steps:
[0032] Step 1: Using the DNA of the loofah material to be identified as a template, perform PCR amplification using primers with molecular marker C9-28.
[0033] In some embodiments, the PCR amplification reaction system is: 5.0 μL of 2×Taq Master Mix, 2.0 μL of ddH2O, 1.0 μL each of forward and reverse primers, and 1.0 μL of genomic template DNA at 50 ng / μL and 1.0 μL respectively.
[0034] In some embodiments, the PCR amplification program is as follows: pre-denaturation at 95°C for 5 min; pre-denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s per cycle, for a total of 35 cycles; extension at 72°C for 10 min, and storage at 4°C.
[0035] It should be noted that those skilled in the art, after understanding the essence of the present invention, can make corresponding changes to the PCR amplification reaction system and amplification procedure, but these changes are still within the protection scope of the present invention.
[0036] Step 2: Separate and analyze the amplification products by polyacrylamide gel electrophoresis.
[0037] Specifically, 3.5 μL of the amplified product was taken out and electrophoresed on a 6% non-denaturing polyacrylamide gel; the electrodes were turned on and electrophoresis was performed at a constant voltage of 130 V for 2.1 hours, and then the power was turned off; the gel was removed and stained with silver nitrate.
[0038] Analysis shows that if only a single band of 141bp is displayed, it is a homozygous organism with pale yellow flowers; if only a single band of 152bp is displayed, it is a homozygous organism with yellow flowers; and if both bands of 141bp and 152bp are displayed, it is a heterozygous organism with yellow flowers.
[0039] In other words, the method for detecting the flower color gene of loofah using the molecular marker C9-28 provided by this invention can amplify plants with a specific single band of 141bp that are plants with pale yellow flowers, plants with a specific single band of 152bp that are plants with yellow flowers, and plants with double bands of 141bp and 152bp that are plants with yellow flowers.
[0040] Those skilled in the art can apply the molecular marker C9-28 to marker-assisted breeding of loofah.
[0041] Those skilled in the art can also apply the molecular marker C9-28 to the localization or identification of flower color genes in loofah.
[0042] The present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited thereto.
[0043] Example 1
[0044] This embodiment provides a molecular marker C9-28 and its amplification primers that are closely linked to the flower color gene of loofah.
[0045] In the autumn of 2023, the flower color phenotypes of six generations of loofah populations—'SP55', 'SP48', F1 (SP55×SP48), F2 (SP55×SP48), BC1 (F1×SP55), and BC1 (F1×SP48)—were identified. The segregation ratios of yellow and pale yellow flowers in the six generations were calculated, and the inheritance patterns of loofah flower color were analyzed. The results showed that 'SP55' produced yellow flowers, 'SP48' produced pale yellow flowers, and F1 (SP55×SP48) produced yellow flowers. Figure 1 This refers to the flower color performance of 'SP55', F1 (SP55×SP48), and 'SP48' under normal field planting conditions, through... Figure 1 It can be seen that in the F2 (SP55×SP48) population, the segregation ratio of yellow flowers to pale yellow flowers is 3:1; in the BC1 (F1×SP55) population, all flowers are yellow; and in the BC1 (F1×SP48) population, the segregation ratio of yellow flowers to pale yellow flowers is 1:1. For the analysis of the genetic patterns of flower color in loofah, please refer to Table 1. The study found that the pale yellow flower phenotype in 'SP48' is controlled by a single recessive gene, fc.
[0046] Table 1. Analysis of the Inheritance Patterns of Flower Color Genes in Luffa.
[0047]
[0048] 135 pairs of InDel primers and 20 pairs of SSR primers were used for polymorphic primer screening between 'SP55' and 'SP48', ultimately yielding 33 pairs of InDel primers and 1 pair of SSR primers. PCR amplification was performed in 184 F2 populations. Linkage maps were constructed using JoinMap 4.0, and the location of the fc gene in *Luffa cylindrica* was analyzed in conjunction with statistical results of flower color phenotype. The results showed that the fc gene is located on chromosome 9 between markers C9-28 and SEC9-1. Please refer to [link to relevant documentation]. Figure 2 The genetic distance between fc and molecular marker C9-28 was 0.416 cM, and the genetic distance between fc and molecular marker SEC9-1 was 0.566 cM. Molecular marker validation on 20 yellow-flowered and 20 pale yellow-flowered plants from the F2 population revealed that molecular marker C9-28 is closely linked to the flower color gene fc in loofah. Please refer to [link to relevant documentation]. Figure 3 .
[0049] 1. Design of molecular marker primers tightly linked to fc
[0050] In the aforementioned study on molecular marker linkage map construction and the localization of the *Luffa cylindrica* flower color gene *fc*, molecular marker C9-28 was found to be tightly linked to *fc*. This marker was developed by extracting the sequence from this region using laboratory bioinformatics scripts, analyzing the obtained sequence using IGV-sRNA & GSAman v0.6.83 software, and designing the marker using Primer Premier 6.0 software.
[0051] The C9-28 primer sequences are: forward primer C9-28-F: 5′AACGCTAAATGGATGGTTGG 3′, reverse primer C9-28-R: 5′TCACTTTTATTAATGTTTGGTCAAATG 3′.
[0052] Example 2
[0053] This embodiment provides a method for detecting flower color genes in loofah using the molecular marker C9-28, to perform molecular detection of marker primers C9-28-F / C9-28-R in individual plants with yellow or pale yellow flowers in the F2 population.
[0054] To verify the accuracy of this molecular marker, our laboratory used C9-28-F / C9-28-R primers to perform PCR amplification on 20 yellow-flowered and 20 pale yellow-flowered plants in the F2 population, followed by separation and analysis by polyacrylamide gel electrophoresis.
[0055] It should be noted that during PCR amplification, the reaction system can be: 5.0 μL of 2×Taq Master Mix, 2.0 μL of ddH2O, 1.0 μL each of forward and reverse primers, and 1.0 μL of genomic template DNA at 50 ng / μL and 1.0 μL respectively.
[0056] The PCR amplification program can be as follows: 95℃ pre-denaturation for 5 min; each cycle of 95℃ pre-denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 10 min, and storage at 4℃.
[0057] PCR product detection: The reaction products were electrophoresed on a 6% non-denaturing polyacrylamide gel and stained with silver nitrate. It should be understood that those skilled in the art can make appropriate modifications based on actual circumstances, and this invention is not limited thereto.
[0058] The amplified products were separated and analyzed by polyacrylamide gel electrophoresis. The results showed that in the F2 population, all 20 pale yellow-flowering plants amplified a single 141 bp band, consistent with the banding pattern amplified in 'SP48'; all 11 yellow-flowering plants amplified a single 152 bp band, consistent with the banding pattern amplified in 'SP55'; and 9 yellow-flowering plants amplified double bands of 141 bp and 152 bp, consistent with the banding pattern amplified in F1 (SP55×SP48). This indicates that the molecular marker C9-28 is tightly linked to fc.
[0059] In other words, the method for detecting the flower color gene of loofah using the molecular marker C9-28 provided by this invention can amplify plants with a specific single band of 141bp that are plants with pale yellow flowers, plants with a specific single band of 152bp that are plants with yellow flowers, and plants with double bands of 141bp and 152bp that are plants with yellow flowers.
[0060] This invention obtains a molecular marker C9-28 closely linked to the flower color gene of loofah through screening, laying the foundation for marker-assisted selection breeding and gene cloning. Using the molecular marker C9-28 closely linked to the flower color gene of loofah in this invention, the flower color gene of loofah was identified. The selection efficiency among 20 yellow-flowered individual plants and 20 pale yellow-flowered individual plants in F2 was 100%, which has a good prospect for application and promotion.
[0061] It should be noted that the molecular marker C9-28 provided by this invention can be widely used in the molecular detection of flower color genes in loofah in molecular marker-assisted selection breeding, so as to realize the industrialization of gene molecular breeding.
[0062] It should be understood that those skilled in the art can also apply the molecular marker C9-28 to the localization or identification of flower color genes in loofah to solve the problems of time-consuming, costly, and difficult phenotypic identification results.
[0063] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The use of primer pair of molecular marker C9-28 in luffa color molecular marker assisted luffa color breeding, wherein the primer pair of molecular marker C9-28 consists of forward primer C9-28-F: 5' AACGCTAAATGGATGGTTGG 3' and reverse primer C9-28-R: 5' TCACTTTTATTAATGTTTGGTCAAATG 3'.
2. The use of primer pair of molecular marker C9-28 in luffa color molecular marker assisted luffa color gene location or identification, wherein the primer pair of molecular marker C9-28 consists of forward primer C9-28-F: 5' AACGCTAAATGGATGGTTGG 3' and reverse primer C9-28-R: 5' TCACTTTTATTAATGTTTGGTCAAATG 3'.
3. A method for detecting luffa flower color gene by using molecular marker C9-28, characterized in that, It comprises the following steps: Step one, using DNA of luffa material to be identified as template, PCR amplification is carried out with primer pair of molecular marker C9-28; The primer pair of molecular marker C9-28 consists of forward primer C9-28-F: 5' AACGCTAAATGGATGGTTGG 3' and reverse primer C9-28-R: 5' TCACTTTTATTAATGTTTGGTCAAATG 3'; Step two, polyacrylamide gel electrophoresis separation analysis is carried out on the amplification product, the plant that can amplify 141 bp specific single band is the plant with light yellow flower, the plant that can amplify 152 bp specific single band is the plant with yellow flower, and the plant that can amplify 141 bp and 152 bp double bands is the plant with yellow flower.
4. The method for detecting lagenaria leucantha color gene by molecular marker C9-28 according to claim 3, characterized in that, The reaction system of PCR amplification in step one is as follows: 2 × Taq Master Mix 5.0 μL, ddH2O 2.0 μL, forward and reverse primers each 1.0 μL, genomic template DNA, 50 ng / μL, 1.0 μL.
5. The method for detecting lagenaria leucantha color gene by molecular marker C9-28 according to claim 3, characterized in that, The amplification program of PCR amplification in step one is as follows: 95℃ pre-denaturation for 5 min; each cycle of 95℃ pre-denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, a total of 35 cycles; 72℃ extension for 10 min, 4℃ preservation.
Citation Information
Patent Citations
SSR primers and method for purity identification of luffa hybrid seeds
CN105821154A
KASP molecular marking method for towel gourd main effect QTL resisting cucumber mosaic virus disease and application thereof
CN110055346A