Application of MIR2911 in the preparation of drugs against yellow fever virus YFV

Abstract

The present application provides the use of MIR2911 in the preparation of drugs against yellow fever virus YFV. Compared with the prior art, the present application has the following advantages: the application provided by the present application innovatively proposes a strategy for inhibiting YFV replication using MIR2911 small nucleic acid drugs, which can specifically target multiple genes of YFV and more effectively inhibit YFV replication than ribavirin; cell experiments have verified the inhibitory effects at the mRNA, protein and virus particle levels. The RNA sequence that ultimately exerts the effect is encapsulated and transported by endogenous exosomes, and there is no immune response. There is no need to verify the safety of exosomes, and it can also compensate for individual differences in oral MIR2911. Compared with protein and peptide drugs with a single target on the market, it is low-cost and more efficient.

Description

Technical Field

[0001] The present application relates to the field of biopharmaceutical technology, and specifically to the use of MIR2911 in the preparation of drugs against yellow fever virus YFV. Background Art

[0002] Yellow fever virus (YFV) belongs to the genus Flavivirus in the family Flaviviridae and is a single-stranded, positive-sense RNA virus. It is primarily transmitted by mosquitoes. After an infected mosquito bites a human, it injects saliva containing the yellow fever virus into the subcutaneous capillaries. The virus rapidly spreads to local lymph nodes, where it replicates and multiplies. After several days, it enters the bloodstream, causing viremia, primarily affecting the liver, spleen, kidneys, lymph nodes, bone marrow, and striated muscle. Clinical manifestations include high fever, headache, jaundice, proteinuria, relatively bradycardia, and bleeding. Severe cases can progress to multiple organ failure, hemorrhagic shock, and even death.

[0003] Although a vaccine for yellow fever virus effectively prevents infection, low vaccine coverage, inadequate mosquito control measures, and the lack of effective treatment for the disease have resulted in periodic outbreaks in endemic areas. Yellow fever is common in tropical and subtropical regions of South America and Africa. Worldwide, approximately 600 million people live in endemic areas, with approximately 200,000 infections and up to 40,000 deaths annually. my country has also reported numerous imported cases, posing a significant threat to its vulnerable population. Therefore, the development of anti-YFV drugs is crucial.

[0004] Early reports indicate that traditional Chinese medicines known for their heat-clearing and detoxifying properties, such as honeysuckle, isatis root, and phellodendron, have the ability to inhibit viral replication. MIR2911, a naturally occurring functional small molecule discovered in honeysuckle in 2015, can regulate target genes in non-plant environments and inhibit a variety of viruses. It represents a novel nucleic acid-based active ingredient with broad-spectrum antiviral potential.

[0005] Its antiviral mechanism is as follows: MIR2911 has the sequence GGCCGGGGGACGGGCUGGGA, which is a high-GC sequence. Almost all viral genomes contain 60% high-GC sequences. MIR2911 binds to viral target mRNA through base pairing, inhibiting viral gene expression. Currently, MIR2911 is reported to target 94% of known viruses. In contrast, the human genome contains only 10% high-GC sequences, ensuring its safety.

[0006] Studies have found that exogenous MIR2911 is transported into cells through the SIDT1 protein in the gastric apical cells of the gastric mucosa and then enters the circulatory system; however, 16% of the Chinese population has SIDT1 gene polymorphisms that prevent them from absorbing exogenous miRNAs, resulting in the oral synthesised or extracted MIR2911 not being absorbed and unable to inhibit viral replication in the body. In view of this, it is necessary to develop an antiviral injectable small nucleic acid drug.

[0007] At present, the clinical application development of small nucleic acid drugs lags far behind expectations. The fundamental reason is the lack of a suitable siRNA delivery system to safely, accurately and efficiently deliver siRNA to target tissues. This problem has become a core issue restricting the application of small nucleic acid drugs.

[0008] In summary, designing small nucleic acid drugs against yellow fever virus based on MIR2911 has very broad application prospects. It is particularly important to know how to deliver MIR2911 to the target tissue to exert its antiviral function. Summary of the Invention

[0009] In response to the above-mentioned technical limitations, the present application proposes the use of MIR2911 in the preparation of drugs against yellow fever virus YFV; it overcomes the deficiencies and defects mentioned in the background technology.

[0010] The applicant's research team discovered that endogenous cells can selectively encapsulate miRNAs into exosomes, which can deliver miRNAs to recipient cells. The secreted miRNAs can effectively block the expression of target genes at relatively low concentrations. Exosomes are biocompatible with the host immune system and have the innate ability to protect and transport miRNAs across biological barriers in the body, making them a potential solution to overcome the problems associated with the delivery of small nucleic acid drugs. The research team further developed the in vivo self-assembly third-generation small nucleic acid technology, making it a safe and effective siRNA delivery system. Combined with the independently developed plasmid delivery system for efficient expression of MIR2911, the team developed a biosynthetic MIR2911 small nucleic acid drug, which can provide a potential strategy for targeting YFV and compensate for individual differences in oral absorption of MIR2911.

[0011] To achieve the above objectives, this application adopts the following technical solutions:

[0012] The invention of this application is to provide the use of MIR2911 in the preparation of drugs against yellow fever virus YFV.

[0013] Optionally, in the application, MIR2911 is derived from a gene assembly, which includes a DNA sequence for expressing the MIR2911 sequence and a complementary sequence that can form at least 80% complementarity with the DNA sequence.

[0014] Optionally, in the application, the DNA coding sequence (5′-3′) for expressing MIR2911 is as shown in SEQ ID No. 1, and the complementary sequence (5′-3′) that is completely complementary to the DNA sequence for expressing MIR2911 is as shown in SEQ ID No. 2. In order to make MIR2911 more easily expressed, the bases on the complementary sequence are mutated to reduce the binding energy between MIR2911 and the complementary sequence. More preferably, the complementary sequence (5′-3′) is as shown in SEQ ID No. 3, and this conclusion is drawn from the quantitative detection of MIR2911 expressed in exosomes after injection.

[0015] SEQ ID No. 1:

[0016] GGCCGGGGGACGGGCTGGGA.

[0017] SEQ ID No. 2:

[0018] TCCCAGCCTCCCCCGGCC.

[0019] SEQ ID No.3:

[0020] TTTTAGCCTTTTTTGGCC.

[0021] Optionally, in the application, the gene component further includes a loop sequence; the composition order of the gene component is a DNA sequence expressing the MIR2911 sequence-loop sequence-a compensatory sequence that can form at least 80% complementarity with the DNA sequence.

[0022] Optionally, in the application, the loop sequence (5′-3′) is the sequence shown in SEQ ID No.4.

[0023] SEQ ID No.4:

[0024] GTTTTGGCCACTGACTGAC.

[0025] The overall gene assembly is arranged according to the MIR2911 sequence-Loop sequence-compensation sequence;

[0026] As shown in SEQ ID No.5 (corresponding to the supplementary sequence SEQ ID No.2):

[0027] GGCCGGGGGACGGGCTGGGA-GTTTTGGCCACTGACTGAC-TCCCAGCCTCCCCCGGCC;

[0028] Or as shown in SEQ ID No.6 (corresponding to the supplementary sequence SEQ ID No.3):

[0029] GGCCGGGGGACGGGCTGGGA-GTTTTGGCCACTGACTGAC-TTTTAGCCTTTTTTGGCC.

[0030] Optionally, in the application, the MIR2911 is contained in a delivery system, which contains the gene component. The delivery system can be enriched in the host's organ tissue and spontaneously form a complex structure containing the MIR2911 sequence endogenously in the organ tissue of the administration object.

[0031] Optionally, in the application, the delivery system is a viral vector or a non-viral vector; the viral vector includes adeno-associated viral vector, adenoviral vector, and retroviral vector; the non-viral vector includes plasmid vector, liposome vector, cationic polymer vector, nanoparticle vector, and multifunctional envelope nanocarrier.

[0032] Preferably, the vector is a plasmid vector.

[0033] The delivery system is a plasmid system, and the plasmid contains the promoter, targeting tag and gene components.

[0034] Optionally, in the application, the delivery system further comprises a promoter and a targeting tag, wherein the targeting tag can form a targeting structure of a composite structure in the organ tissue of the administered subject, wherein the targeting structure is located on the surface of the composite structure, and the composite structure can find and bind to the target tissue through the targeting structure, thereby delivering the MIR2911 sequence into the target tissue;

[0035] Preferably, the delivery system comprises any one or a combination of the following circuits: a promoter and a DNA sequence expressing the MIR2911 sequence, a promoter and a targeting tag, a promoter and a DNA sequence expressing the MIR2911 sequence and a targeting tag;

[0036] Preferably, the composite structure is an exosome.

[0037] The delivery system is arranged as a promoter-targeting tag-gene assembly.

[0038] Optionally, in the application, the promoter is a CMV promoter, and the targeting tag is selected from a targeting peptide or a targeting protein having a targeting function;

[0039] Preferably, the targeting peptide includes RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; more preferably, it is selected from RVG targeting peptide. The rabies virus peptide RVG can cross the blood-brain barrier and enter the brain tissue, allowing small nucleic acids to play a role in the brain, which plays an important role in the small nucleic acid treatment of brain diseases.

[0040] Preferably, the targeting protein includes RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein; more preferably, it is selected from RVG-LAMP2B fusion protein.

[0041] Through target prediction, it was found that MIR2911 can directly target YFV-NS3, YFV-NS4B and YFV-E, preferably YFV-NS3, and can inhibit the replication of YFV strains at the cellular level. The cellular level includes but is not limited to inhibiting the replication of YFV strains in HEK-293T, BHK-21, and Huh-7 cells (including replication at three levels: mRNA, protein, and virus particles).

[0042] The second invention point of the present application is to provide a pharmaceutical composition for use against yellow fever virus YFV, which comprises the gene assembly or the delivery system; and also contains pharmaceutical excipients; and the administration methods of the drug include oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

[0043] This drug can self-assemble in the body to form exosomes that encapsulate MIR2911, then enter the blood circulation and deliver MIR2911 to various tissues.

[0044] The present application also provides a method for inhibiting YFV replication or inhibiting YFV protein gene expression in vitro, wherein the inhibition is achieved by contacting an artificially synthesized plasmid expressing MIR2911 with YFV-infected cells.

[0045] Compared with the prior art, the present application has the following advantages: The application of MIR2911 provided in the present application in the preparation of drugs against yellow fever virus YFV innovatively proposes a new strategy of using a MIR2911 small nucleic acid drug to inhibit YFV replication, which can specifically target multiple genes of YFV and more effectively inhibit the replication of YFV in vitro. Cell experiments have shown that the small nucleic acid drug can directly target the YFV gene and can significantly inhibit the replication of YFV at three levels: mRNA, protein, and viral particles. As a mature injection, the safety and reliability of the plasmid have been fully verified, and its drugability is very good. The RNA sequence that ultimately exerts the effect is encapsulated and delivered by endogenous exosomes. There is no immune response, and there is no need to verify the safety of the exosomes. It can also compensate for individual differences in oral MIR2911. MIR2911 can directly target multiple genes of YFV and can effectively respond to viral genome mutations. Compared with protein and peptide drugs with single targets on the market, it is low-cost and more efficient. In addition, siRNA has a simple production process, flexible and diverse design, and powerful application functions. It provides an alternative method for targeting other viruses or treating diseases that are currently incurable or ineffective with other traditional therapies, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 A predicted secondary structure diagram of the artificially synthesized MIR2911 gene assembly after transfection into cells (MIR2911 small nucleic acid drug sense-loop-antisense hairpin structure), such as CMV-MIR2911 WT and CMV-MIR2911 13 -2 As shown, the red ones are the bases mutated in the original compensation sequence of MIR2911 (marked boxes in the figure).

[0047] Figure 2 In one embodiment of the present application, MIR2911 is predicted to target the YFV genome.

[0048] Figure 3 In one embodiment of the present application, a luciferase reporter gene assay was used to validate the predicted MIR2911 target sequence.

[0049] Figure 4 This is an electrophoresis result diagram of MIR2911 inhibiting the expression of target gene protein in one embodiment of the present application.

[0050] Figure 5 In one embodiment of the present application, the statistical results of the MIR2911 small nucleic acid drug inhibiting the expression of YFV-17D-NS3 mRNA at the cellular level are shown.

[0051] Figure 6In one embodiment of the present application, the electrophoresis results of the MIR2911 small nucleic acid drug inhibiting the expression level of YFV-17D-NS3 protein at the cellular level ( Figure 6 A) and statistical results ( Figure 6 B).

[0052] Figure 7 In one embodiment of the present application, the plaque assay results of the MIR2911 small nucleic acid drug inhibiting the expression of YFV-17D virus particles at the cellular level ( Figure 7 A) and experimental results statistics ( Figure 7 B). DETAILED DESCRIPTION

[0053] To make the purpose, technical solutions and advantages of this application more clear, this application is further described in detail below. However, it should be understood that the description herein is only used to explain this application and is not intended to limit the scope of this application.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are intended solely for the purpose of describing specific embodiments and are not intended to limit this application. The reagents and instruments used herein are commercially available, and the characterization methods involved can be found in the relevant descriptions in the prior art and will not be further elaborated herein.

[0055] In order to further understand the present application, the present application is further described in detail below in conjunction with the best embodiment.

[0056] Example 1

[0057] This example provides the use of MIR2911 in the preparation of drugs against yellow fever virus YFV.

[0058] In a specific application process, MIR2911 is derived from a gene assembly, which includes a DNA sequence for expressing the MIR2911 sequence and a compensatory sequence that can form at least 80% complementarity with the DNA sequence.

[0059] In the coding strand, the DNA sequence (5′-3′) expressing MIR2911 is shown in SEQ ID No. 1, and the complementary sequence (5′-3′) that is completely complementary to the DNA sequence expressing MIR2911 is shown in SEQ ID No. 2. To facilitate the expression of MIR2911, the bases in the complementary sequence are mutated to reduce the binding energy between MIR2911 and the complementary sequence. More preferably, the complementary sequence (5′-3′) is shown in SEQ ID No. 3. This conclusion can be verified by quantitative detection of MIR2911 expressed in exosomes after injection.

[0060] SEQ ID No. 1:

[0061] GGCCGGGGGACGGGCTGGGA.

[0062] SEQ ID No. 2:

[0063] TCCCAGCCTCCCCCGGCC.

[0064] SEQ ID No.3:

[0065] TTTTAGCCTTTTTTGGCC.

[0066] The gene component also includes a loop sequence; the composition order of the gene component is a DNA sequence expressing the MIR2911 sequence-loop sequence-a complementary sequence that can form at least 80% complementarity with the DNA sequence.

[0067] The loop sequence (5′-3′) is the sequence shown in SEQ ID No. 4.

[0068] SEQ ID No.4:

[0069] GTTTTGGCCACTGACTGAC.

[0070] The entire gene assembly is arranged according to the MIR2911 sequence-Loop sequence-compensatory sequence, which is shown in SEQ ID No. 5 (corresponding to the supplementary sequence SEQ ID No. 2):

[0071] GGCCGGGGGACGGGCTGGGA-GTTTTGGCCACTGACTGAC-TCCCAGCCTCCCCCGGCC;

[0072] Or the sequence shown in SEQ ID No.6 (corresponding to the supplementary sequence SEQ ID No.3):

[0073] GGCCGGGGGACGGGCTGGGA-GTTTTGGCCACTGACTGAC-TTTTAGCCTTTTTTGGCC.

[0074] In further specific usage, MIR2911 can also be derived from a delivery system containing gene components. The delivery system itself can be enriched in the host's organ tissues and spontaneously form a complex structure containing the MIR2911 sequence in the organ tissues of the administered object.

[0075] In practical applications, the delivery system can be either a viral vector or a non-viral vector; viral vectors include adeno-associated viral vectors, adenoviral vectors, and retroviral vectors; non-viral vectors include plasmid vectors, liposome vectors, cationic polymer vectors, nanoparticle vectors, and multifunctional envelope nanocarriers. Preferably, the vector is a plasmid vector.

[0076] The delivery system may further include a promoter and a targeting tag, wherein the targeting tag can form a targeting structure of a composite structure in the organ tissue of the administered subject, the targeting structure being located on the surface of the composite structure, and the composite structure can find and bind to the target tissue through the targeting structure, thereby delivering the MIR2911 sequence into the target tissue;

[0077] The delivery system includes any one of the following lines or a combination of several lines: a promoter and a DNA sequence expressing the MIR2911 sequence, a promoter and a targeting tag, a promoter and a DNA sequence expressing the MIR2911 sequence and a targeting tag;

[0078] The composite structure is an exosome.

[0079] The delivery system is arranged as a promoter-targeting tag-gene assembly.

[0080] The promoter is a CMV promoter, and the targeting tag is selected from a targeting peptide or a targeting protein having a targeting function;

[0081] Targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides; more preferably, RVG targeting peptides are selected. Rabies virus peptide RVG can cross the blood-brain barrier and enter the brain tissue, allowing small nucleic acids to play a role in the brain, which plays an important role in the treatment of small nucleic acid-induced brain diseases.

[0082] Preferably, the targeting protein includes RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein; more preferably, it is selected from RVG-LAMP2B fusion protein.

[0083] MIR2911 can directly target YFV-NS3, YFV-NS4B and YFV-E, preferably YFV-NS3, and can inhibit the replication of YFV strains at the cellular level. The cellular level includes but is not limited to inhibiting the replication of YFV strains in HEK-293T, BHK-21, and Huh-7 cells (including replication at the three levels of mRNA, protein, and viral particles).

[0084] This embodiment also provides a pharmaceutical composition for use against yellow fever virus YFV, which contains its gene components or a delivery system thereof; and also contains pharmaceutical excipients; and the drug administration methods include oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

[0085] This drug can self-assemble in the body to form exosomes that encapsulate MIR2911, then enter the blood circulation and deliver MIR2911 to various tissues.

[0086] This embodiment also provides a method for inhibiting YFV replication or inhibiting YFV protein gene expression in vitro, wherein the inhibition is achieved by contacting an artificially synthesized plasmid expressing MIR2911 with YFV-infected cells.

[0087] Example 2

[0088] Design and construction of the MIR2911 gene assembly:

[0089] The gene components constructed in the present invention are all in the form of plasmids. The plasmid system uses CMV as a promoter and pre-miR-155 as a basic skeleton, which are dissolved in PBS solution for subsequent research.

[0090] CMV-MIR2911 WT The MIR2911 nucleic acid sequence (5'-GGCCGGGGGACGGGCTGGGA-3'), loop stem-loop sequence (5'-GTTTTGGCCACTGACTGAC-3') and MIR2911 complementary sequence (5'-TCCCAGCCTCCCCCGGCC-3') were inserted into the backbone.

[0091] To further improve the expression efficiency of MIR2911 and reduce the strong binding energy in the hairpin structure of MIR2911, a gene loop CMV-MIR2911 was designed. 13-2 The C at eight different positions in the original complement sequence of MIR2911 was mutated to T, resulting in the complementary sequence (5′-TTTTAGCCTTTTTTGGCC-3′). In this loop, the expression level of MIR2911 was significantly increased. CMV-scrR, which expresses scrambled RNA, was used as a negative control.

[0092] Example 3

[0093] Verification of MIR2911 Directly Targeting the YFV Gene:

[0094] First, bioinformatics analysis was performed to determine whether MIR2911 could complement the YFV viral genome sequence. The specific method was as follows: the YFV genome sequence was obtained from the NCBI database (GeneID: 1502173), and RNAhybrid was used to search for potential MIR2911 binding sites on the YFV gene. Figure 2 As shown, there are multiple potential target genes of MIR2911 in YFV, such as YFV-NS3, YFV-NS4B and YFV-E.

[0095] Then, a luciferase reporter gene was used to detect whether MIR2911 can bind to the target gene predicted in YFV. The specific implementation method is as follows: an approximately 80bp nucleic acid fragment covering the predicted MIR2911 binding site on the YFV gene was inserted into a plasmid containing a luciferase reporter gene, and the binding sites included YFV-NS3, YFV-NS4B and YFV-E, etc. In the luciferase reporter gene assay, 0.2μg of firefly luciferase reporter plasmid, 0.2μg of β-galactosidase expression vector (Ambion) and an equal amount (20pmol) of mature MIR2911 or ncRNA were transfected into cells in a 24-well plate. The β-galactosidase vector was used as a transfection control. After 24 hours of transfection, the cells were analyzed using a luciferase detection kit.

[0096] Compared with ncRNA, the synthetic MIR 2911 reduced the luciferase activity by binding to the target gene sequence ( Figure 3 ), when the above target gene was mutated and then inserted into the plasmid, this MIR2911-dependent decrease in luciferase activity did not occur and the luciferase activity did not change.

[0097] Furthermore, this experiment also verified that MIR2911 can inhibit the expression of NS3 protein in YFV virus ( Figure 4 ), Figure 4 The electrophoresis results showed that MIR2911 could directly target the YFV gene and inhibit protein expression through base complementary pairing.

[0098] Example 4:

[0099] Verification of the anti-YFV-17D virus strain properties of the injectable MIR2911 small nucleic acid drug at the cellular level:

[0100] To further illustrate the anti-YFV properties of the injectable MIR2911 small nucleic acid drug, this example was verified at the cellular level. The specific experimental design is as follows: BHK-21, HEK-293T, and Huh-7 cells infected with YFV-17D virus were divided into 5 groups, namely, blank control group (CV), negative control group transfected with CMV-scrR (CMV-scrR), and transfected with CMV-MIR2911. WT Group (CMV-MIR2911 WT ), adding the antiviral drug Ribavirin group (Ribavirin) and transfecting CMV-MIR2911 13-2 Group (CMV-MIR2911 13-2 ) and the NS3 mRNA and protein levels and virus titers of the three cell types after transfection were identified.

[0101] like Figure 5 As shown, at the mRNA level, CMV-MIR2911 13-2 The mRNA of YFV-17D-NS3 in group A decreased significantly. Figure 6 ), WB results showed that CMV-MIR2911 13-2 It can significantly reduce the expression of YFV-17D-NS3 protein. This shows that at the cellular level, CMV-MIR2911 13-2 The purpose of resisting YFV-17D can be achieved by inhibiting the expression of YFV-17D virus strain genes.

[0102] CMV-MIR2911 13-2 It can also significantly inhibit the replication of YFV-17D virus strain and reduce the intracellular virus titer ( Figure 7 ), plaque assay showed that CMV-MIR2911 13-2 It can significantly reduce the titer of the virus in the cells and achieve the purpose of resisting YFV-17D.

[0103] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. The use of the MIR2911 gene assembly in the preparation of a drug against yellow fever virus YFV, characterized in that: The MIR2911 gene assembly CMV-RVG-MIR2911 13-2 including the MIR2911 nucleic acid sequence, stem-loop sequence, and MIR2911 mutation compensation sequence; The MIR2911 nucleic acid sequence is the sequence shown in SEQ ID No. 1; The stem-loop sequence is the sequence shown in SEQ ID No.4; The MIR2911 mutation compensation sequence is the sequence shown in SEQ ID No.

3.

2. The use according to claim 1, characterized in that The MIR2911 gene component is loaded into a delivery system, which can be enriched in the host's organ tissues and spontaneously form a complex structure containing the MIR2911 sequence in the organ tissues of the administration subject.

3. The use according to claim 2, characterized in that The delivery system is a plasmid vector.

4. A pharmaceutical composition for resisting yellow fever virus YFV, characterized in that: The pharmaceutical composition includes the MIR2911 gene component described in claim 1 or the delivery system described in claim 2 or 3; it also contains pharmaceutical excipients; the administration method of the drug includes oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

Images