Application of rice transcription factor OsRAV1 gene in regulating seed storage tolerance and germination stage salt tolerance
By regulating and knocking out the expression of the rice transcription factor OsRAV1 gene, the problem of decreased rice seed vigor during storage was solved, germination rate and seedling rate were improved, rice salt tolerance was enhanced, and germplasm resources for high-vigor rice varieties were provided.
Patent Information
- Application Number
- CN202410948167.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2044-07-16
AI Technical Summary
In existing technologies, rice seeds lose viability during storage, leading to reduced germination rates and abnormal seedling growth. This is especially true in coastal areas where saline stress negatively impacts seed germination and seedling establishment. Furthermore, there are few genes regulating seed viability, and the molecular mechanisms are unclear.
By regulating the expression levels of the rice transcription factor OsRAV1 gene through overexpression and CRISPR/Cas9 technology, seed vigor after seed storage and seedling emergence rate under direct seeding conditions were improved. Gene editing was performed using OsRAV1 overexpression materials and knockout materials to obtain rice varieties with high seed vigor.
It significantly improved the germination rate and seedling rate of seeds after storage, enhanced the tolerance of rice to salt stress, improved the germination vitality and salt tolerance of rice seeds, and provided excellent germplasm resources.
Smart Images

Figure CN118726455B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of plant molecular biology and plant breeding, specifically involving the application of the rice transcription factor OsRAV1 gene in regulating seed storage tolerance and germination salt tolerance. Background Technology
[0002] Rice seed vigor is closely related to factors such as seed storage conditions, and largely determines seedling growth and tolerance to stress. High temperature and high humidity during seed storage can lead to decreased seed vigor, manifested as reduced germination rate, abnormal seedling growth, and decreased tolerance to stress. The promotion of direct-seeding rice technology in coastal areas mainly faces salt stress, which negatively impacts seed germination and seedling establishment.
[0003] Enhancing seed vigor is a key strategy for improving crop productivity and adaptability. However, currently, there are few cloned genes in rice that regulate seed vigor, and the molecular mechanisms are unclear. Furthermore, there are correlations between seed germination, storage tolerance, and salt tolerance during germination. Utilizing different allelic variations in gene promoters or coding regions to regulate transcriptional levels and protein activity is significant for improving or balancing seed germination, storage tolerance, and salt tolerance during germination. Related research provides excellent germplasm resources for breeding rice varieties with high seed vigor. Summary of the Invention
[0004] The purpose of this invention is to provide the application of the rice transcription factor OsRAV1 gene in regulating seed storage tolerance and salt tolerance during germination. Through overexpression and CRISPR / Cas9 technology of OsRAV1 transgenic materials with different expression levels, it was found that OsRAV1 overexpression materials can improve seed vigor after storage, seedling emergence rate under direct seeding conditions, and salt tolerance. This provides a new gene resource for breeding high-seed vigor rice suitable for direct seeding, which is of great significance for the breeding of rice varieties with storage tolerance, suitability for direct seeding, and salt tolerance.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the application of the rice transcription factor OsRAV1 gene in regulating the storage tolerance and salt tolerance of rice seeds during germination.
[0007] The regulation of salt tolerance during rice germination is to improve the germination rate of rice seeds and the seedling rate, root length, shoot length, root dry weight, and shoot dry weight during the germination period under salt stress.
[0008] This invention also provides the application of the rice transcription factor OsRAV1 gene in regulating the emergence rate of rice direct seeding.
[0009] Preferably, the nucleic acid sequence of the OsRAV1 gene is shown in SEQ ID NO.1; and the encoded amino acid sequence is shown in SEQ ID NO.11.
[0010] This invention also provides a method for regulating rice seed vigor by overexpressing the transcription factor OsRAV1 gene in rice to obtain transgenic rice plants and rice varieties with high seed vigor. The nucleic acid sequence of the rice transcription factor OsRAV1 gene is shown in SEQ ID NO.1.
[0011] Preferably, the regulation of rice seed vigor is to improve rice seed vigor.
[0012] Preferably, the regulation of rice seed vigor is to improve the germination rate and final germination rate of rice seeds after aging treatment.
[0013] Preferably, the regulation of rice seed vigor is to improve the germination rate of rice seeds under salt stress and to improve the seedling rate, root length, shoot length, root dry weight and shoot dry weight of rice during the germination period under salt stress.
[0014] Preferably, obtaining transgenic rice plants includes: transforming Agrobacterium EHA105 competent cells with a plasmid containing the OsRAV1 coding region fragment, infecting rice seed callus tissue, and obtaining transgenic rice plants through hygromycin screening.
[0015] Preferably, the primers for identifying the transgenic rice plants are shown in SEQ ID NO.2~5.
[0016] A method for regulating rice seed vigor, the method comprising overexpressing the transcription factor OsRAV1 gene in rice to enhance seed vigor. Using CRISPR / Cas9 gene editing technology, transgenic rice plants with the OsRAV1 gene knocked out are obtained, resulting in reduced seed vigor. The nucleic acid sequence of the rice transcription factor OsRAV1 gene is shown in SEQ ID NO. 1.
[0017] The method for overexpressing the OsRAV1 gene in rice includes the following steps:
[0018] (1) Using Nipponbare cDNA as a template, homologous recombination primers were designed, and the OsRAV1 coding region sequence was amplified using a high-fidelity enzyme;
[0019] (2) The purified product obtained in (1) was cloned into the pB1301UbiNOS-OsRAV1-3ha vector to obtain the recombinant plasmid.
[0020] (3) The plasmid containing the OsRAV1 coding region fragment in (2) was transformed into Agrobacterium EHA105 competent cells, which were then infected with rice seed callus tissue. Transgenic rice plants were obtained by screening with hygromycin.
[0021] (4) The primer sequence in step (3) is:
[0022] Hm-F: GCTTCTGCGGGCGATTTGTGT (SEQ ID NO.2)
[0023] Hm -R: GGTCGCGGAGGCTATGGATGC (SEQ ID NO.3)
[0024] (5) Transgenic plants were identified by qRT-PCR using primers OsRAV1-F: GTGGAGCCGATTCGTGAGGGAG (SEQ ID NO.4) and OsRAV1-R: CGTCGACGGTTGCCAGGTTGTT (SEQ ID NO.5).
[0025] The method for knocking out the OsRAV1 gene in rice includes the following steps:
[0026] The method for targeted knockout of the rice transcription factor OsRAV1 gene employs CRISPR / Cas9 gene editing technology. The target sequence of the OsRAV1 gene and the corresponding upstream and downstream primers are selected, and intermediate and final vectors are constructed sequentially. The final vector is then used to infect rice callus tissue to obtain transgenic rice plants with the OsRAV1 gene knocked out, thus completing the targeted knockout of the rice OsRAV1 gene.
[0027] (1) The target sequence is a 20np fragment on the first exon of the OsRAV1 gene, and the target sequence is GCTCGTCCACGGACAAGCTG (SEQ ID NO.6).
[0028] (2) The nucleotide sequence of the upstream primer is ggacatccgtccgtactggggtag (SEQ ID NO.7), and the nucleotide sequence of the downstream primer is aaacgcttcggtatgacgagcctg (SEQ ID NO.8).
[0029] (3) The construction method of the intermediate vector includes the following steps: 1. The intermediate vector SK-gRNA is digested with restriction endonuclease AarI; 2. The upstream and downstream primers are mixed in equal proportions, denatured at 100℃ for 5 minutes, and cooled to room temperature to form a fragment with sticky ends; 3. The digested SK-gRNA vector and the fragment with sticky ends are ligated by T4 ligase, and transformed into Escherichia coli DH5α competent cells to obtain the intermediate vector SK-Grna-OsRAV1 containing the target fragment.
[0030] (4) The final vector construction method includes the following steps: 1. The final vector pC1300-Cas9 is digested with restriction endonucleases KpnI and BamHI to form a vector with sticky ends; 2. The intermediate vector SK-gRNA-OsRAV1 obtained in the above steps is digested with restriction endonucleases KpnI and BglII, and the fragment is recovered; 3. The pC1300-Cas9 vector with sticky ends and the above fragment are ligated, transformed into Escherichia coli DH5α competent cells, and the final vector pC1300-Cas9-gRNA-OsRAV1 containing the target sequence is obtained by sequencing detection.
[0031] (5) Transform Agrobacterium EHA105 competent cells into the final vector successfully constructed in (4), infect rice callus tissue, and obtain transgenic rice plants by screening with hygromycin and PCR.
[0032] (6) OsRAV1 sequencing-specific primers osrav1-F: atccgtccgtactggggtag; (SEQ ID NO. 9) and osrav1-R: gcttcggtatgacgagcctg (SEQ ID NO. 10). Sequencing screening of the above transgenic rice plants yielded the mutant line osrav1-1 with a 5-base deletion of "ACAAG" and the mutant line osrav1-2 with a 1-base insertion of "G". Figure 1 ).
[0033] Beneficial effects
[0034] The OsRAV1 gene and its encoded protein of this invention can be used to regulate the storage tolerance and salt tolerance during germination of rice seeds. After artificial aging treatment, the germination rate of overexpressing seeds was significantly higher than that of wild-type seeds, while the opposite was true for knockout lines. In the control (CK) treatment, the root length and dry weight of overexpressing lines were significantly greater than those of wild-type seeds. In the 0.5% NaCl saline soil treatment, the seedling emergence rates of the two overexpressing lines increased by 68.54% and 133.90%, respectively, and the root length, shoot length, root dry weight, and shoot dry weight were also significantly greater than those of wild-type seeds, while the opposite was true for knockout lines. Therefore, this invention can be used to solve the problem of decreased seed germination vigor after storage, improve the seedling emergence rate and salt stress tolerance during direct seeding of rice, and has broad application prospects. Attached Figure Description
[0035] Figure 1 To detect the expression level of OsRAV1 in overexpression materials.
[0036] Figure 2 Identification of knockout sites for OsRAV1 mutant materials.
[0037] Figure 3 Germination phenotypes of transgenic and wild-type materials after aging treatment. (A) Germination phenotypes of transgenic and parental lines at 3, 6, and 9 days after CK treatment and aging treatment. NIP is wild-type, and OE1 and OE2 are overexpression lines. (BE) Germination rates of transgenic and parental lines at 3, 6, and 9 days after CK treatment and aging treatment.
[0038] Figure 4 Phenotypic detection for direct seeding of transgenic and wild-type materials. (AB) Seedling rate and phenotype at CK and different salt concentrations. (CF) OsRAV1 positively regulates shoot and root growth; different letters indicate significant differences (p<0.05). Detailed Implementation
[0039] Example 1: Creation of rice transcription factor OsRAV1 gene overexpression lines.
[0040] (1) RNA was extracted from leaves of Nipponbare, cDNA template was obtained using Tiangen reverse transcription reagent, homologous recombination primers were designed, and the OsRAV1 coding region was amplified using high-fidelity enzyme.
[0041] (2) p1301UbiNOS was digested with the restriction endonuclease BamHI for 1 h. The digestion system is as follows:
[0042]
[0043] (3) Using the Novitane homologous recombination method, the OsRAV1 coding region was cloned into the pBWA(V)HU-OsRAV1-3ha vector to obtain the recombinant plasmid, which was then transformed into Agrobacterium EHA105 competent cells for later use. The homologous recombination method and system are as follows: water bath for 30 min, then immediately placed on ice for 5 min.
[0044]
[0045] (4) Harvest the seeds of Nipponbare 40 days after heading and manually remove the seed husks. Soak the seeds in 75% ethanol and sodium hypochlorite in sequence, then wash off the impurities on the seed surface with sterile distilled water, and then culture the seeds on a culture medium to obtain callus tissue.
[0046] (5) Infect rice seed callus tissue (3) with Agrobacterium from step (2), and obtain transgenic rice plants by screening with hygromycin. The positive transgenic plants were identified by PCR. The sequence of the front primer was GCTTCGCGGGCGATTTGTGT (SEQ ID NO.2), and the sequence of the back primer was GGTCGCGGAGGCTATGGATGC (SEQ ID NO.3).
[0047] (6) Detection of T2-type stable transgenic plants using qRT-PCR ( Figure 1 The front primer sequence was GTGGAGCCGATTCGTGAGGGAG (SEQ ID NO. 4), and the back primer sequence was CGTCGACGGTTGCCAGGTTG TT (SEQ ID NO. 5). Overexpression lines OsRAV1 overexpression line 1 (OE1) and OsRAV1 overexpression line 2 (OE2) were obtained.
[0048] Example 2: Creation of knockout lines of rice transcription factor OsRAV1 gene.
[0049] The gene editing method used in this case was based on the CRISPR / Cas9 system provided by the research group of Wang Kejian at the Rice Research Institute of the Chinese Academy of Agricultural Sciences. The OsRAV1 gene coding region-specific target sequence GCTCGCCACGGACAAGCTG (SEQ ID NO. 6) was selected. Based on the intermediate vector SK-gRNA restriction endonuclease (Aar I), the pre-primer sequence for the OsRAV1 gene editing vector was designed as ggacatccgtccgtactggggtag (SEQ ID NO. 7), and the post-primer sequence as aaacgcttcggtatgacgagcctg (SEQ ID NO. 8). The successfully constructed final vector pC1300-Cas9-gRNA-OsRAV1 was transformed into Agrobacterium EHA105 competent cells, infecting rice callus tissue to obtain OsRAV1 mutant transgenic plants.
[0050] The specific method for constructing the carrier is as follows:
[0051] (1) The intermediate vector SK-gRNA was digested overnight with the restriction endonuclease Aar I. The digestion system is shown in the table below:
[0052]
[0053] (2) Mix 15 μl of each of the upstream and downstream primers of the OsRAV1 gene editing vector together, anneal and denature at 100 °C for 5 min, and cool at room temperature to form a fragment with sticky ends for later use.
[0054] (3) The linearized intermediate vector SK-gRNA (1) and the sticky-end fragment (2) were ligated at 22℃ for 1 h. The ligation product was transformed into competent E. coli DH5α cells. Single clones were picked, plasmids were extracted, and sequencing was performed to obtain the intermediate vector SK-gRNA-OsRAV1 carrying the target fragment. The system is shown in the table below:
[0055]
[0056] (4) The intermediate vector SK-gRNA-OsRAV1 in (3) was digested with BamHI and BglII and the fragment was recovered. The system is shown in the table below:
[0057]
[0058] (5) The final vector pC1300-Cas9 was digested with Kpn I and BamHI at 37℃ for 1 h. The system is shown in the table below:
[0059]
[0060] (6) The recovered intermediate vector fragment (4) and the enzyme-digested final vector (5) were ligated using T4 ligase (system as above). The vector was transformed into competent E. coli DH5α cells, and after picking single clones to extract plasmids, the OsRAV1 knockout vector pC1300-Cas9-gRNA-OsRAV1 was obtained by sequencing.
[0061] Example 3: Identification of OsRAV1 homozygous mutant plants
[0062] (1) Extract DNA from the leaves of T0 generation transgenic plants, design primers for detection, and the primer sequences are shown below:
[0063] osrav1-F:CATCACGCACCCACGCATA (SEQ ID NO.9);
[0064] osrav1-R: CCTCCTATTCTAGTCAAACACTAATCC (SEQ ID NO. 10);
[0065] (2) Through the above screening, the mutant line osrav1-1 with a deletion of 5 bases "ACAAG" and the mutant line osrav1-2 with an insertion of 1 base "G" were finally obtained. Figure 2 ).
[0066] Example 4: Investigation of the regulation of seed vigor after seed storage by the OsRAV1 gene
[0067] (1) In this invention, the genetically modified and parental seeds harvested at maturity are dried at 37°C and then stored at room temperature for 3 months.
[0068] (2) The seeds were soaked in a saturated NaCl solution at 42°C for artificial aging treatment to reduce seed vigor.
[0069] (3) Soak the seeds in pure water at 4℃ for 3 days.
[0070] (4) Then place the seeds in a germination experiment in a 28℃, 80% humidity incubator (12 hours of light / 12 hours of darkness).
[0071] (5) By Figure 3 It was found that the germination rate and final germination rate of osrav1-1 and osrav1-2 were significantly lower than those of the wild type. In the CK and 3-day aging treatments, the germination rate of OE1 and OE2 was slightly lower than that of the wild type. With the increase of aging time, the germination rate and final germination rate of the overexpressed OE1 and OE2 were significantly higher than those of the wild type.
[0072] Example 5: Investigation on the regulation of salt tolerance during seed germination by the OsRAV1 gene
[0073] (1) In this invention, the genetically modified and parental seeds harvested at maturity are dried at 37°C and then stored at room temperature for 3 months.
[0074] (2) The seeds were sown in 0.5 cm soil and subjected to three salt stress (NaCl) treatments of 0, 0.25% and 0.50%.
[0075] (3) Place the seedlings in a 28℃, 80% humidity incubator (12 hours of light / 12 hours of darkness) for 7 days and measure the seedling rate, root length, shoot length, root dry weight and shoot dry weight.
[0076] (4) By Figure 4 It was found that the seedling emergence rate, root length, shoot length, root dry weight, and shoot dry weight of osrav1-1 and osrav1-2 were significantly lower than those of the wild type, especially under high salt stress. In the CK treatment, the seedling emergence rate of OE1 and OE2 was not significantly different from that of the wild type, but their root length and root dry weight were significantly greater than those of the wild type, especially under salt stress. In the 0.5% NaCl treatment, the seedling emergence rate of OE1 and OE2 increased by 68.54% and 133.9%, respectively, and the seedling quality, such as root length, shoot length, root dry weight, and shoot dry weight, was also significantly better than that of the wild type. This indicates that overexpression of the rice transcription factor OsRAV1 gene can significantly improve the direct seeding emergence rate of rice and enhance the salt tolerance of rice during germination.
[0077] This invention provides a pathway for regulating seed storage tolerance and germination salt tolerance through the rice transcription factor OsRAV1 gene, providing excellent germplasm resources for breeding rice varieties with high seed vigor.
Claims
1. Overexpression of rice transcription factors OsRAV1 The application of genes in improving salt tolerance during rice germination is characterized by, The rice transcription factor OsRAV1 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; The improvement of salt tolerance during rice germination period refers to increasing the germination rate of rice seeds and the seedling rate, root length, shoot length, root dry weight, and shoot dry weight during the germination period under salt stress conditions.
2. A method for regulating rice seed vigor, characterized in that, Overexpression of transcription factors in rice OsRAV1 Genes, to obtain transgenic rice plants and rice varieties with high seed vigor, the rice transcription factor OsRAV1 The nucleic acid sequence of the gene is shown in SEQ ID NO.1; the regulation of rice seed vigor is to improve rice seed vigor. The regulation of rice seed vigor aims to improve the germination rate of rice seeds under salt stress and to improve the seedling rate, root length, shoot length, root dry weight, and shoot dry weight during the germination period of rice under salt stress.
3. The method for regulating rice seed vigor according to claim 2, characterized in that, The process of obtaining transgenic rice plants includes: [the process of obtaining transgenic rice plants carrying...] OsRAV1 Plasmid transformation of coding region fragment into Agrobacterium EHA105 Competent cells were used to infect rice seed callus tissue, and transgenic rice plants were obtained through screening with hygromycin.
4. The method for regulating rice seed vigor according to claim 3, characterized in that, The primers for identifying the transgenic rice plants are shown in SEQ ID NO.2~5.