A group of diagnostic markers for aortic dissection and their applications
Through the genes MMP8, ALOX15, HP, FXYD2, SIGLEC8 and CCL2 as diagnostic markers of aortic dissection, the problem of the time-consuming early diagnosis of aortic dissection in the prior art is solved, and solutions for early diagnosis and risk assessment are provided, which are suitable for primary hospitals.
Patent Information
- Application Number
- CN202410988866.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-23
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2044-07-23
AI Technical Summary
The prior art is difficult to detect aortic dissection early, the diagnosis of aortic enhanced CT is long and difficult to implement in primary hospitals, the acquisition of aortic tissue is difficult, and the application of differentially expressed RNA as a biomarker in peripheral blood is limited.
The genes MMP8, ALOX15, HP, FXYD2, SIGLEC8 and CCL2 are used as diagnostic markers of aortic dissection, and the expression amount of these genes is detected or specific identification is specifically identified through a kit to provide diagnostic, screening and risk assessment products.
It realizes the possibility of early diagnosis of aortic dissection, reduces the detection time and cost, is suitable for primary hospitals, and improves the accuracy and efficiency of diagnosis.
Smart Images

Figure CN118726572B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological detection technology, and in particular relates to a group of aortic dissection diagnostic markers and applications thereof. Background Art
[0002] Cardiovascular disease (CVD) is the leading cause of death in many countries, resulting in 16.7 million deaths annually. Aortic dissection (AD) is one of the most dangerous cardiovascular diseases. It occurs when the aortic intima ruptures due to various causes, allowing blood to enter the media and tear the aortic wall, creating true and false lumens. AD is classified by the Stanford classification as either Stanford A or Stanford B. Acute Stanford type A aortic dissection (ATAAD) is a critical emergency and carries a high mortality rate. The mortality rate increases by approximately 1% per hour within the first two days of onset, and for patients who do not undergo surgical treatment, the mortality rate can reach as high as 74% within two weeks.
[0003] With the completion of the human genome sequencing project and the development of high-throughput sequencing technology, medical researchers have gained a deeper understanding of the human genome, and a deeper understanding of disease-associated genetic variants, the functions of related genes, and regulatory networks. High-throughput sequencing has also been widely used. In recent years, an increasing number of studies have identified genes associated with ATAAD through high-throughput sequencing. However, most of these studies have been based on RNA expressed in aortic tissue. Because obtaining aortic tissue is invasive and difficult to apply clinically, using differentially expressed RNA in aortic tissue as a biomarker for AD may not be appropriate.
[0004] ATAAD is associated with high rates of disability and mortality, making early detection challenging. Although enhanced aortic CT is the gold standard for diagnosing ATAAD, it is expensive, time-consuming, and often unavailable in many primary care hospitals. Furthermore, aortic tissue is difficult to obtain, making it challenging to identify differentially expressed RNA as a biomarker. Therefore, differentially expressed RNA screened from peripheral blood can more easily be used as a biomarker for ATAAD in clinical practice. Summary of the Invention
[0005] Technical problems solved: In response to the above technical problems, the present invention provides a set of diagnostic markers for aortic dissection and their applications, which can effectively solve the shortcomings of existing methods for detecting type A aortic dissection, such as long detection time.
[0006] Technical solution: In the first aspect, the present invention provides a group of diagnostic markers for aortic dissection, including gene MMP8 (Gene ID: 4317), gene ALOX15 (Gene ID: 246), gene HP (Gene ID: 3240), gene FXYD2 (Gene ID: 486), gene SIGLEC8 (Gene ID: 27181) and gene CCL2 (Gene ID: 6347).
[0007] In a second aspect, the present invention provides a kit comprising a reagent for detecting the expression level of the aortic dissection diagnostic marker described in the first aspect, or a reagent for specifically identifying the aortic dissection diagnostic marker described in the first aspect, or a reagent for detecting the content of the aortic dissection diagnostic marker described in the first aspect.
[0008] Preferably, the kit includes primers for detecting the expression level of aortic dissection diagnostic markers; or primers for specifically identifying aortic dissection diagnostic markers.
[0009] Furthermore, the primers include upstream and downstream primers for amplifying genes MMP8, ALOX15, HP, FXYD2, SIGLEC8, and CCL2, and their nucleotide sequences are shown in SEQ ID No. 1 to SEQ ID No. 12:
[0010] SEQ ID No.1: CTCCCTGAAGACGCTTCCAT;
[0011] SEQ ID No.2: AGACTGATACTGGTTGCTTGGT;
[0012] SEQ ID No.3:TTGCAGCCTGATGGGAAACT;
[0013] SEQ ID No.4: TCCGTAGGCAAGAAAAGGGG;
[0014] SEQ ID No.5: CAGCACAGTCCCCGAAAAGAA;
[0015] SEQ ID No.6: CAGTCGCATACCAGGTGTCC;
[0016] SEQ ID No.7:CGTGGACCCGTTCTACTATGACTA;
[0017] SEQ ID No.8: GCGCTTCTTATTGCCCCCAC;
[0018] SEQ ID No.9: GGAAGAAATCGGCAAGGCCAG;
[0019] SEQ ID No.10: GGGGTTGCCATCTTTCCAGG;
[0020] SEQ ID No.11:GATCTCAGTGCAGAGGCTCG;
[0021] SEQ ID No. 12: TGAACCCACTTCTGCTTGGG.
[0022] In a third aspect, the present invention provides use of the marker described in the first aspect or the kit described in the second aspect in at least one of the following projects:
[0023] 1) Application in the preparation of products for diagnosing aortic dissection;
[0024] 2) Application in the preparation of products for screening aortic dissection;
[0025] 3) Application in the preparation of products for assessing the risk of aortic dissection.
[0026] Beneficial effects: 1) The genes MMP8, ALOX15, HP, FXYD2, SIGLEC8 and CCL2 protected by the present invention can be used as biomarkers for AD;
[0027] 2) The genes MMP8, ALOX15, HP, FXYD2, SIGLEC8 and CCL2 protected by the present invention can be used as one of the indicators for assessing the severity of AD patients. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 Volcano plot (A) and cluster heat map (B) of differentially expressed genes, where L represents the dissection case group and HC represents the normal control group;
[0029] Figure 2 The qPCR results are used to specifically verify the mRNA expression levels of each gene between the aortic dissection and acute myocardial infarction case groups and the normal control group in the present invention, where CON: normal control group (n=64); AMI: acute myocardial infarction case group; ATAAD: aortic dissection case group (n=64), *: P<0.05; **: P<0.01; ***: P<0.001; ns: no statistically significant difference;
[0030] Figure 3 is the restricted cubic spline regression analysis curve of the association between specific gene mRNA expression and ATAAD;
[0031] Figure 4 It is a ROC curve diagram of the molecular markers of different gene combinations in the present invention for diagnosing aortic dissection. DETAILED DESCRIPTION
[0032] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments: Example 1
[0033] First, high-throughput transcriptome sequencing was performed on eight ATAAD cases and 20 normal controls to identify differentially expressed mRNA genes in ATAAD cases. Twenty genes each with the most significant up-regulated and down-regulated differential expression in the sequencing results were included in the validation phase. A three-group case-control study design was then employed. In the first phase, 84 pairs of ATAAD case and control samples were used for validation. Gene mRNAs with statistically significant validation results consistent with the sequencing direction were included in the second phase of validation. In the second phase, 94 pairs of ATAAD case and control samples were used for validation. Gene mRNAs with statistically significant validation results consistent with the sequencing direction were included in the specificity validation phase. Real-time quantitative polymerase chain reaction (qRT-PCR) was used to determine mRNA expression levels of the validated genes. Finally, relative quantification (2-ΔΔCT) was used to calculate mRNA expression levels. Gene expression differences between the case and control groups were compared using the Mann-Whitney U test. Restricted cubic spline regression (RCS) was used to explore the dose-response relationship between gene mRNA expression levels and ATAAD. Receiver operating characteristic (ROC) curves were used to evaluate the ability of specific gene mRNA to discriminate between ATAAD and normal subjects. The sensitivity, specificity, and area under the ROC curve (AUC) were analyzed. Different models were constructed to analyze their value in discriminating ATAAD. Specific data are as follows:
[0034] Association between specific mRNA expression and acute Stanford type A aortic dissection: a case-control study.
[0035] 1. Clinical samples:
[0036] Peripheral blood was collected from 178 patients diagnosed with AD who were hospitalized in the Department of Cardiovascular Surgery at Nanjing First Hospital between 2019 and 2022. 1.5 mL of peripheral blood was collected using an EDTA anticoagulant tube, and 4.5 mL of whole blood RNA preservation solution (Nanjing Yi Ning Fu Sheng Biotechnology Co., Ltd.) was added and thoroughly mixed. The blood was then stored in a -20°C refrigerator for RNA extraction. Inclusion criteria:
[0037] Inclusion criteria for ATAAD patients included: ① Han Chinese aged 18-85 years; ② ATAAD diagnosed by full-length aortic contrast-enhanced scanning and confirmed intraoperatively. Exclusion criteria included: ① Cardiovascular disease caused by genetic disorders or inherited cardiovascular diseases such as Marfan syndrome, Ehlers-Danlos syndrome, familial thoracic aortic aneurysm, and dissection caused by trauma; ② Patients confirmed intraoperatively to have non-ATAAD; ③ Patients with malignant tumors; ④ Patients with other conditions deemed unsuitable for inclusion in the study by the investigator.
[0038] This invention is in collaboration with the School of Public Health of Nanjing Medical University, and the control source is the prospective cohort study population conducted in Jurong City, Jiangsu Province from 2018 to 2019.
[0039] Inclusion criteria for controls: Individuals were matched 1:1 with ATAAD cases in terms of age (±2 years) and gender.
[0040] Control exclusion criteria: patients with severe heart, brain, lung, kidney diseases and tumors.
[0041] 2. Experimental methods:
[0042] 2.1 RNA extraction:
[0043] Total RNA from peripheral blood was extracted using the magnetic bead method (Cat# Yu-BR02-1, Yu'an Biotechnology Co., Ltd., Wuxi, China). The specific steps are as follows:
[0044] (1) Sample processing: Thaw the frozen sample in the preservation solution at room temperature, mix thoroughly by inverting, add 800 μL of the sample to a 1.5 mL centrifuge tube, then add 600 μL of isopropanol, and mix thoroughly by inverting. Centrifuge at 7230 rpm at 4°C for 10 min.
[0045] (2) Discard the supernatant and retain the precipitate. Add 400 μL of lysis adsorption buffer, 10 μL of RNA protectant, and 10 μL of mixed magnetic beads. Close the lid and place the centrifuge tube on a shaker for 10 minutes. Remove the centrifuge tube and centrifuge briefly.
[0046] (3) Place the centrifuge tube on a magnetic rack and let it stand for 2 minutes. Open the lid, aspirate the liquid with a pipette and discard it, retaining the magnetic beads.
[0047] (4) Add 600 μL of Buffer AW1, close the cap, and place the centrifuge tube on a shaker for 1 min.
[0048] (5) Place the centrifuge tube on a magnetic rack. After standing for 1 minute, quickly invert the magnetic rack upside down to fully recover the magnetic beads on the centrifuge tube cap. Let it stand for another 1 minute. Open the cap, aspirate the liquid with a pipette and discard it, retaining the magnetic beads.
[0049] (6) Add 600 μL of 80% DEPC ethanol, close the cap, and place the centrifuge tube on a shaker for 1 min;
[0050] (7) Place the centrifuge tube on a magnetic rack. After standing for 1 minute, quickly invert the magnetic rack upside down to fully recover the magnetic beads on the centrifuge tube cap. Let stand for another 1 minute. Open the cap and use a pipette to aspirate and discard the liquid, retaining the magnetic beads.
[0051] (8) Repeat steps (6)-(7);
[0052] (9) Place the centrifuge tube on a foam board, place it in a 50°C constant temperature water bath, and dry it for 2 minutes;
[0053] (10) Take back the centrifuge tube, add 50 μL of eluent A, blow the magnetic beads thoroughly to disperse them into the eluent, close the lid, place the centrifuge tube on a foam board, and place it in a 52°C constant temperature water bath for 2 min;
[0054] (11) Place the centrifuge tube on a magnetic rack and let it stand for 2 minutes until the liquid becomes clear. Open the lid and use a pipette to transfer the liquid to another new centrifuge tube, discarding the magnetic beads.
[0055] (12) RNA concentration and purity were detected by ultraviolet spectrophotometry (Thermo Nano Drop 2000 nucleic acid protein analyzer). RNA purity was qualified when the OD value (260 / 280) was between 1.8 and 2.0.
[0056] 2.2 RNA reverse transcription to cDNA
[0057] cDNA was synthesized using the TAKARA reverse transcription kit (RR047A Takara PrimeScript™ RT reagent Kit with gDNA Eraser, Japan). The specific steps are as follows:
[0058] (1) Based on the measured concentrations, balance the RNA of samples with different concentrations to four fixed values: 10 ng / μL, 30 ng / μL, 50 ng / μL, and 100 ng / μL. Calculate the volume of eluent A required based on the concentrations;
[0059] (2) Add 2 μL of reverse transcription system 1 to a 200 μL centrifuge tube;
[0060] (3) Add RNA sample to the centrifuge tube (volume calculated based on concentration), centrifuge, and place in a 42°C water bath for 2 min;
[0061] (4) Add 10 μL of reverse transcription system 2 and centrifuge;
[0062] (5) PCR amplification, the program was set at 37°C for 15 min, 85°C for 5 s, and 15°C for ∞;
[0063] (6) After reverse transcription is completed, store in a -80°C refrigerator for subsequent experiments.
[0064] 2.3 qRT-PCR
[0065] Design the mRNA primer sequences according to the mRNA primer design principles;
[0066] Relative quantification of mRNA was performed by qPCR using the SYBR Green assay. A 384-well plate was used, with three replicate wells set up for each sample, and GAPDH was used as the reference gene. The first-stage assay was performed using the ABI QuantStudio 7 fluorescence quantitative PCR system, and the second-stage assay and specificity verification were performed using the Fusheng FS384 real-time fluorescence quantitative PCR instrument. The standard deviation of the CT value between replicate wells for each sample was less than 0.5, and the final reading was the average of the three replicate wells.
[0067] The system used 1.5 μL of cDNA sample, 1.3 μL of RNase-free H2O, 2.8 μL of SYBR Green Master Mix, and 0.2 μL each of forward and reverse primers, for a total of 6 μL system;
[0068] The qPCR program settings were: ① Pre-denaturation: 95°C, 5 min; ② Denaturation: 95°C, 10 s; ③ Annealing: 57°C, 20 s; ④ Extension: 72°C, 20 s; ⑤ Melting curve: instrument default settings. Steps ②-④ were cycled 40 times, and the remaining steps were performed only once.
[0069] 2.4 Calculation method of mRNA expression
[0070] The relative quantification method (2-ΔΔCT) was used to calculate the expression level of each mRNA. The specific method is as follows:
[0071] (1) ΔCT = CT value of target gene - CT value of reference gene;
[0072] (2) Batch coefficient fn = average ΔCT of the control group in each batch / average ΔCT of the total control group;
[0073] (3) ΔCT core = ΔCT / fn;
[0074] (4) ΔΔCT core = ΔCT core - average ΔCT of total control;
[0075] (5) mRNA expression level = 2(-ΔΔCT nuclei).
[0076] 2.5 Data collation and statistical analysis
[0077] All experimental data were independently collated and verified for consistency by two researchers. The mRNA expression of each gene was calculated using the relative quantification method. Before analysis, the ΔCT value was corrected for extreme values using the mean ± three standard deviations. Differences in mRNA expression levels between the case and control groups were compared using the Mann-Whitney U test. Restricted cubic spline (RCS) regression was used to analyze the dose-response relationship between mRNA expression levels and ATAAD prevalence. Receiver-operating characteristic (ROC) curves were constructed to analyze the ability of specific mRNAs to discriminate between ATAAD and healthy individuals. Sensitivity, specificity, and area under the curve (AUC) were calculated. All analyses were performed using SPSS 24 or R4.2.2 statistical software. Statistical significance was considered to be two-sided P < 0.05.
[0078] 3. Experimental results:
[0079] like Figure 1 As shown: RNA-Seq detected a total of 19,548 mRNAs, of which 3,634 were significantly dysregulated (Padj < 0.05, |log2FC| > 1); compared with the normal control group, 1,923 mRNAs were significantly upregulated and 1,711 mRNAs were significantly downregulated in the ATAAD group. Volcano plot ( Figure 1 A) and heatmap ( Figure 1 B) shows the expression profiles of mRNAs between ATAAD and normal controls.
[0080] like Figure 2As shown: Compared with the normal control group, the mRNA of MMP8, HP and CCL2 genes were differentially up-regulated in the AMI case group (P<0.05), the mRNA of ALOX15 gene was differentially down-regulated (P<0.05), and there was no statistically significant difference in the mRNA of FXYD2 and SIGLEC8 genes (P>0.05); compared with the AMI case group, the mRNA of MMP8 and HP genes were differentially up-regulated in the ATAAD case group (P<0.05), and the mRNA of FXYD2, ALOX15, SIGLEC8 and CCL2 genes were differentially down-regulated (P<0.05); compared with the control group, the mRNA of each gene was differentially expressed in the ATAAD case group.
[0081] like Figure 3 As shown: The upregulated gene mRNA generally showed that the risk of ATAAD increased with the increase of expression level, among which the risk of ATAAD increased with the increase of HP expression level. The risk of ATAAD showed that the disease risk increased. When the expression level reached a certain level, the risk no longer increased. The initial risk of MMP8 increased with the increase of expression level, and then decreased slightly with the increase of expression level, but the risk was still much higher than the low expression level. The downregulated gene mRNA generally showed that the risk of ATAAD decreased with the increase of expression level. Among which the risks of FXYD2, ALOX15, SIGLEC8 and CCL2 decreased with the increase of expression level, and the final OR tended to 1.
[0082] like Figure 4 As shown: the AUC values of gene MMP8, gene ALOX15, gene HP, gene FXYD2, gene SIGLEC8 and gene CCL2 are greater than 0.93, indicating that the above gene combination has good potential for diagnosing AD and has good diagnostic efficacy, and the larger the ACU value, the stronger its diagnostic efficiency.
[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A group of diagnostic markers for aortic dissection, characterized in that: The markers consist of gene MMP8, gene ALOX15, gene HP, gene FXYD2, gene SIGLEC8 and gene CCL2; The aortic dissection is acute Stanford type A aortic dissection; The marker uses the peripheral blood whole blood RNA of the sample to be tested as the detection sample; The risk of acute Stanford type A aortic dissection increased with the increase of MMP8 and HP gene mRNA expression, and the risk of acute Stanford type A aortic dissection decreased with the increase of FXYD2, ALOX15, SIGLEC8 and CCL2 gene mRNA expression.
2. A kit, characterized in that The invention comprises primers that specifically recognize the aortic dissection diagnostic marker according to claim 1.
3. The kit according to claim 2, wherein The primers are upstream and downstream primers for amplifying genes MMP8, ALOX15, HP, FXYD2, SIGLEC8 and CCL2, and their nucleotide sequences are shown in SEQ ID No. 1 to SEQ ID No.
12.
4. Use of the marker according to claim 1 or the kit according to claim 3 in at least one of the following projects: 1) Application in the preparation of products for diagnosing aortic dissection; 2) Application in the preparation of products for screening aortic dissection; 3) Use in the preparation of products for assessing the risk of aortic dissection; The aortic dissection is acute Stanford type A aortic dissection.
Citation Information
Patent Citations
Treatment of cancer by risk stratification of patients based on comordidities
US20220044764A1
Polypeptide for regulating energy metabolism and uses thereof
WO2018165936A1