A broad-spectrum antibacterial peptide, its preparation method and application
The broad-spectrum antimicrobial peptides prepared through deep learning model design and biosynthesis technology solve the limitations of existing antimicrobial peptides in broad-spectrum and safety, and achieve effective inhibition of a variety of pathogenic bacteria and safe application in cosmetics.
Patent Information
- Application Number
- CN202410778359.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-17
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2044-06-17
AI Technical Summary
The existing antimicrobial peptides have limitations in broad-spectrum antibacterial properties and safety of use, and the design and transformation are difficult and the success rate is low. The types of antimicrobial peptides generated by deep learning models are limited.
The deep learning model was used to predict the amino acid sequence of antimicrobial peptides to be GECEGNNRPVKKPQPRKKLPRFKKC-NH2, and combined with biosynthesis technology to express and purify them in E. coli to prepare broad-spectrum antimicrobial peptides, which are used in cosmetics and oral care products.
It has achieved broad-spectrum antibacterial activity, thermal stability and low hemolysis, with the characteristics of efficient screening and preparation, is effective against a variety of pathogenic bacteria, and is highly safe in cosmetics and oral care products.
Smart Images

Figure BDA0004896374530000071 
Figure BDA0004896374530000081 
Figure BDA0004896374530000091
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to a broad-spectrum antibacterial peptide, a preparation method thereof, and an application thereof. Background Art
[0002] Antibacterial peptides (AMPs), also known as host defense peptides, are usually small polypeptides composed of 7 to 100 amino acids, widely existing in various organisms in nature, and are an important part of the natural immune defense system of organisms. Research shows that antibacterial peptides have a variety of biological activities, including antibacterial, antiviral, anti-parasitic, and anti-tumor activities, etc., and have a lower incidence of drug resistance compared with traditional antibiotics, and are considered to be the best choice for solving the problem of bacterial drug resistance.
[0003] As an important object for the development of current antibacterial and antiviral drugs, antibacterial peptides have the following problems:
[0004] (1) Limited safety. Most antibacterial peptides kill microorganisms by destroying cell membranes. Due to the similar membrane components, they may also destroy normal cells in the human body, and hemolytic effects occur at high concentrations.
[0005] (2) Difficult design and modification. In order to make antibacterial peptides have good antibacterial effects and low hemolytic effects at the same time, researchers usually use methods such as amino acid residue substitution, chemical modification, and antibacterial peptide combination to artificially design and modify natural antibacterial peptides. Such design methods rely too much on the sufficient prior knowledge of the properties of polypeptides by researchers, the process is cumbersome, and the success rate is low. The range of polypeptide sequences that can be modified in such methods is also limited by the existing AMP sequence library and cannot directly generate new AMP sequences.
[0006] With the rise of artificial intelligence, deep learning models can quickly learn a large number of samples of known drugs. The generated model after training can directly sample and produce new drug molecules, and the discriminant model can screen and identify new potential drug targets by predicting the properties of these molecules, effectively accelerating the drug design process. Patent CN117343148A discloses an antibacterial peptide directly generated by an artificial intelligence generation model. This antibacterial peptide has low cytotoxicity and hemolytic activity, but the types of bacteria that can be inhibited are limited, and there are certain limitations in broad-spectrum antibacterial. Summary of the Invention
[0007] Aiming at the deficiencies of the prior art, the present invention aims to provide an antibacterial peptide with both the broad-spectrum antibacterial activity of melittin and safety in use by using a deep learning model.
[0008] To achieve this purpose, the present invention adopts the following technical solutions:
[0009] In the first aspect, the present invention provides a broad-spectrum antimicrobial peptide, and the amino acid sequence of the antimicrobial peptide is GECEGNNRPVKKPQPRKKLPRFKKC-NH2.
[0010] As a preferred embodiment, the antimicrobial peptide inhibits Gram-negative bacteria, Gram-positive bacteria and fungi.
[0011] As a preferred embodiment, the Gram-negative bacteria include Escherichia coli and Pseudomonas aeruginosa, the Gram-positive bacteria include Staphylococcus aureus and Propionibacterium acnes, and the fungi include Candida albicans.
[0012] In the second aspect, the present invention provides an application of a broad-spectrum antimicrobial peptide in cosmetics and oral care products.
[0013] In the third aspect, the present invention provides a preparation method of a broad-spectrum antimicrobial peptide, comprising the following steps:
[0014] S1: Based on the amino acid sequence GNNRPVYIPQPRPPHPRI-NH2 of melittin Ia, the amino acid sequence of the antimicrobial peptide is predicted and designed;
[0015] S2: The predicted antimicrobial peptide is gene-synthesized and inserted into a plasmid to construct a recombinant plasmid;
[0016] S3: The recombinant plasmid is introduced into Escherichia coli, coated on an LB plate containing 40-60 μg / mL Amp and cultured overnight, and high-quality colonies are selected for sequencing confirmation to obtain recombinant bacteria;
[0017] S4: The recombinant bacteria are activated, induced to express, separated and purified, and the antimicrobial peptide is collected.
[0018] As a preferred embodiment, in step S1, the antimicrobial peptide prediction tool amPEPpy of a deep learning model is used to design the antimicrobial peptide.
[0019] As a preferred embodiment, the gene synthesis of the antimicrobial peptide predicted in step S2 is carried out, and the synthesized base sequence is:
[0020] AAGGCCATGGGGTGAATGCGAAGGTAACAATCGTCCGGTTAAAAAACCA CAACCGCGTAAAAAACTGCCACGTTTCAAGAAATGCTAAAAGCTTGCGG.
[0021] As a preferred embodiment, the specific steps of step S2 are: gene-synthesize the antimicrobial peptide, insert it between the NcoⅠ and HindⅢ restriction enzyme sites in the plasmid pET32a(+), and construct a recombinant plasmid, as shown in the appendixFigure 1 as shown, i.e., the recombinant plasmid pET32a(+)-(Ia-1).
[0022] As a preferred embodiment, the specific steps of step S3 are as follows: introducing the recombinant plasmid pET32a(+)-(Ia-1) into Escherichia coli BL21(DE3), culturing overnight at 35-38 °C on an LB medium plate containing 40-60 μg / mL Amp (ampicillin), selecting 3 high-quality colonies from each plate for sequencing confirmation, and finally obtaining the recombinant bacteria.
[0023] As a preferred embodiment, the specific steps of step S4 for induction expression are as follows:
[0024] M1: Activate the recombinant bacteria, pick a single colony and inoculate it into an LB liquid medium containing 40-60 μg / mL Amp, culture with shaking at 35-38 °C for 6-8 h, then transfer the bacterial liquid to a fresh LB liquid medium containing 40-60 μg / mL Amp according to the ratio of the bacterial liquid: culture medium volume ratio of 1:(80-120), and culture with shaking at 35-38 °C until the OD 600 is 0.6-0.8, add IPTG with a final concentration of 0.3-0.7 mM, and induce expression overnight at 16-25 °C for 12-48 h;
[0025] M2: After induction expression, centrifuge the bacterial cells at room temperature, collect the bacterial cell precipitate, add the lysis buffer to the bacterial cell precipitate according to the ratio of the bacterial cell precipitate: lysis buffer volume ratio of 1:(15-30), and ultrasonically disrupt the bacterial cells under ice bath conditions. After disruption, centrifuge and collect the supernatant.
[0026] Preferably, the composition of the lysis buffer includes 20 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl, and the pH is 7.2-7.5.
[0027] As a preferred embodiment, the specific steps of step S4 for separation and purification are as follows:
[0028] H1: Filter the supernatant collected in step M2 with a 0.2-0.8 μm filter membrane to obtain a filtrate;
[0029] H2: Under an ice-water bath, stir and mix the filtrate and Ni resin according to a volume ratio of 1:(0.3-1.5) for 40-60 min, then load the Ni resin into a chromatography column, first wash away the impurity proteins with buffer A, and then elute with buffer B, and collect the eluate;
[0030] H3: Add enterokinase with a final enzyme activity of 0.08 - 0.15 U to the eluate, first react at 14 - 18 °C for 10 - 14 h, then react at 50 - 70 °C for 20 - 40 min, and finally centrifuge at 10000 - 14000 rpm for 10 - 20 min to collect the supernatant;
[0031] H4: Place the supernatant in an ultrafiltration centrifugal tube with a molecular weight cut-off of 1 kDa and centrifuge at 3000 - 5000 rpm for 10 - 20 min; Wash the retentate with 10 - 30 mM PBS solution according to the volume ratio of retentate:PBS solution of 1:(10 - 30), and centrifuge at 3000 - 5000 rpm, repeat three times, and collect the retentate, which is the antibacterial peptide solution.
[0032] Preferably, the buffer A contains 100 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl; the buffer B contains 500 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl.
[0033] In a third aspect, the present invention provides an application of the broad-spectrum antibacterial peptide as described in the first and second aspects in cosmetics and oral care products.
[0034] Compared with the prior art, the present invention has the following beneficial effects:
[0035] (1) The antibacterial peptide provided by the present invention has broad-spectrum antibacterial activity, thermal stability and low hemolytic activity; it has good inhibitory effects on Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, and Propionibacterium acnes.
[0036] (2) The broad-spectrum antibacterial peptide provided by the present invention is designed by screening antibacterial peptides with a prediction probability > 95% using a deep learning model and is prepared by bioengineering technology, which has the characteristics of small screening workload, short screening period and high screening efficiency. Description of the Drawings
[0037] Figure 1 It is a schematic structural diagram of the recombinant plasmid constructed in Example 1 of the present invention. Detailed Embodiments
[0038] The following further describes the present invention with specific embodiments. The following embodiments are only used to illustrate the present invention and are not used to limit the scope of application of the present invention.
[0039] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.
[0040] Example 1 Preparation of Broad-Spectrum Antibacterial Peptide
[0041] (1) Prediction of broad-spectrum antimicrobial peptide gene sequence
[0042] Based on the amino acid sequence GNNRPVYIPQPRPPHPRI-NH2 of melittin Ia, the antimicrobial peptide was predicted using the antimicrobial peptide prediction tool amPEPpy of the deep learning model. The method is as follows: (1) Obtain amPEPpy under Python 3 program through GitHub (https: / / github.com / tlawrence3 / amPEPpy) and install it. (2) Training data. Use the training module file in the amPEPpy GitHub repository to train the RF classifier to identify AMP sequences, optimize the number of decision trees in the classifier, and calculate feature importance using the drop-column method. (3) Training and optimization of the RF AMP classifier. Implement the RF classifier using scikit-learn v 0.23.1 in Python v 3.8.3. Use the out-of-bag (OOB) error (1 - OOB accuracy) as the optimality criterion to optimize the number of decision trees in the RF classifier. Optimize the classifier for the count-balanced and length / count-balanced training sets. Use the drop-column method to delete features, retrain the classifier, and calculate the OOB accuracy difference relative to the complete model to determine the relative feature importance. (4) Prediction of antimicrobial peptide gene sequence. Based on the amino acid sequence GNNRPVYIPQPRPPHPRI-NH2 of melittin Ia, randomly change the amino acid sequence by changing, adding, or deleting amino acids, and use the trained RF AMP classifier in amPEPpy to sort out the AMP amino acid sequences, and finally obtain the antimicrobial peptide sequence, whose gene sequence is:
[0043] GECEGNNRPVKKPQPRKKLPRFKKC-NH2.
[0044] (2) Construction of recombinant plasmid
[0045] The antimicrobial peptide was gene-synthesized and inserted between the NcoⅠ and HindⅢ restriction enzyme sites of plasmid pET32a(+) to construct the recombinant plasmid pET32a(+)-(Ia-1), as shown in the appendix Figure 1 as follows.
[0046] (3) Preparation of recombinant bacteria
[0047] The recombinant plasmid pET32a(+)-(Ia-1) was introduced into Escherichia coli BL21(DE3) and cultured overnight at 37℃ on an LB medium plate containing 50 μg / mL Amp. Three high-quality colonies were selected from each plate for sequencing confirmation, and finally the recombinant bacteria were obtained.
[0048] (4) Fermentation and disruption
[0049] Activate the recombinant bacteria, pick a single colony and inoculate it into 1 mL of LB liquid medium containing 50 μg / mL Amp, culture it with shaking at 37 °C for 7 h, then transfer it to 500 mL of fresh LB liquid medium containing 50 μg / mL Amp, and culture it with shaking at 37 °C until the OD 600 reaches 0.7, add IPTG to a final concentration of 0.5 mM, and induce expression at 16 °C for 20 h; then centrifuge at room temperature and 12,000 rpm for 10 min to collect the cell precipitate, add 25 mL of lysis buffer (composition: 20 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl, pH 7.4), resuspend the cell precipitate by shaking, ultrasonically disrupt the cells under ice bath conditions, centrifuge at 12,000 rpm for 15 min, and collect the supernatant.
[0050] (5) Isolation and purification
[0051] Filter the supernatant through a 0.22 μm microporous filter membrane to obtain a filtrate; mix the filtrate with 20 mL of Ni resin by stirring in an ice-water bath for 50 min, then load it into a chromatography column, and wash away the impurity proteins with 75 mL of buffer A (composition: 100 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl); then elute with 25 mL of buffer B (composition: 500 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl) to obtain the target protein solution with His-tag;
[0052] Add enterokinase with a final enzyme activity of 0.1 U to the target protein solution with His-tag, first react at 16 °C for 12 h, then react at 60 °C for 30 min, and finally centrifuge at 12,000 rpm for 15 min to collect the supernatant;
[0053] Place the supernatant in an ultrafiltration centrifugal tube with a cut-off molecular weight of 1 kDa and centrifuge at 3,000 rpm for 15 min; wash the retentate with 20 mM PBS solution according to the ratio of retentate:PBS solution volume of 1:20 and centrifuge at 3,000 rpm, repeat three times, and collect the retentate.
[0054] Preparation of antibacterial peptide Ia in Comparative Example 1
[0055] The difference from Example 1 is that melittin Ia is used for recombinant plasmid construction to prepare recombinant bacteria.
[0056] Performance test
[0057] 1. Antibacterial peptide purity test
[0058] Take the antimicrobial peptide samples obtained from the examples and comparative examples, perform protein separation using SDS-PAGE electrophoresis, and then scan the protein gel using the grayscale scanning method. The proportion of the protein in the entire lane is the purity of the antimicrobial peptide. The results are shown in Table 1. As can be seen from Table 1, the antimicrobial peptides prepared by the present invention have a high purity and can be used for subsequent detection.
[0059] Table 1
[0060] Sample Antibacterial peptide purity (%) Example 1 89.57% Comparative Example 1 88.30%
[0061] 2. Determination of Antibacterial Activity
[0062] (1) Preparation of Test Bacteria
[0063] Select Gram-positive bacteria (Staphylococcus aureus ATCC 25923, Propionibacterium acnes ATCC11827), Gram-negative bacteria (Escherichia coli ATCC 8739, Pseudomonas aeruginosa ATCC 15442) and fungi (Candida albicans ATCC10231) as indicator bacteria. The preparation methods of the corresponding fresh cultures of the bacteria are shown in Table 2.
[0064] Table 2
[0065] Test strain Test medium Cultivation temperature Cultivation time Staphylococcus aureus MHB broth medium 35℃ 18h Escherichia coli MHB broth medium 35℃ 18h Pseudomonas aeruginosa MHB broth medium 35℃ 18h Candida albicans MHB broth medium 28℃ 36h Propionibacterium acnes Reinforced Clostridium medium 35℃ 48h
[0066] (2) Preparation of Bacterial Suspension
[0067] Take the fresh cultures of each test bacterium and inoculate them into 5 mL of sterile medium. First, pour a layer of agar medium in a glass petri dish. When the corresponding solid medium has melted and cooled to about 50 °C, dilute the indicator bacteria to 1×10 6 CFU / mL with the corresponding medium as the test bacterial suspension. If the bacterial suspension is placed at room temperature after preparation, it should be used within 2 h; if stored at 2 - 8 °C, it can be used within 24 h.
[0068] (3) Preparation of Sample Solution
[0069] Take the retentate obtained from Example 1 and Comparative Example 1 as the sample to be tested at room temperature.
[0070] Take 5 mL of the retentate obtained from Example 1 and Comparative Example 1 respectively, and oscillate them in a water bath at 60 °C for 30 min as the samples to be tested after high-temperature treatment.
[0071] At the same time, prepare a 1 mg / mL ampicillin solution as the positive control sample and a 20 mM PBS buffer solution as the negative control sample.
[0072] (4) Determination of Bacteriostatic Efficacy
[0073] Pour the test bacterial solution into the sterilized culture medium suitable for each test bacterial strain, place a sterile filter paper with a diameter of 0.5 cm on the surface of the culture medium, add 15 μL of each sample solution to the filter paper, and then place it upright in a 4°C refrigerator for pre-diffusion for 2 h, and then culture it according to the culture conditions in Table 2. Observe whether an inhibition zone appears, measure the diameter of the inhibition zone with a vernier caliper, repeat three times, and take the average value.
[0074] The test results are shown in Table 3.
[0075] Table 3
[0076]
[0077] After screening, the antibacterial peptides prepared in Example 1 have inhibitory effects on Staphylococcus aureus ATCC25923, Escherichia coli ATCC 8739, Pseudomonas aeruginosa ATCC 15442, Candida albicans ATCC10231, and Propionibacterium acnes ATCC11827 before and after treatment at 60°C. It is proved that the broad-spectrum antibacterial peptides prepared by the present invention have broad-spectrum antibacterial properties and high-temperature stability.
[0078] 3. Hemolytic activity experiment
[0079] (1) Preparation of red blood cell suspension
[0080] Collect fresh red blood cells (RBCs) from ICR mice. Wash the RBCs with 0.01 mM PBS buffer and centrifuge at 1000 r / min for 10 min. Discard the supernatant, repeat washing and centrifugation three times until no color can be seen in the suspension. Then dilute the washed RBC precipitate with 0.01 mM PBS to obtain an RBCs solution with a volume fraction of 2.5%.
[0081] (2) Detection of hemolytic activity
[0082] Dilute the antibacterial peptide solution with 0.01 mM PBS buffer to obtain antibacterial peptide solutions with concentrations of 10, 20, 40, 80, 160, 320, and 640 μg / mL as the samples to be tested.
[0083] Mix 100 μL of a 2.5% (v / v) RBCs solution with 100 μL of the antimicrobial peptide solution sample to obtain mixtures with antimicrobial peptide concentrations of 5, 10, 20, 40, 80, 160, and 320 μg / mL. Incubate the mixtures at 37 °C for 1 hour, centrifuge (1500 × g, 5 min), and take the supernatant. Then transfer 0.1 mL of the supernatant to a 96-well plate and measure the absorbance at 540 nm using a microplate reader. Set up three parallel groups and repeat the measurement twice, and take the average value. Use 0.1% Triton X-100 (Sigma-Aldrich) solution and 0.01 mM PBS solution as the positive control and negative control, respectively. Calculate the hemolysis rate according to the following formula:
[0084] Hemolysis rate (%) = [(A - A0) / (A1 - A0)] × 100.
[0085] A represents the absorbance of the antimicrobial peptide in the sample (Examples and Comparative Examples);
[0086] A0 represents the absorbance of the negative control group;
[0087] A1 represents the absorbance of the positive control group.
[0088] The test results are shown in Table 3.
[0089] Table 3
[0090]
[0091] As can be seen from Table 3, the antimicrobial peptide prepared in Example 1 has very low hemolytic activity in the concentration range of 5 - 320 μg / mL, meeting the requirement of low hemolysis.
[0092] 3. Safety test
[0093] (1) Sample preparation:
[0094] Sample 1: Dilute the antimicrobial peptide prepared in Example 1 directly with deionized water to obtain an antimicrobial peptide solution with a final concentration of 0.1 wt%, which is used as Test Sample 1.
[0095] Sample 2: Add the antimicrobial peptide prepared in Example 1 to the essence base formula at a final concentration of 0.1 wt% (Table 4) and prepare the essence according to the following method, which is used as Test Sample 2.
[0096] S1. Mix water, polyol, and thickener, heat to 85 °C with stirring, and keep warm for 30 min for sterilization to obtain the aqueous phase;
[0097] S2. Mix the emulsifier, oil, and active ingredient, and heat to 80 °C to obtain the oil phase;
[0098] S3. Add the oil phase to the water phase and homogenize until uniform.
[0099] S4. Stir and cool down to 40 °C, add skin conditioners, preservatives, chelating agents, and fragrances, mix and stir evenly, then cool down to 25 °C to obtain Test Sample 2.
[0100] Table 4 Formulation Table
[0101]
[0102] Select 30 volunteers who meet the requirements, aged 18 - 60 years old, including 22 females and 8 males, to try the sample. Take 0.03 g of the test sample respectively and put it into the small chamber of the patch tester. Select 2 test points on the inner sides of the left and right arms of the subjects. Stick the patch tester with the test sample on the inner side of the forearm of the subject with a low-sensitization tape, gently press with the palm to make it evenly adhere to the skin, and wait for 24 h. Observe the skin reaction according to the standard in Table 5 30 min, 24 h, and 48 h after removing the patch tester (after the indentation disappears). The results are shown in Table 6.
[0103] Table 5
[0104]
[0105] Table 6
[0106]
[0107] The results show that all the test sites of the volunteers showed negative reactions, indicating that the safety of the antimicrobial peptides and their derivative products described in the present invention is guaranteed, and there are no adverse reactions such as skin irritation and sensitization (except for people with easy allergy or those allergic to this product).
[0108]
[0109]
Claims
1. A broad-spectrum antimicrobial peptide, characterized in that, The amino acid sequence of the antimicrobial peptide is GECEGNNRPVKKPQPRKKLPRFKKC-NH2.
2. The broad-spectrum antibacterial peptide according to claim 1, wherein The antimicrobial peptide inhibits Gram-negative bacteria, Gram-positive bacteria and fungi.
3. The broad-spectrum antibacterial peptide according to claim 2, wherein The Gram-negative bacteria include Escherichia coli and Pseudomonas aeruginosa, the Gram-positive bacteria include Staphylococcus aureus and Propionibacterium acnes, and the fungi include Candida albicans.
4. Use of the broad-spectrum antimicrobial peptide according to any one of claims 1-3 in the preparation of cosmetics and oral care products.
5. A preparation method of the broad-spectrum antibacterial peptide according to any one of claims 1-3, characterized in that, It includes the following steps: S1: Based on the amino acid sequence of melittin Ia, predict and design the amino acid sequence of the antimicrobial peptide; S2: Genetically synthesize the predicted antimicrobial peptide and insert it into a plasmid to construct a recombinant plasmid; S3: Introduce the recombinant plasmid into Escherichia coli to construct an engineering bacterium, coat it on an LB plate containing 40-60 μg / mL Amp and culture it overnight, select high-quality colonies for sequencing confirmation to obtain a recombinant bacterium; S4: Activate the recombinant bacterium, induce expression, separate and purify it, and collect the antimicrobial peptide.
6. The preparation method of the broad-spectrum antibacterial peptide according to claim 5, wherein, In step S1, the antimicrobial peptide prediction tool amPEPpy of the deep learning model is used to design the antimicrobial peptide. In step S2, the synthesized gene is inserted between the NcoⅠ and HindⅢ restriction enzyme sites of plasmid pET32a(+) to construct a recombinant plasmid.
7. The preparation method of the broad-spectrum antibacterial peptide according to claim 5, characterized in that, The specific steps of the induction expression in step S4 are as follows: M1: Activate the recombinant bacteria, pick a single colony and inoculate it into LB liquid medium containing 40 - 60 μg / mL Amp, culture it with shaking at 35 - 38 °C for 6 - 8 h, then transfer the bacterial liquid to fresh LB liquid medium containing 40 - 60 μg / mL Amp according to the ratio of bacterial liquid: medium volume ratio of 1:(80 - 120), culture it with shaking at 35 - 38 °C until 600 the OD is 0.6 - 0.8, add IPTG with a final concentration of 0.3 - 0.7 mM, and induce expression overnight at 16 - 25 °C for 12 - 24 h; M2: After induction expression, centrifuge the bacterial cells at room temperature, collect the bacterial cell precipitate, add lysis buffer to the bacterial cell precipitate according to the volume ratio of bacterial cell precipitate: lysis buffer of 1:(15-30), and ultrasonically disrupt the bacterial cells under ice bath conditions. After disruption, centrifuge and collect the supernatant.
8. The preparation method of the broad-spectrum antibacterial peptide according to claim 7, wherein The composition of the lysis buffer A contains 20 mM imidazole, 20 mM Tris-HCl, 20 mM NaCl, and the pH is 7.2-7.
5.
9. The preparation method of the broad-spectrum antibacterial peptide according to claim 7, characterized in that, The steps of separation and purification in step S4 are as follows: H1: Filter the supernatant collected in step M2 with a 0.2-0.8 μm filter membrane to obtain a filtrate; H2: Stir and mix the filtrate and Ni resin according to a volume ratio of 1:(0.3-1.5) for 40-60 min, then load the Ni resin into a chromatography column, first wash away the miscellaneous proteins with buffer A, and then elute with buffer B, and collect the eluate; H3: Add enterokinase with a final enzyme activity of 0.08-0.15 U to the collected eluate, first react at 14-18 °C for 10-14 h, then react at 50-70 °C for 20-40 min, and finally centrifuge at 10000-14000 rpm for 10-20 min, and collect the supernatant; H4: Place the supernatant in an ultrafiltration centrifugal tube with a molecular weight cut-off of 1 kDa and centrifuge at 3000-5000 rpm for 20-40 min; according to the volume ratio of retentate:PBS solution of 1:(10-30), wash the retentate with 10-30 mM PBS solution and centrifuge at 3000-5000 rpm, repeat three times, and collect the retentate.
10. The preparation method of the broad-spectrum antibacterial peptide according to claim 9, characterized in that, Buffer A contains 100 mM imidazole, 20 mM Tris-HCl, and 20 mM NaCl; Buffer B contains 500 mM imidazole, 20 mM Tris-HCl, and 20 mM NaCl.
Citation Information
Patent Citations
Antibacterial peptide and application thereof in preparation of antibacterial drugs or antiviral drugs
CN117343148A
Method for predicting the toxicity of polypeptides
CN111128295A
Melittin-based nanoparticle composite and method for preparing same
WO2023249386A1
Cited By
Product, system and method of cell cultivation
US12668774B2
Culture media based on protein hydrolysate and a process for preparing thereof
US12686847B2