A strain of Enterobacter pxylophilus PxGF1 and its applications

By mixing Enterobacter coli PxGF1 with Bt protein, the problem of Bt resistance and intestinal microorganisms of diamondback moth was solved, and the killing effect of Cry1Ac toxin on diamondback moth was significantly improved, with significant damage to intestinal tissue, and the pupation rate and pupation weight were reduced.

CN118813439BActive Publication Date: 2025-08-05HUNAN AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202410170556.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-02-06
Publication Date
2025-08-05
Estimated Expiration
2044-02-06

AI Technical Summary

Technical Problem

Diamond moth is resistant to chemical insecticides and B. thuringiensis Bt, which leads to difficulties in prevention and control. The existing technology has a great influence on intestinal microorganisms in outdoor environments, making it difficult to effectively improve the insecticidal activity of Bt protein.

Method used

The mixture of Enterobacter asburiae PxGF1 and Bt protein was used to improve the lethality rate of pests through synergistic effects. Specifically, Enterobacter asburiae PxGF1 was classified as Enterobacter asburiae PxGF1, and the storage number was CCTCC NO: M2023056, which was isolated from the intestine of the DBM-F field population of the diamondback moth.

Benefits of technology

The killing ability of Cry1Ac toxin to rhodopsia moth was significantly improved, with a mortality rate of 32.22% increased by 48 hours and a 42.22% increased by 72 hours, severe damage to intestinal tissue, and significantly reduced pupation rate and pupal weight.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813439B_ABST
    Figure CN118813439B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of agricultural pest control and relates to a strain of Enterobacter asburiae Plutella xylostella (PxGF1) and its applications. The strain is classified and named Enterobacter asburiae PxGF1. The strain was deposited with the China Center for Type Culture Collection on January 10, 2023, with a deposit number of CCTCC NO: M2023056 at Wuhan University, Wuhan. Experiments have demonstrated that the strain PxGF1 of the present invention can improve the efficiency of Cry1Ac in killing Plutella xylostella. Furthermore, compared to feeding Plutella xylostella only with Cry1Ac protoxin, the pupation rate and pupal weight of the test insects were significantly reduced, and the intestinal tissue was severely damaged, making it impossible to observe intact intestinal epithelial cells. This suggests that PxGF1 promotes the killing ability of Cry1Ac against Plutella xylostella.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of agricultural pest control and relates to a Plutella xylostella Enterobacterium PxGF1 and an application thereof. Background Art

[0002] The diamondback moth, Plutella xylostella (L), is one of the most serious pests of cruciferous crops, often causing significant economic losses to a variety of important vegetables, including cabbage, broccoli, and cauliflower. The moth has developed significant resistance to most chemical insecticides used to control lepidopteran pests, as well as to the microbial insecticide Bacillus thuringiensis (Bt), making its control increasingly difficult.

[0003] Prior art CN112175861B discloses a strain of Enterococcus mundtii PxG1 of the diamondback moth and its application. The strain was deposited in the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on June 29, 2020, and the strain deposit number is GDMCC No: 61067. The invention study showed that the emergence rate of diamondback moths fed with the Enterococcus mundtii PxG1 strain was significantly reduced; it also showed that the Enterococcus mundtii PxG1 strain has the effect of improving the insecticidal activity of Bt toxin and enhancing the rapid lethality of Cry1A protoxin to diamondback moths. The Enterococcus mundtii PxG1 strain can be used as a new type of biological control bacteria for the prevention and control of cruciferous vegetable pests, and has good biological control potential and application prospects. However, the principle is to add Cry1Ac toxin after removing the remaining intestinal microorganisms of the diamondback moth, thereby verifying that PxG1 has the effect of accelerating the killing of diamondback moth larvae by Cry1Ac toxin. The application of this technology will be affected to a certain extent by the outdoor environment or the remaining microorganisms in the intestinal tract of the diamondback moth. Summary of the Invention

[0004] The purpose of the present invention is to provide a Plutella xylostella Enterobacterium PxGF1 and its application, so as to further improve the sensitivity of Plutella xylostella to Bt protein.

[0005] In order to solve the above technical problems, the technical solutions of the present invention are as follows:

[0006] A strain of Plutella xylostella Enterobacter PxGF1, whose classification name is Enterobacter asburiae PxGF1, was deposited in the China Center for Type Culture Collection on January 10, 2023, with the deposit number CCTCC NO: M2023056, and the deposit address is Wuhan University, Wuhan.

[0007] Specifically, the nucleotide sequence of 16s rDNA of the strain is shown in SEQ ID NO: 1.

[0008] The Plutella xylostella Enterobacterium PxGF1 is isolated and purified from the intestinal tract of the field population DBM-F of the diamondback moth. The PxGF1 colony is round, light yellow, has convexities, flat edges, and a smooth surface.

[0009] Furthermore, the present invention also claims to protect the use of the Plutella xylostella Enterobacterium PxGF1 in improving the insecticidal activity of Bt protein.

[0010] In one preferred embodiment, the Enterobacterium Plutella xylostella PxGF1 is used to enhance the activity of Bt protein in killing Plutella xylostella.

[0011] Furthermore, the present invention also claims protection for the use of the Plutella xylostella Enterobacter PxGF1 in preventing and controlling pests on cruciferous vegetables.

[0012] In a preferred embodiment, the cruciferous vegetable pest is Plutella xylostella.

[0013] The present invention also provides a method for preventing and controlling pests on cruciferous vegetables, which comprises mixing the Plutella xylostella Enterobacterium PxGF1 with Bt protein and feeding the mixture to the pests.

[0014] The present invention also provides the use of the Plutella xylostella Enterobacter PxGF1 in preparing a medicament for preventing and controlling cruciferous vegetable pests.

[0015] The present invention also provides an agent for preventing and controlling cruciferous vegetable pests, wherein the agent comprises the diamondback moth Enterobacterium PxGF1 and Bt protein, and utilizes the synergistic effect of the PxGF1 strain on the Bt protein protoxin to improve the mortality rate of the pests.

[0016] In a preferred embodiment, the Bt protein is Cry1Ac protoxin.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] Experiments have shown that when the strain PxGF1 of the present invention is fed simultaneously with the Cry1Ac toxin, the mortality rate of the diamondback moth increases dramatically to approximately 37.78% within 48 hours, and reaches a peak of approximately 95.55% at 72 hours. The strain PxGF1 of the present invention can enhance the efficiency of Cry1Ac in killing diamondback moths. Furthermore, compared to feeding the diamondback moths with only the Cry1Ac protoxin, the pupation rate and pupal weight of the test insects were significantly reduced. The intestinal tissue was severely damaged, and intact intestinal epithelial cells could not be observed. This indicates that PxGF1 enhances the killing ability of Cry1Ac against diamondback moths. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the columnar result of intestinal microbial abundance among the diamondback moth groups;

[0020] Figure 2 Heat map of gut microbial abundance among the groups of Plutella xylostella;

[0021] Figure 3 The colony morphology of the five strains is shown;

[0022] Figure 4 This is the gene tree of Enterobacter asburiae PxGF1;

[0023] Figure 5 mortality of treated diamondback moths;

[0024] Figure 6 The weight of the pupae of the treated diamondback moth;

[0025] Figure 7 The pupation rate of the treated diamondback moth;

[0026] Figure 8 The intestinal tissue of the processed diamondback moth. DETAILED DESCRIPTION

[0027] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0028] Example 1

[0029] First, third-instar larvae of the diamondback moth (Plutella xylostella) were randomly excised from a Cry1Ac-susceptible strain (DBM1Ac-S), a Cry1Ac-resistant strain (DBM1Ac-R), a field population F (F-CK), and a Cry1Ac-treated field population (F-Cry1Ac). Larvae were placed on ice for 5 minutes, then soaked in 75% anhydrous ethanol for 20 seconds. The insect surfaces were rinsed twice with sterile water. The intestines were then dissected and removed and placed in PBS buffer to maintain cell viability. All dissected intestines were placed in pre-sterilized, RNase-free 1.5 mL centrifuge tubes, sealed, and rapidly frozen in liquid nitrogen. The tubes were then stored in a -80°C freezer until further use. Ten replicates were performed for each population. Tissue fragments were sent to Shanghai Bioengineering for bacterial 16S rRNA metagenomic sequencing using the Miseq 2x300bp sequencing platform. The amplified regions targeted the bacterial 16S rRNA gene V3-V4. The diamondback moth (DBM1Ac-S) strain was originally donated to the Institute of Floriculture and Vegetable Research, Chinese Academy of Agricultural Sciences, by Researcher Zhao Jianzhou and Professor AM Shelton (Cornell University, USA) in 2003. The culture method was based on the method described by Tang JD, Gilboa S., Roush RT, et al. Inheritance, stability, and lack-of-fitness costs of field-selected resistance to Bacillus thuringiensis indiamondback moth (Lepidoptera: Plutellidae) from Florida [J]. Journal of Economic Entomology, 1997. 90(3):732–741. No pesticides have been used to date. During their rearing in this laboratory, they were fed with laboratory-grown radish seedlings or home-grown cabbage leaves and were not exposed to any pesticides. The resistant strain (DBM1Ac-R) was collected from Loxahatchee, Florida, USA. Because Bt preparations are often used in large doses in this cabbage-growing area, the population has developed about 1,600 times resistance to Bt. This diamondback moth strain was donated by Researcher Zhao Jianxin and Professor AM Shelton to the Institute of Vegetable and Floriculture, Chinese Academy of Agricultural Sciences in 2003 and has been cultivated ever since.The culture method is based on Shelton AM, Robertson JL, Tang JD, et al. Resistance of diamondbackmoth (Lepidoptera: Plutellidae) to Bacillus thuringiensis subspecies in the field [J]. Journal of Economic Entomology, 1993. 86(3): 697–705. This strain was donated by the Chinese Academy of Agricultural Sciences and continuously selected and bred in our laboratory, maintaining a 3000-fold resistance to sensitive populations. The field population F (F-CK) was collected in 2019 from a cabbage field in Changde, Hunan, which is sprayed with various chemical or biological pesticides year-round. It was raised in the laboratory with radish seedlings and cabbage. The Cry1Ac toxin-treated field population (F-Cry1Ac) was constructed as follows: Washed cabbage leaves were cut into circular shapes approximately 8.5 cm in diameter, using the leaf-dip method. The leaves were soaked on both sides with a Cry1Ac solution (10 μg / mL) for 10–20 seconds each, then placed on plastic wrap and air-dried at room temperature. Filter paper (6 cm in diameter) was lightly moistened with water and then covered with a layer of dry filter paper to prevent excessive moisture. The dried leaves, along with the leaves, were placed in new Petri dishes. Ten third-instar larvae of the diamondback moth (Plutella xylostella) were seeded into each dish. The gaps between the upper and lower Petri dish lids were sealed with two layers of toilet paper folded crosswise to prevent escape. The dishes were reared at 25 ± 2°C, 50% relative humidity, and a natural photoperiod. Five biological replicates were used for each treatment (F-CK / F-Cry1Ac). After 30 hours of treatment, any remaining live insects were removed for testing. After sequencing, the columnar results of intestinal microbial abundance among the diamondback moth groups and the heat map of intestinal microbial abundance among the diamondback moth groups were obtained as shown below. Figure 1 and Figure 2 shown.

[0030] Sequencing results revealed significant differences in the Enterobacteriaceae family between susceptible (DBM1Ac-S), resistant (DBM1Ac-R), field populations (F-CK), and Cry1Ac-treated field populations (F-Cry1Ac). The dominant species in the F-CK population were Burkholderia sp., Phenylobacterium sp., and Streptophyta sp.; while the dominant species in the F-Cry1Ac population were unclassified Enterobacteriaceae, Klebsiella sp., Streptophyta sp., and Enterococcus sp. The abundance of unclassified Enterobacteriaceae was significantly increased in the F-Cry1Ac population after toxin treatment compared to the F-CK population. This suggests that certain Enterobacteriaceae may be involved in the insecticidal effect of Cry1Ac. The dominant microbial communities in DBM1Ac-S and DBM1Ac-R were highly homogenous, consisting of Klebsiella sp. This suggests that the long-term presence of laboratory populations in the insectary, with its stable external environment and food structure, has stabilized the composition of their midgut microbiota. Although Klebsiella sp. dominated the midgut microbiota in both DBM1Ac-S and DBM1Ac-R, Enterococcus sp. was significantly more abundant in the DBM1Ac-R population than in the DBM1Ac-S population. Therefore, the target strains were isolated and cultured from the guts of Cry1Ac-susceptible and Cry1Ac-resistant strains of diamondback moth, as well as from the field population F, for subsequent experiments.

[0031] The extraction of intestinal bacteria from the diamondback moth was performed in a clean bench, and all instruments, consumables, and reagents were sterilized. Fifteen third-instar larvae from each Cry1Ac-susceptible and Cry1Ac-resistant strains, as well as healthy field populations, were starved for 2 hours. Each group of test insects was soaked in 75% ethanol for 3 minutes and rinsed twice with ddH2O to remove residual ethanol. Next, the anterior half of the moth was gently grasped with one hand, and the hip fork behind the last segment of the moth was grasped with forceps. The intestinal tissue was gently pulled out, ensuring minimal intestinal structural integrity. The excised intestinal tissue was placed in a 1.5mL centrifuge tube containing 200μL of PBS and ground with a grinding rod to a homogenate free of visible tissue fragments. The volume was then filled to 1mL with PBS.

[0032] The homogenate was placed in a constant-temperature incubator at 37°C for 1 hour to allow the intestinal microorganisms to diffuse into the PBS as fully as possible. In a clean bench, the homogenate was serially diluted in a 10-fold gradient to 10₂, 10₃, 10₄, and 10₅. 200 μL of each dilution was taken twice and plated onto previously prepared LB or NA solid media. A PBS control group was also set up as a negative control. After the bacterial solution on the plate dried, it was inverted and incubated in a constant-temperature incubator (35-37°C) for 24 hours or until colonies were clearly visible. Based on bacterial morphology, different strains were transferred to new solid LB or NA media for streak culture. Single colonies were selected and cultured and purified at least three times. Purified single colonies were enriched in 1.5 mL centrifuge tubes (30°C, 200 rpm, 12 hours). A portion of the bacterial solution was used for subsequent PCR amplification, and the remaining solution was added with glycerol (final concentration 40%) and stored sealed at -20°C.

[0033] The above bacterial suspension was used as a PCR template for conventional PCR amplification under the following conditions: primers 16S rDNA universal primer 27F: 5'-AGAGTTTGATCCTGGCTCAG-3'; 1492R: 5'-GGCTACCTTGTTACGACTT-3'. PCR reaction system: Max Master Mix (Dye Plus) 12.5 μL, ddH2O 10.5 μL, F / R 0.5 μL, cDNA 1 μL. Reaction conditions: 98°C denaturation for 10 min, 98°C for 10 s, 55°C for 30 s, 72°C for 2 min 30 cycles, 72°C extension for 7 min, storage at 4°C.

[0034] The PCR amplification products were separated by 1.5% agarose gel electrophoresis and the PCR effect was observed in a gel imaging system. Use the Gel Extraction Kit to recover and purify the target fragment as follows:

[0035] 1. Use a surgical blade to accurately cut out the gel block containing the complete target band and transfer it to a clean 1.5 mL centrifuge tube;

[0036] 2. Add Binding Buffer (XP2) to the above centrifuge tube (1 mL Binding Buffer (XP2) for every 1 g of the above gel block) and incubate at 56°C in a metal bath for 10 min. During this period, take out the centrifuge tube every 4-5 min and shake to mix until the agarose gel containing the target fragment is completely dissolved in the Binding Buffer.

[0037] 3. Transfer the mixed solution obtained in step 2 to the binding column provided in the kit, centrifuge at 12000g for 2 min at room temperature, pour the lower layer of liquid back into the binding column, centrifuge at 12000g for another 2 min at room temperature, and discard the waste liquid.

[0038] 4. Add 300 μL Binding Buffer (XP2) to the binding column, centrifuge at 12000 rpm at room temperature for 2 min, and discard the waste liquid;

[0039] 5. Add 700 μL SPW Wash Buffer (anhydrous ethanol must be added before use) to the binding column, centrifuge at 13,000 rpm for 1 min at room temperature, and discard the filtrate;

[0040] 6. Centrifuge the empty binding column twice at 13,000 rpm at room temperature, place it in a 35°C metal bath with the lid open and air-dry for 2 minutes to completely remove any ethanol remaining on the tube wall and filter membrane.

[0041] 7. Transfer the binding column to a new, clean 1.5 mL centrifuge tube. Add 20-30 μL (depending on the brightness of the target band) of Elution Buffer and drop it onto the membrane. Let it stand at room temperature for 2 minutes. Centrifuge at 12,000 g for 2 minutes to obtain the purified DNA. Store at -20°C.

[0042] The purified target fragment was cloned using the pClone007 Versatile Simple Vector Kit. The specific method is as follows:

[0043] 1. Ligation: Prepare a 10 μL reaction system: xx ng (1 μL-8 μL) of the aforementioned DNA, 4 μL of the pClone007 VersatileSimple Vector Kit, and 10 μL of ddH2O. Incubate in a metal bath at 25°C for 5 minutes. Transform immediately after the reaction.

[0044] 2. Transformation: Take 100 μL of Trelief melted on ice TM 5αChemically Competent Cell, add 10 μL of the above ligation product, mix gently, and let it stand on ice for 25 minutes.

[0045] 3. The competent mixed solution was placed in a 42°C metal bath for 45 seconds, quickly transferred to an ice bath, and allowed to stand for 2 minutes.

[0046] 4. Add 500 μL of LB liquid medium without antibiotic AMP to the centrifuge tube and culture at 200 rpm and 37°C for 1 hour.

[0047] 5. Take 200 μL of bacterial solution and evenly spread it on the LB solid medium containing Amp. After the bacterial solution on the surface of the above plate is dry, turn it upside down and place it in a constant temperature incubator at 37°C for overnight culture.

[0048] (4) Positive clone detection and sequencing

[0049] 6. The next day, single colonies with normal growth were picked and cultured in LB liquid for enrichment. Positive clones were detected using M13 primers (M13F: 5'-TGTAAAACGACGGCCAGT-3', M13R: 5'-CAGGAAACAGCTATGACC-3').

[0050] According to the PCR test results, the bacterial liquid of the corresponding positive clone was picked and sent to Shanghai Bioengineering for sequencing. Each sample was tested in 5-8 replicates to ensure its accuracy.

[0051] The target fragment was found to be approximately 1542 bp in length. The product was sent to Shanghai Bioengineering for sequencing. The sequence of Enterobacter asburiae PxGF1 is shown in SEQ ID NO. 1.

[0052] SEQ ID NO.1:tgcaagtcga gcggcagcgg aagtagcttg ctactttgcc ggcgagcggcggacgggtgagtaatgtctg ggaaactgcc tgatggaggg ggataactac tggaaacggtatctaacgcataacgtcgcaagaccaa ctt agacggggcgg ctt cttgccatcatatgtgcccatatgggatta tctagtaggt ggggtaacggctcacctagg cgacgatccctatctggtctgagaggatga ccacccactc tggaactgag acacggtccacactcctacgggaggcagcagtggggaata ttgcacagtg ggcgcaagcc tgatgcaccc atgccgcgtgtatgaaaaggccttcgggttgtaaagtac tttcagcggg gaggaaggcg ataaggttaataaccttgtcgattgacgtt acccgcaaaa aaagcaccggctaactccgt gccagcagccgcggtaatacggagggtgca agcggttaatc ggaattactg ggcgtaaagcgcacgcaggcggtctgtcaagtcggatgtg aaatccccgg gctcaacctg ggaactgcat tcgaaactggcaggctagagtcttgtagaggggggtagaa ttccaggtgt agcggtgaaa tgcgtagagatctggaggaataccggtggc gaccccgacggcgcgc tcaggtgcgaaagcgtggggagcaaacagg attagatacc ctggtagtc acgccgtaaacgatgtcgacttggaggttgtgcccttgag gcgtggcttc cggagctaac gcgttaagtc gaccgcctggggagtacggcgcaaggttaaactcaaat gccgagcgcgc aagcggtggagcatgtggttttaattcgatg caacgcgaagaaccttacctactcttgaca tccagagaactttccagagatggattggtg ccttcgggaa ctctgagaca ggtgctgcatggctgtcgtcagctcgtgttgtgaaatgtt gggttaagtc ccgcaacgag cgcaaccctt atcctttgttgccagcggttcggccgggaactcaaaggag actgccagtg ataaactgga ggaaggtggggatgacgtcaagtcatcatg gcccttacga gtagggctacacacgtgcta caatggcgcatacaaagagaagcgacctcg cgagagcaag cggacctcat aaagtgcgtcgtagtccggattggagtctgcaactcgact ccatgaagtc ggaatcgcta gtaatcgtag atcagaatgctacggtgaatacgttcccgggccttgtaca caccgcccgt cacaccatgg gagtgggttgcaaaagaagtaggtagctta accttcggga gggcgc.

[0053] Gene tree of Enterobacter asburiae PxGF1 Figure 4 shown.

[0054] The base sequence obtained after Shanghai Bioengineering sequencing was used 3.2.1 After assembling the sequences, use the NCBI database Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to search for similar sequences to the cloned target band and determine the genus of microorganism it belongs to. The classification of intestinal bacteria in the diamondback moth population is shown in Table 1.

[0055] Table 1 Classification of intestinal bacteria in the diamondback moth population

[0056]

[0057] Nine bacterial species from three genera of Proteobacteria and five bacterial species from two genera of Firmicutes were isolated and cultured from the intestines of Cry1Ac-susceptible strains, Cry1Ac-resistant strains and field populations of Plutella xylostella. The colony morphology of these strains is shown in Figure 2. Figure 3As shown, A-Enterobacter asburiae, B-Enterococcus mundtii, C-Enterococcus malodoratus, D-Pantoea vagans, and E-Enterobacter hormaechei. Colonies of strain PxGF1 are round, pale yellow, with raised areas, flat edges, and a smooth surface. Differences in intestinal microbial populations exist between different strains of diamondback moth. Enterobacter sp. microorganisms are widely distributed in the midguts of Cry1Ac-susceptible strains, Cry1Ac-resistant strains, and field populations of P. xylostella. Bacillus sp. microorganisms are also present in the intestines of all three strains (strains), but the number of isolated and cultured microorganisms is significantly lower than that of Enterobacter sp. It is worth mentioning that Enterococcus sp. microorganisms were only isolated and cultured from the midgut of field populations of diamondback moth, and were not isolated and cultured from either the Cry1Ac-susceptible or Cry1Ac-resistant strains of diamondback moth. Combining the intestinal microbial sequencing results of the three populations (strains) of diamondback moth, there were almost no Enterobacteriaceae in the intestinal microorganisms of the Cry1Ac-susceptible and resistant strains, while the abundance of Enterobacteriaceae in the intestinal microorganisms of the laboratory-resistant strain was much higher than that of the laboratory-susceptible strain. At the same time, the proportion of Enterobacteriaceae in the intestinal microorganisms of field populations of diamondback moth was much higher than that of other populations (strains). Combining the differences in metagenomic sequencing and isolation and culture of the intestinal microorganisms of the three populations (strains) of diamondback moth, Enterobacter asburiae (PxGF1) was selected for subsequent experiments.

[0058] Example 2

[0059] First, the Cry1Ac protoxin was prepared into a 16ppm mother solution, and then gradiently diluted into five gradients of 8ppm, 4ppm, 2ppm, and 1ppm. Then, the five gradients of Cry1Ac protoxin were added to 1000:1 TritonX-100, and the CK control group was the same. Put in the cabbage leaves that were cut to a certain size in advance (slightly smaller than the 9cm culture dish), soak each side for 10 seconds, take it out and turn it over, and dry it at room temperature; put a 6cm filter paper moistened with water in a new culture dish, and put a layer of dry filter paper on it to prevent excessive humidity, put in the dried leaves, and inoculate 10 third-instar larvae of the diamondback moth in each dish, and seal the gap of the culture dish cover with 2 layers of toilet paper to prevent the diamondback moth from escaping; at 25±2℃, relative humidity of 50%. Raise under the natural light cycle, record the death every 24 hours, and end the experiment after 72 hours. The blank control and treatment groups (five gradient concentrations of Cry1Ac toxin) of the above experiment were repeated 4 times. Use Statistics23 calculates the toxicity regression equation and obtains LC 50 value (LethalConcentration 50, i.e. lethal concentration).

[0060] Through the toxicity test, we obtained the regression equation of the toxicity of Cry1Ac toxin to DBM-F as y=1.213x-1.260; R 2 = 0.990, where x is the logarithm of the Cry1Ac toxin concentration to the base 10 and y is the mortality rate (Table 2). Thus, the LC of Cry1Ac toxin to DBM-F can be calculated by the equation 50 It is 10.94μg / mL.

[0061] Table 2 Toxicity equation of Cry1Ac to field populations of Plutella xylostella

[0062]

[0063] * x is the logarithm of the concentration to the base 10, and y is the mortality rate

[0064] The leaf dipping method was used to test the third-instar larvae of diamondback moth. The larvae were divided into several groups, of which 1×10 7 CFU / mL of PxGF1 was mixed with 2.5μg / mL of Cry1Ac protoxin and fed as one group, and the other group was fed with 2.5μg / mL of Cry1Ac protoxin as one group. The control group was fed with water. Three replicates were set for each group, with 30 insects in each group. The mortality rate, pupa weight, and pupation rate of each group were recorded at 72 hours. In addition, the newly dead diamondback moth was placed in 4% paraformaldehyde fixative and sent to Wuhan Pinuofei Biotechnology Co., Ltd. after being fixed for 24 hours for embedding and serial sectioning. The sections with better quality were selected for HE staining and scanning imaging to observe the intestinal tissue of the diamondback moth in each treatment group. Statistics 23 was used for data processing, and one-way analysis of variance and LSD method were used to compare whether there was a significant difference in mortality between the treatment groups (P < 0.05). Figure 5-8 shown.

[0065] As can be seen, when only Cry1Ac protoxin was used to feed diamondback moths, the mortality rate was approximately 5.56% after 48 hours and 53.33% after 72 hours. However, when PxGF1 and Cry1Ac toxin were added simultaneously, the mortality rate of diamondback moths increased sharply to approximately 37.78% after 48 hours and reached its peak at approximately 95.55% after 72 hours. In summary, PxGF1 can improve the efficiency of Cry1Ac in killing diamondback moths, increasing the rate by approximately 32.22% after 48 hours and by approximately 42.22% after 72 hours. When PxGF1 and Cry1Ac toxin were added simultaneously, the pupation rate and pupal weight of the test insects were significantly reduced compared to feeding Cry1Ac protoxin alone. This shows that PxGF1, isolated and identified in this invention, has the ability to enhance the rapid lethality of Cry1Ac protoxin in diamondback moths.

[0066] At the same time, the intestinal structure of the control group was intact, and the intestinal epithelial cells were arranged neatly and tightly ( Figure 8 A). Part of the midgut tissue in the Cry1Ac group was destroyed ( Figure 8 B), epithelial cell shedding. In the PxGF1+Cry1Ac group, the intestinal tissue was severely damaged and no intact intestinal epithelial cells could be observed ( Figure 8 C), indicating that PxGF1 promotes the damage of Cry1Ac to the intestine of Plutella xylostella.

[0067] At the same time, the mortality rates of similar bacteria disclosed in the prior art were also tested according to the same method. Under the same test conditions, the 72-hour mortality rate of the Pantoea agglomerans PxG45 strain disclosed in the prior art CN 116925961A was 21.14% higher than that of Bt alone; under the same test conditions, the 72-hour mortality rate of the Acinetobacter guillouiae PxCG3 strain of the diamondback moth disclosed in the prior art CN 112322541 A was 25.00% higher; under the same test conditions, the 72-hour mortality rate of the Carnobacterium maltaromaticum PxCG2 strain disclosed in the prior art CN 112410252 A was 26.66% higher; and under the same test conditions, the 72-hour mortality rate of the Enterococcus mundtii PxG1 strain of the diamondback moth disclosed in the prior art CN 112175861 B was 30% higher.

[0068] At the same time, the Enterobacter ludwigii disclosed in the prior art (POLENOGOVA OV, NOSKOV YA, YAROSLAVTSEVAO N, et al. Influence of Bacillus thuringiensis and avermectins on gut physiology and microbiota in Colorado potato beetle: Impact of enterobacteria onsusceptibility to insecticides. [J]. PLOS ONE, 2021, 16 (3): e0248704) showed a 72-hour mortality rate that was 20% higher than that of Bt alone under the same test conditions; the Beauveria bassiana disclosed in the prior art (CHUNMEI X, YANBIN S, YUEHUAZ 2018. Influence of synergism with Bacillus thuringiensis and Beauveria bassiana on diamondback moth larvae [C] / / , Atlantis Press; City. 340-343) When bassiana was mixed with Bt in the ratio of 1:1, 1:2, 2:1, 1:3, 3:1 and fed to diamondback moth, the 72h mortality rate was no more than 20% higher than that of feeding Bt alone.

Claims

1. A strain of Enterobacterium plutellae PxGF1, characterized in that Its classification name is Enterobacterasburiae PxGF1. The strain was deposited in the China Center for Type Culture Collection on January 10, 2023, with the collection number CCTCC NO: M2023056, and the collection address is Wuhan University, Wuhan.

2. Use of the Enterobacterium Plutella xylostella PxGF1 according to claim 1 in improving the insecticidal activity of Bt protein.

3. Use of the Enterobacterium Plutella xylostella PxGF1 according to claim 1 in controlling cruciferous vegetable pests; the cruciferous vegetable pests are Plutella xylostella.

4. A method for controlling diamondback moth, characterized in that: The method comprises feeding the diamondback moth with the Enterobacterium PxGF1 of claim 1 and the Bt protein. 5 . Use of the Enterobacterium Plutella xylostella PxGF1 according to claim 1 in the preparation of a medicament for controlling Plutella xylostella.

6. A medicament for controlling diamondback moth, characterized in that: The agent comprises the Plutella xylostella Enterobacterium PxGF1 and Bt protein according to claim 1, and utilizes the synergistic effect of the PxGF1 strain on the Bt protein protoxin to increase the mortality rate to the diamondback moth.

7. The medicament according to claim 6, characterized in that The Bt protein is Cry1Ac protoxin.

Citation Information

Patent Citations

  • A strain of Enterococcus montelukast montelukast and its application

    CN112175861B

  • Acinetobacter guillouiae PxCG3 strain of plutella xylostella (L) and application of acinetobacter guillouiae PxCG3 strain

    CN112322541A

  • Carnocacterium maltaromatoticum PxCG2 strain for plutella xylostella and application thereof

    CN112410252A

  • Pantoea agglomerans PxG45 with effect of enhancing insecticidal activity and bacteriostasis of Bt protein and application of pantoea agglomerans PxG45

    CN116925961A

  • Plutella xylostella (L) Enterococcus mundtii PxG1 bacterial strain and application thereof

    CN112175861A