Application of a Directedly Mutated Glycosyltransferase in the Synthesis of Galactoside Anthocyanins

By directing the mutation of glycosyltransferase Vc3GT to construct a recombinant expression host, a highly efficient catalytic synthesis of malvidin-3-O-galactoside was achieved, solving the problems of high cost and low efficiency in existing technologies and making it suitable for industrial production.

CN118813574BActive Publication Date: 2026-03-06ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411206163.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-30
Publication Date
2026-03-06
Estimated Expiration
2044-08-30

AI Technical Summary

Technical Problem

The lack of efficient enzymatic synthesis methods for malvidin-3-O-galactoside in existing technologies leads to its reliance on separation and purification, which is costly and inefficient.

Method used

By directionally mutagenesizing the glycosyltransferase Vc3GT, particularly at amino acid residues 82, 139, and 322, a glycosyltransferase mutant was constructed and inserted into a recombinant vector for expression. This mutant was then used to catalyze the synthesis of malvidin-3-O-galactoside from malvidin and UDP-galactoside.

Benefits of technology

The efficient catalytic synthesis of malvidin-3-O-galactoside was achieved, reducing costs and making it suitable for large-scale industrial production. The catalytic efficiency of the mutant was significantly improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813574B_ABST
    Figure CN118813574B_ABST
Patent Text Reader

Abstract

This invention provides the application of a directed mutant glycosyltransferase in the synthesis of galactoside anthocyanins, belonging to the field of enzyme engineering technology. This invention provides a glycosyltransferase mutant, wherein the mutant includes mutations at at least one of the following sites in the amino acid sequence of the glycosyltransferase Vc3GT: position 82, position 139, and position 322. The embodiments of this invention verify the synthesis and catalytic efficiency of the mutants, showing that each mutant can be ligated into an expression vector and, through genetic transformation, a recombinant expression host capable of producing the corresponding mutant protein can be obtained. Furthermore, the recombinant protein obtained after induced expression possesses in vitro enzymatic catalytic activity, and can use malvidin and UDP-galactoside as substrates to catalyze the synthesis of malvidin-3-O-galactoside. The catalytic method is simple, the process cost is low, and it is suitable for large-scale industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of engineered enzyme technology, specifically to the application of a directed mutated glycosyltransferase in the synthesis of galactoside anthocyanins. Background Technology

[0002] Anthocyanins ( Figure 2 Anthocyanins are glycoside derivatives of anthocyanins and are the most abundant water-soluble pigments in plants. They possess antioxidant, cardiovascular protective, anti-cancer, blood sugar regulating, immune-enhancing, and beauty and health benefits, and are widely used in pharmaceuticals, health products, cosmetics, and the food industry. The antioxidant activity of anthocyanins and anthocyanins is stronger than that of currently recognized strong antioxidants such as vitamin C, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), and α-tocopherol. Anthocyanins have shown preventive and protective effects against hypertriglyceridemia and hypercholesterolemia (total cholesterol and low-density lipoprotein cholesterol) induced by a high-fat or high-fructose diet in rat models of atherosclerosis. As a natural pigment, anthocyanins or anthocyanins are more trusted by consumers than artificially synthesized pigments. Anthocyanins or anthocyanidins extracted from flowers, fruits, and vegetables are widely used as dyes and food colorings in the food industry.

[0003] Malvaceain-3-O-galactoside is one of the main anthocyanins in blueberries and an important component for the biological activity of blueberry anthocyanins. However, currently, malvaceain-3-O-galactoside can only be prepared by separation and purification methods. For example, Chinese patent CN108822168A combines liquid chromatography purification with high-speed countercurrent chromatography separation technology to separate and prepare high-purity malvaceain-3-O-galactoside monomers from blueberry raw materials with complex anthocyanin composition. To date, there is no research on the in vitro enzymatic catalytic synthesis of malvaceain-3-O-galactoside. Summary of the Invention

[0004] This invention provides the application of a directed mutated glycosyltransferase in the synthesis of galactoside anthocyanins, which can efficiently catalyze the synthesis of anthocyanins.

[0005] The present invention provides a glycosyltransferase mutant, wherein the glycosyltransferase mutant includes a mutation at at least one of the following sites in the amino acid sequence of the glycosyltransferase Vc3GT: position 82, position 139, and position 322;

[0006] The amino acid sequence of the glycosyltransferase Vc3GT is shown in SEQ ID No. 2.

[0007] Preferably, the mutation includes mutations occurring at at least one of the following sites: H82A, V139C, and K322E.

[0008] The present invention also provides primer pairs for introducing the point mutation H82A into the glycosyltransferase Vc3GT, including H82A-F with nucleotide sequences as shown in SEQ ID No. 3 and H82A-R with nucleotide sequences as shown in SEQ ID No. 4.

[0009] The present invention also provides primer pairs for introducing the point mutation V139C into the glycosyltransferase Vc3GT, including V139C-F with nucleotide sequences as shown in SEQ ID No. 5 and V139C-R with nucleotide sequences as shown in SEQ ID No. 6.

[0010] The present invention also provides primer pairs for introducing the point mutation K322E into the glycosyltransferase Vc3GT, including the nucleotide sequence K322E-F as shown in SEQ ID No. 7 and the nucleotide sequence K322E-R as shown in SEQ ID No. 8.

[0011] The present invention also provides the encoding gene of the above-mentioned glycosyltransferase mutant.

[0012] The present invention also provides a recombinant vector containing the above-described coding gene.

[0013] The present invention also provides a recombinant expression host comprising the above-described recombinant vector and expressing the glycosyltransferase mutant described above.

[0014] The present invention also provides the application of the above-mentioned glycosyltransferase mutant, the above-mentioned recombinant vector, or the above-mentioned recombinant expression host in the enzymatic synthesis of malvidin-3-O-galactoside.

[0015] The present invention also provides an in vitro enzymatic method for synthesizing malvidin-3-O-galactoside, using malvidin and UDP-galactoside as substrates, and utilizing the above-mentioned glycosyltransferase mutant or the recombinant protein produced by the above-mentioned recombinant expression host as a catalytic enzyme to carry out an enzymatic reaction to catalyze the synthesis of malvidin-3-O-galactoside.

[0016] Beneficial Effects: This invention uses the glycosyltransferase Vc3GT as the basic enzyme and obtains multiple site-directed mutants through directional modification. These mutants are obtained by mutating one or more amino acid residues at positions 82, 139, and 322 of the basic enzyme's amino acid sequence to another amino acid residue. The synthesis and catalytic efficiency of mutants H82A, H82A / V139C, and H82A / V139C / K322E were verified in the embodiments of this invention. The results show that each mutant can be ligated into an expression vector and, through genetic transformation, a recombinant expression host capable of producing the corresponding mutant protein can be obtained. Furthermore, the recombinant protein obtained after induced expression exhibits in vitro enzyme catalytic activity. Figure 1Using malvidin and UDP-galactoside as substrates, malvidin-3-O-galactoside is obtained by enzyme catalysis. The catalytic method is simple, the process cost is low, and it is suitable for large-scale industrial production. Attached Figure Description

[0017] Figure 1 The structural formula of malvidin;

[0018] Figure 2 The structural formula for anthocyanins is shown.

[0019] Figure 3 The recombinant plasmid is pET-30a(+)-Vc3GT;

[0020] Figure 4 SDS-PAGE electrophoresis analysis of the glycosyltransferase Vc3GT fusion expression;

[0021] Figure 5 Schematic diagram of the reaction catalyzed by glycosyltransferase to synthesize malvidin-3-O-galactoside from malvidin;

[0022] Figure 6 This is a liquid phase analysis diagram of the product of the malvidin reaction catalyzed by the glycosyltransferase mutant M3. Detailed Implementation

[0023] The present invention provides a glycosyltransferase mutant, wherein the glycosyltransferase mutant includes a mutation at at least one of the following sites in the amino acid sequence of the glycosyltransferase Vc3GT: position 82, position 139, and position 322;

[0024] The amino acid sequence of the glycosyltransferase Vc3GT is shown in SEQ ID No. 2.

[0025]

[0026] In this embodiment of the invention, the blueberry-derived glycosyltransferase Vc3GT gene (SEQ ID No. 1) is preferably used. The glycosyltransferase Vc3GT is directionally modified using rationally designed enzyme engineering techniques such as alanine scanning, saturation mutagenesis, and homologous sequence alignment, so that at least one of the following point mutations occurs in the amino acids of glycosyltransferase Vc3GT: H82A, V139C, and K322E.

[0027] The present invention also provides primer pairs for introducing the point mutation H82A into the glycosyltransferase Vc3GT, including H82A-F with nucleotide sequences as shown in SEQ ID No. 3 and H82A-R with nucleotide sequences as shown in SEQ ID No. 4.

[0028] H82A-F (SEQ ID No. 3): CCTTTCGCGTTTTCTACCCACGCCG;

[0029] H82A-R (SEQ ID No. 4): GTCCTCCGCGTGTTTACCAGAGAAG.

[0030] The present invention also provides primer pairs for introducing the point mutation V139C into the glycosyltransferase Vc3GT, including V139C-F with nucleotide sequences as shown in SEQ ID No. 5 and V139C-R with nucleotide sequences as shown in SEQ ID No. 6.

[0031] V139C-F (SEQ ID No. 5): CTTTGGTGCTTCTGGAGCTTGCAGTC;

[0032] V139C-R (SEQ ID No. 6): TCCAGAGCACCAAAGGGTGATCCAT.

[0033] The present invention also provides primer pairs for introducing the point mutation K322E into the glycosyltransferase Vc3GT, including the nucleotide sequence K322E-F as shown in SEQ ID No. 7 and the nucleotide sequence K322E-R as shown in SEQ ID No. 8.

[0034] K322E-F (SEQ ID No. 7): TTTCTTGAAAGGACCAGTGAGVTTG;

[0035] K322E-R (SEQ ID No. 8): GGTCCTTTCAAGAAAACCTTCTGGA.

[0036] The present invention also provides the encoding gene of the above-mentioned glycosyltransferase mutant.

[0037] In this embodiment of the invention, a preferred method is to use a plasmid containing the gene shown in SEQ ID No. 1 as a template to amplify a mutant H82A containing H82A using H82A-F and H82A-R. The nucleotide sequence of H82A is different from that of SEQ ID No. 1, with positions 244-246 mutated from CAC to GCG. Then, using a plasmid containing the mutant H82A as a template, a mutant H82A / V139C containing both H82A and V139C is amplified using V139C-F and V139C-R. The nucleotide sequence of H82A / V139C is different from that of SEQ ID No. 1. In Sequence No. 1, positions 244-246 are mutated from CAC to GCG, and positions 416-417 are mutated from TC to CG. Finally, using the plasmid containing the mutant H82A / V139C as a template, the mutant H82A / V139C / K322E was amplified using K322E-F and K322E-R. Compared with Sequence No. 1, its nucleotide sequence is mutated from CAC to GCG at positions 244-246, from TC to CG at positions 416-417, and from A to G at position 964.

[0038] The present invention also provides a recombinant vector containing the above-described coding gene.

[0039] In this invention, the above-mentioned coding genes are preferably inserted into an expression vector to construct a recombinant vector. For example, in the embodiments, each of the above-mentioned coding genes is inserted into a prokaryotic expression vector, such as pET-30a(+), pET-28a(+), or pET-32a(+). In the embodiments, it is preferred to insert them between the BamHI and XhoI sites of the prokaryotic expression vector.

[0040] The present invention also provides a recombinant expression host comprising the above-described recombinant vector and expressing the glycosyltransferase mutant described above.

[0041] This invention preferably uses prokaryotic expression, thus the recombinant vector is prepared using genetic transformation to obtain recombinant engineered bacteria. In this embodiment, the recombinant vector is preferably chemically transformed into BL21(DE3) competent cells. After reviving for 1 hour, the cells are plated on LB plates containing 50 μg / mL kanamycin resistance, incubated overnight at 37°C, and sequenced to obtain recombinant Escherichia coli genetically engineered bacteria.

[0042] In this embodiment of the invention, it is preferable to use the recombinant Escherichia coli genetically engineered bacteria for induced expression, and more preferably, it includes: inoculating the recombinant Escherichia coli genetically engineered bacteria into LB medium containing 50 μg / mL kanamycin resistance, and culturing at 37°C and 200 rpm with shaking until OD. 600At approximately 0.6, IPTG was added to a final concentration of 0.1 mM, and the mixture was incubated at 16 °C and 180 rpm for 20 h. The bacterial cells were then collected by centrifugation. The supernatant of the bacterial cell lysate was then separated and purified to obtain the mutant.

[0043] The present invention also provides the application of the above-mentioned glycosyltransferase mutant, the above-mentioned recombinant vector, or the above-mentioned recombinant expression host in the enzymatic synthesis of malvidin-3-O-galactoside.

[0044] In this embodiment of the invention, the mutant is used as an enzyme, and malvidin and UDP-galactoside are used as substrates for catalytic reaction to obtain malvidin-3-O-galactoside. The catalytic reaction is as follows: Figure 5 As shown, this demonstrates that the mutant possesses in vitro enzyme activity.

[0045] The present invention also provides an in vitro enzymatic method for synthesizing malvidin-3-O-galactoside, using malvidin and UDP-galactoside as substrates, and utilizing the above-mentioned glycosyltransferase mutant or the recombinant protein produced by the above-mentioned recombinant expression host as a catalytic enzyme to carry out an enzymatic reaction to catalyze the synthesis of malvidin-3-O-galactoside.

[0046] The enzymatic reaction system described in this invention preferably comprises, in 100 μL: 0.05–0.1 M Tris-HCl buffer (pH = 7.0), 0.01–0.5 mM glycosyl donor (UDP-galactose), 0.1–1.0 mM glycosyl acceptor substrate (malvaccinia), and 10–20 μg of purified enzyme.

[0047] The preferred temperature for the enzymatic reaction of the present invention is 25-35°C, and the preferred time for the enzymatic reaction is 10-30 min.

[0048] To further illustrate the present invention, the application of a directionally mutated glycosyltransferase provided by the present invention in the synthesis of galactoside anthocyanins is described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0049] Unless otherwise specified, the materials and methods used in the embodiments of this invention are all conventional commercially available materials and common methods in the art.

[0050] Example 1: Construction of recombinant strain of glycosyltransferase Vc3GT

[0051] Using Yisheng Biotechnology Co., Ltd. The Plant RNA Kit extracts RNA from ripe blueberry berries (Vaccinium corymbosum L.) that have been flash-frozen in liquid nitrogen. RNA was then extracted using PrimeScript from Bio-Tech Co., Ltd. TMThe RT reagent kit reverse transcription method converts extracted RNA into blueberry fruit cDNA, which is then stored at -80°C for later use.

[0052] Primers Vc3GT-BamHI-F and Vc3GT-XhoI-R were designed, and the Vc3GT gene was amplified from blueberry fruit cDNA using PrimeStar DNA polymerase. The PCR system was as follows: 32.5 μL ddH2O, 10 μL 5× buffer, 4 μL 2.5 mM dNTPs, 1 μL 10 mM primer Vc3GT-BamHI-F, 1 μL 10 mM primer Vc3GT-XhoI-R, 1 μL blueberry genomic cDNA, and 0.5 μL PrimeStar DNA polymerase. The PCR program was as follows: 98℃ pre-denaturation for 2 min, followed by 35 cycles (98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 1.5 min), and a further extension at 72℃ for 5 min, followed by storage at 4℃.

[0053] Vc3GT-BamHIF (SEQ ID No. 9): CGGATCCATGCACCATCATCATCATCA;

[0054] Vc3GT-XhoIR (SEQ ID No. 10): CCTCGAGTTAGATATTGTAACCTCTGA.

[0055] PCR products were purified using a PCR product purification kit from Beijing TransGen Biotech Co., Ltd., and then ligated into the vector pET-30a(+) digested with BamHI and XhoI restriction endonucleases. The ligation product was transformed into *E. coli* BL21(DE3), plated onto kanamycin-resistant plates, and incubated overnight (12–16 h) at 37°C. Single colonies were picked and added to 5 mL LB broth containing kanamycin-resistant medium, and incubated overnight on a shaker at 37°C and 200 rpm. The bacterial culture was then sequenced using universal sequencing primers Seq1 and Seq2. Based on the sequence results, the correctly sequenced strains were selected as... Figure 3 The strain expressing the recombinant plasmid pET-30a(+)-Vc3GT is shown.

[0056] Seq1 (SEQ ID No. 11): CAGCCGGATCTCAGTGGTGG;

[0057] Seq2 (SEQ ID No. 12): TCTGGTATGAAAGAAACCGC.

[0058] Example 2 Construction of a mutant recombinant plasmid of glycosyltransferase Vc3GT

[0059] Primers for mutants M1, M2, and M3 were designed based on the gene sequence of the glycosyltransferase Vc3GT and the requirements for directed mutation. Fast Mutagenesis primers were then used. The System kit was used to construct the recombinant plasmid pET-30a(+)-Vc3GT, a mutant of glycosyltransferase Vc3GT, pET-30a(+)-M1, using primers H82A-F and H82A-R. Using pET-30a(+)-M1 as a template, the recombinant plasmid pET-30a(+)-M2, a mutant of glycosyltransferase Vc3GT, was constructed using primers V139C-F and V139C-R. Using pET-30a(+)-M2 as a template, the recombinant plasmid pET-30a(+)-M3, a mutant of glycosyltransferase Vc3GT, was constructed using primers K322E-F and K322E-R. The primer sequences are SEQ ID No. 3 to SEQ ID No. 8, respectively.

[0060] Recombinant plasmids pET-30a(+)-M1, pET-30a(+)-M2, and pET-30a(+)-M3 were transformed into *E. coli* BL21(DE3), plated onto kanamycin-resistant plates, and incubated overnight (12–16 h) at 37°C. Single colonies were picked and added to 5 mL LB broth containing kanamycin-resistant medium, and incubated overnight on a shaker at 37°C and 200 rpm. The bacterial culture was then sequenced using universal sequencing primers Seq1 and Seq2. Based on the sequence results, the correctly sequenced strains were selected as the expression strains for recombinant plasmids pET-30a(+)-M1, pET-30a(+)-M2, and pET-30a(+)-M3.

[0061] Example 3: Expression and purification of glycosyltransferase Vc3GT and its mutants

[0062] The expression strains of recombinant plasmids pET-30a(+)-Vc3GT, pET-30a(+)-M1, pET-30a(+)-M2, and pET-30a(+)-M3 were added at a ratio of 1:50 to 5 mL of LB broth containing kanamycin resistance in test tubes and cultured overnight at 37°C and 200 rpm in a shaker. Then, 5 mL of the overnight culture was added to 250 mL of LB broth containing kanamycin resistance and cultured for 2–3 hours in a shaker at 37°C and 200 rpm until OD500 was reached. 600Approximately 0.6. IPTG solution was added to a final concentration of 0.1 mM, and the mixture was incubated in a shaker at 16°C and 180 rpm for 20 h to induce protein expression. The cells were collected by centrifugation at 8000 rpm and 4°C for 15 min, resuspended in 1×PBS buffer pre-frozen at 4°C, and stored at -80°C. The -80°C-frozen cells were thawed in a 37°C water bath and sonicated. The sonication program was: 4 s sonication, 2 s interval, 10 min sonication. The protein was purified using the Clontech HisTALON kit from Baori Medical Technology Co., Ltd., following the kit's instructions. Protein bands were detected by SDS-PAGE. Samples with correct bands were then desalted using a GE Healthcare PD-10 column, following the recommended procedures. The samples were stored at -80°C for later use. Results are as follows... Figure 4 As shown.

[0063] Example 4 Enzyme kinetics test of glycosyltransferase Vc3GT and its mutants

[0064] The total volume of the reaction system was 100 μL, which contained 0.1 M Tris-HCl buffer (pH = 7.0), 0.01-0.5 mM glycosyl donor (UDP-galactose), 0.1 mM glycosyl acceptor substrate (malvaline), and 10 μg of purified Vc3GT or the mutant protein prepared in Example 3.

[0065] The enzyme kinetics experiment was performed by incubating in a 30°C water bath for 10 min, followed by the addition of 100 μL of 0.1 M HCl to terminate the reaction. The mixture was centrifuged at 12000 rpm for 3 min, and the supernatant was filtered through a 0.22 μM organic filter membrane and analyzed by liquid chromatography.

[0066] The specific conditions for liquid chromatography detection are as follows: Instrument: ThermoFisher U3000 high performance liquid chromatograph; Analytical column: Promosil C18 column (4.6×250mm, 5μm); Detection wavelength: 520nm; Injection volume: 20 μL; Detection temperature: 30℃; Flow rate: 0.8mL / min; Mobile phases are acetonitrile (phase A) and 1.5% formic acid solution (phase B).

[0067] The elution gradient was set as follows: 0-3.5 min, the proportion of phase A increased from 15% to 40%; 3.5-5.5 min, the proportion of phase A increased from 40% to 100%; 5.5-7 min, the proportion of phase A decreased from 100% to 15%; 7-10 min, the proportion of phase A remained at 15%.

[0068] Liquid chromatography analysis results of the product of the glycosyltransferase mutant M3 catalyzing the reaction of malvatin are as follows: Figure 6As shown in Table 1, the results of the enzyme kinetics experiment are shown in Table 1. The Km of mutant M3... m It is 9.89±1.68, k cat 1.03×10 5 ±3.22×10 3 s -1 k cat / K m 1.04×10 4 The k of mutant M3 cat / K m It is 15.30 times that of the wild type (WT), indicating that its catalytic efficiency is significantly improved compared to the wild type.

[0069] Table 1 Enzyme kinetic data of glycosyltransferase Vc3GT and its mutants

[0070] enzymes Km(μM) <![CDATA[kcat(s -1 )]]> <![CDATA[kcat / Km(μM -1 ·s -1 )]]> multiple WT 131.9±48.7 <![CDATA[8.95×10 4 ±1.31×10 3 ]]> 678.67 1.00 M1 8.81±1.19 <![CDATA[8.36×10 4 ±5.62×10 3 ]]> <![CDATA[9.49×10 3 ]]> 13.98 M2 2.33±1.80 <![CDATA[2.02×10 4 ±1.22×10 3 ]]> <![CDATA[8.69×10 3 ]]> 12.80 M3 9.89±1.68 <![CDATA[1.03×10 5 ±3.22×10 3 ]]> <![CDATA[1.04×10 4 ]]> 15.30

[0071] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A glycosyltransferase mutant, characterized in that, The sugar transferase mutant is mutated at H82A, V139C and K322E in the amino acid sequence of sugar transferase Vc3GT; The amino acid sequence of the sugar transferase Vc3GT is shown in SEQ ID No.

2.

2. A gene encoding the sugar transferase mutant of claim 1.

3. A recombinant vector comprising the gene of claim 2.

4. A recombinant expression host comprising the gene of claim 2 and expressing the sugar transferase mutant of claim 1.

5. Use of the glycosyltransferase mutant of claim 1 or the recombinant vector of claim 3 or the recombinant expression host of claim 4 in the enzymatic synthesis of malvidin-3- galactoside. O - galactoside.​ 6. A process for the in vitro enzymatic synthesis of malvidin-3- glucoside, characterized in that, O - galactoside, characterized in that, Using malvidin and UDP-galactoside as substrates, and employing the glycosyltransferase mutant of claim 1 or the recombinant protein produced by the recombinant expression host of claim 4 as the catalytic enzyme, an enzymatic reaction is carried out to catalyze the synthesis of malvidin-3- O -Galactoside.

Citation Information

Patent Citations

  • Separation and purification method and application of malvidin-3-O-galactoside

    CN108822168A

  • A galactosyltransferase mutant and its application in preparing flavonoids

    CN118909996B