A method and kit for detecting total methylated cysteine
By combining an evanescent wave fiber optic sensor with a competitive detection mode of nucleic acid aptamers, the problem of insufficient sensitivity in the detection of total methylcysteine in serum in existing technologies has been solved, realizing a rapid, low-cost, and sensitive detection method suitable for use in grassroots units and homes.
Patent Information
- Application Number
- CN202310432096.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-21
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2043-04-21
Smart Images

Figure CN118818052B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a method and a kit for detecting total amount of methylated cysteine, belonging to the field of biotechnology and analytical testing. BACKGROUND
[0002] Methylated cysteine (Hcy) is an intermediate product of methionine metabolism. In the human body, about 98%-99% of Hcy forms a complex with proteins and amino acids through disulfide bonds, and only 1%-2% of Hcy exists in a free state. The total amount of Hcy (tHcy) in the serum of normal people is 5-15 micromoles per liter (μM), and less than 6 micromoles per liter is the optimal value. Clinical medical research shows that the tHcy concentration of patients with cardiovascular system diseases, diabetes, hypertension and other diseases is higher than the normal value. Therefore, serum tHcy concentration detection has become an important part of clinical diagnosis of cardiovascular diseases and general health examination. The existing methods for detecting tHcy mainly include high performance liquid chromatography, radioimmunoassay and enzyme cycling method. Among them, high performance liquid chromatography relies on expensive instruments and skilled technicians, so it is not convenient to use in basic units. Radioimmunoassay needs to use radioactive reagents, which has poor safety. The enzyme cycling method has relatively simple detection steps and good safety, and is the mainstream method for tHcy detection in hospital laboratories at present.
[0003] The enzyme cycling method utilizes the cycle reaction of substrate and coenzyme to continuously generate enzyme reaction products, and is a colorimetric detection method based on continuous catalytic reaction of multiple enzymes. Figure 1 Firstly, the oxidized Hcy is reduced to free Hcy by using a reducing agent. Then, the free Hcy reacts with S-adenosyl methionine (SAM) under the catalysis of Hcy methyltransferase to form methionine and S-adenosyl homocysteine (SAH). The SAH is hydrolyzed by SAH hydrolase to generate adenosine and Hcy. The generated Hcy enters the next cycle reaction to continuously generate SAH and then adenosine. The adenosine is hydrolyzed into inosine and ammonia, and the ammonia is converted into reduced coenzyme I (NADH) into oxidized coenzyme I (NAD) under the action of glutamate dehydrogenase. The concentration of Hcy in the sample is proportional to the change in the concentration of NAD. The quantitative detection of tHcy is realized by detecting the ultraviolet-visible absorption of NAD at 340 nm. The enzyme cycling method needs to accurately control the reaction time and relies on imported equipment; the reagents are of multiple types, high in cost, and need to be stored at 2-8 degrees without freezing; the stability of the reagents is only 7 days at 2-8 degrees in the dark after opening the bottle. At present, the detection can only be carried out in the laboratory, and the detection result is easily interfered by endogenous substances. Therefore, there is an urgent need for a rapid and inexpensive method for detecting tHcy.
[0004] Aptamer is a single-stranded DNA or RNA molecule with unique spatial configuration, which can specifically recognize various types of targets. Aptamer is obtained by in vitro screening technology, and can be obtained by chemical synthesis, with less performance difference between batches, good thermal stability, and low cost. In recent years, rapid detection methods based on aptamer have attracted much attention, and rapid and sensitive detection of various small molecule targets such as antibiotics and toxins has been achieved. The DNA aptamer of Hcy has been reported in the literature (5' ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3', RSC Adv., 2013, 3, 24415-24422), and the dissociation constant is 600 ± 300 nanomoles per liter (nM). The aptamer is combined with gold nanoparticles to realize colorimetric detection of free Hcy. The detection limit (LOD, S / N = 3) is 0.5 μM (equivalent to 5 μM for 100% serum) in 10% serum, and the kinetic interval is 0.5-3.0 μM (RSC Adv., 2013, 3, 24415-24422). The aptamer is combined with an electrochemical sensor to realize electrochemical detection of free Hcy, and the LOD is 0.01 μM in buffer, and the kinetic interval is 0.05-20.0 μM (Bioelectrochemistry, 2020, 134, 107497). However, this method is greatly affected by the serum matrix, and the detection limit of free Hcy in 50% serum is higher than 1 μM (equivalent to 2 μM for 100% serum). The concentration of free Hcy in normal human serum is about 50 nM-0.3 μM, so the sensitivity of the methods reported in the above two literatures is poor, and neither of them can detect free Hcy in serum. In particular, the above methods detect free Hcy and cannot be used for tHcy detection.
[0005] Evanescent wave fiber fluorescence sensor is a portable optical sensor based on the unique phenomenon of evanescent wave generated on the interface of light-lean medium when light wave is transmitted in optical fiber in the form of total reflection. By utilizing the ability of evanescent wave to excite fluorescent groups on the surface of optical fiber, the quantitative detection of the content of various types of to-be-detected substances is realized by detecting the change of fluorescence intensity. SUMMARY
[0006] In the present application, the tHcy concentration of patient serum is detected by evanescent wave fiber method. As shown in Fig. 1, the serum sample is first mixed with the tHcy antibody to form a complex, and then the complex is mixed with the tHcy antibody to form a complex. Figure 2As shown, in addition to free Hcy, there are three kinds of oxidized Hcy complexes in serum. In the present application, an evanescent wave optical fiber sensor is constructed using a nucleic acid aptamer which has a high response to free Hcy (dissociation constant in the range of nanomolar per liter) and a moderate response to oxidized Hcy (dissociation constant in the range of micromolar per liter). The sensor is based on a competitive detection mode, in which a fluorescently labeled complementary strand and Hcy compete for binding to the nucleic acid aptamer immobilized on the optical fiber. The decrease in the fluorescence signal is positively correlated with the concentration of tHcy in serum. The concentration of tHcy in serum is calculated according to the percentage of fluorescence reduction. The present application only requires 1 microliter of serum for detection, and the detection is performed after diluting the serum 1000 times. The detection results are consistent with those of the commercial enzyme cycle method. Compared with the enzyme cycle method, the present application has the advantages of low price (the optical fiber can be reused more than 30 times), fast detection speed (5 minutes at the fastest), no need for enzymes, small equipment, simple operation, etc., and has excellent clinical application value.
[0007] The application provides a method for detecting total amount of methylated cysteine, which utilizes a nucleic acid aptamer with high response to free Hcy and moderate response to oxidized Hcy to construct an evanescent wave optical fiber sensor. The sensor is based on a competitive detection mode, in which a fluorescently labeled complementary strand, reduced Hcy and oxidized Hcy compete with the nucleic acid aptamer immobilized on the optical fiber for binding. The higher the concentrations of reduced (free) Hcy and oxidized Hcy, the more nucleic acid aptamer immobilized on the optical fiber binds to them, and the less nucleic acid aptamer binds to the fluorescently labeled complementary strand, resulting in a lower fluorescence response value. The decrease in fluorescence signal is positively correlated with the concentration of tHcy in serum, and the concentration of tHcy in serum is calculated according to the percentage of fluorescence reduction. In addition, a Tween 80 nanometer layer on the optical fiber interface in situ enriches Hcy, greatly increasing the concentrations of reduced Hcy and oxidized Hcy near the optical fiber interface, further promoting their binding to the nucleic acid aptamer immobilized on the optical fiber, resulting in a lower fluorescence response value and thus higher detection sensitivity. Serum containing different concentrations of tHcy is diluted 1,000-fold in buffer, or a mixture of serum and reducing agent Tris(2-carboxyethyl) phosphine (TCEP) is diluted 1,000-fold in buffer, and then a complementary strand modified with Cy5.5 is added at a final concentration of 20 nM. The mixture is introduced into the optical fiber sensor through the following three steps: (1) pump in buffer for 30 seconds to clean the sample pipeline and optical fiber reaction cell, ensuring a stable baseline; (2) pump in the mixture of target and complementary strand for 20 seconds and keep for 180 seconds to determine the fluorescence signal in real time; (3) flush with 0.5% SDS, pH 1.9 washing buffer for 30 seconds to flush away the complementary strand bound to the surface of the optical fiber, repeat (1)-(3) to detect the next sample. The working curve is plotted with the concentration of tHcy as the abscissa and the percentage of relative fluorescence signal decrease as the ordinate. The detection of tHcy in real samples is carried out according to the method described above. According to the response value of the fluorescence signal, the concentration of tHcy is calculated using the working curve.
[0008] In the method for detecting the total amount of methylated cysteine described in this invention, both reduced Hcy and oxidized Hcy can bind to nucleic acid aptamers immobilized on the optical fiber. However, the affinity of the nucleic acid aptamers for reduced Hcy is much higher than that for oxidized Hcy. When the serum is diluted 10,000 times for detection, the decrease in fluorescence signal value is mainly caused by the competitive binding of the complementary strands of reduced Hcy and nucleic acid aptamers with the nucleic acid aptamers immobilized on the optical fiber. The concentration of reduced Hcy can be detected based on the fluorescence signal value. When the serum is diluted 1,000 times for detection, the decrease in fluorescence signal value is caused by the competitive binding of reduced Hcy, oxidized Hcy, the complementary strands of nucleic acid aptamers with the nucleic acid aptamers immobilized on the optical fiber. The total concentration tHcy of reduced and oxidized Hcy can be detected based on the fluorescence signal value. Furthermore, since nucleic acid aptamers have a much higher affinity for reduced Hcy than for oxidized Hcy, adding TCEP to partially reduce oxidized Hcy in serum to reduced free Hcy can improve the fluorescence signal response value, thereby increasing detection accuracy. The fluorescence signal response value can be controlled by adjusting the TCEP reduction reaction time and the TCEP concentration.
[0009] The present invention also provides a kit for detecting the total amount of methylated cysteine, comprising a complementary sequence of a Cy5.5-modified Hcy nucleic acid aptamer, a buffer, a reducing agent tris(2-carboxyethyl)phosphine (TCEP), and an interface regeneration reagent (0.5% sodium dodecyl sulfonate (SDS, pH 1.9).
[0010] In the foregoing kit, a nucleic acid aptamer with high response to free Hcy and moderate response to oxidized Hcy is used to construct an evanescent wave optical fiber sensor based on a competitive detection mode, in which a fluorescently labeled complementary strand, reduced Hcy, and oxidized Hcy compete with the nucleic acid aptamer immobilized on the optical fiber for binding. The higher the concentrations of reduced (free) Hcy and oxidized Hcy, the more nucleic acid aptamer immobilized on the optical fiber binds to them, and the less nucleic acid aptamer binds to the fluorescently labeled complementary strand, resulting in a lower fluorescence response value. The decrease in fluorescence signal is positively correlated with the concentration of tHcy in serum, and the concentration of tHcy in serum is calculated based on the percentage decrease in fluorescence. In addition, a Tween 80 nanolayer on the optical fiber interface in situ enriches Hcy, greatly increasing the concentrations of reduced Hcy and oxidized Hcy near the optical fiber interface, further promoting their binding to the nucleic acid aptamer immobilized on the optical fiber, resulting in a lower fluorescence response value and higher detection sensitivity. Serum containing different concentrations of tHcy is diluted 1,000-fold in buffer, or a mixture of serum and reducing agent Tris(2-carboxyethyl) phosphine (TCEP) is diluted 1,000-fold in buffer, and then 20 nM of the complementary strand modified with Cy5.5 is added. The mixture is introduced into the optical fiber sensor through the following three steps: (1) pump in buffer for 30 seconds to clean the sample pipeline and optical fiber reaction cell, ensuring a stable baseline; (2) pump in the mixture of target and complementary strand for 20 seconds and hold for 180 seconds to measure the fluorescence signal in real time; (3) flush with 0.5% SDS, pH 1.9 washing buffer for 30 seconds to flush away the complementary strand bound to the surface of the optical fiber. Repeat steps (1)-(3) to detect the next sample. Plot the working curve with the concentration of tHcy as the horizontal coordinate and the percentage decrease in relative fluorescence signal as the vertical coordinate. Detect tHcy in real samples as described above, and calculate the concentration of tHcy based on the fluorescence signal response value using the working curve.
[0011] In the foregoing kit, both reduced Hcy and oxidized Hcy can bind to the nucleic acid aptamer fixed on the optical fiber, but the affinity of the nucleic acid aptamer to reduced Hcy is much higher than that to oxidized Hcy, when the serum is diluted 10000 times for detection, the decrease of the fluorescence signal value is mainly caused by the competitive binding of the complementary strand of reduced Hcy and nucleic acid aptamer to the nucleic acid aptamer fixed on the optical fiber, and the concentration of reduced Hcy can be detected according to the fluorescence signal value, when the serum is diluted 1000 times for detection, the decrease of the fluorescence signal value is caused by the competitive binding of reduced Hcy, oxidized Hcy, the complementary strand of nucleic acid aptamer to the nucleic acid aptamer fixed on the optical fiber, and the total concentration tHcy of reduced and oxidized Hcy can be detected according to the fluorescence signal value, in addition, since the affinity of the nucleic acid aptamer to reduced Hcy is much higher than that to oxidized Hcy, by adding TCEP to reduce part of the oxidized Hcy in the serum to free Hcy in the reduced state, the response value of the fluorescence signal can be improved, thereby improving the accuracy of the detection, and the response value of the fluorescence signal can be regulated by regulating the time of TCEP reduction reaction and the concentration of TCEP.
[0012] In the foregoing kit, the complementary sequence of the Hcy nucleic acid aptamer is 5'-GATGCCTGTGAA-Cy5.5-3'.
[0013] In addition, in the foregoing kit, TCEP is a common reducing agent for Hcy detection. SDS is a common surfactant and denaturing agent for double-stranded DNA.
[0014] The method of the present application has the following advantages:
[0015] 1) Low price: The price of enzyme cycle method is generally 50-120 yuan / time. Since the optical fiber can be recycled (>30 times), the cost of single detection is low (<1 yuan).
[0016] 2) Ultra-fast detection: The enzyme cycle method needs 2-3 hours for detection. The present application can detect tHcy in serum in 5 minutes at the fastest.
[0017] 3) Community and family use: Due to the complexity of existing detection technology, Hcy detection is currently usually carried out in large hospitals. The present application is small in size, cheap, maintenance-free and easy to operate, and can be independently completed after simple training. It can be popularized in community hospitals or even families, so that people can more conveniently detect the content of tHcy in serum.
[0018] 4) Only 1 microliter of blood is needed: The present application can accurately detect the content of tHcy in one thousandth of serum, and the amount of blood needed is extremely small, reducing the pain of patients.
[0019] 5) fewer reagent types, longer shelf life: enzyme cycling method requires more reagent types, 2-8 degrees storage, not frozen; 2-8 degrees after opening, stable for 7 days. The method of the application only needs optical fiber probe and buffer, reducing agent, interface regeneration reagent, fluorescently labeled complementary probe, and all are chemical synthesis reagents, good stability. The optical fiber is stable at 2-8 degrees for more than 2 months; the reagent box is stable in the freezer for more than 1 year. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 is the principle diagram of the enzyme cycling method for detecting tHcy;
[0021] Figure 2 is the structural diagram of four different forms of Hcy in serum;
[0022] Figure 3 is the construction step and detection principle diagram of the Hcy evanescent wave optical fiber sensor;
[0023] Figure 4 is the working curve diagram of the optical fiber sensor for detecting Hcy in serum;
[0024] Figure 5 is the working curve diagram of Hcy detection with or without TCEP added;
[0025] Figure 6 is the working curve diagram of patient serum tHcy concentration detection without TCEP (group A) and test samples (group B). The vertical coordinate of the fluorescence reduction percentage is the signal measured by the optical fiber sensor, and the horizontal coordinate of the tHcy concentration is detected by the enzyme cycling method.
[0026] Figure 7 is the working curve diagram of patient serum tHcy concentration detection with 5 μM TCEP added (group A) and test samples (group B). The vertical coordinate of the fluorescence reduction percentage is the signal measured by the optical fiber sensor, and the horizontal coordinate of the tHcy concentration is detected by the enzyme cycling method. DETAILED DESCRIPTION
[0027] The overall technical solution of the application is a method and kit for detecting total methylated cysteine.
[0028] The application provides a method for detecting total amount of methylated cysteine, which utilizes aptamer with high response to free Hcy and moderate response to oxidized Hcy to construct an evanescent wave optical fiber sensor. The sensor is based on a competitive detection mode, in which a fluorescently labeled complementary strand and Hcy compete with the aptamer immobilized on the optical fiber. Meanwhile, a Tween 80 nanolayer on the optical fiber interface in-situ enriches Hcy, and the decrease of the fluorescent signal is positively correlated with the concentration of tHcy in serum. The concentration of tHcy in serum is calculated according to the percentage of fluorescence reduction. The serum containing different concentrations of tHcy is diluted 1,000 times in buffer, or the mixture of serum and reducing agent is diluted 1,000 times in buffer, and then the complementary strand with Cy5.5 modification is added at a final concentration of 20 nM. The mixture is introduced into the optical fiber sensor through the following three steps: (1) pumping buffer for 30 seconds to clean the sample pipeline and the optical fiber reaction pool to ensure a stable baseline; (2) pumping the mixture of target and complementary strand into the optical fiber reaction pool for 20 seconds and keeping for 180 seconds to determine the fluorescent signal in real time; (3) flushing for 30 seconds by pumping 0.5% SDS, pH 1.9 washing buffer to flush away the complementary strand combined with the surface of the optical fiber. The steps (1)-(3) are repeated to detect the next sample. The working curve is plotted with the concentration of tHcy as the abscissa and the percentage of relative fluorescent signal reduction as the ordinate. The detection of tHcy in real samples is carried out according to the method described above. The concentration of tHcy is calculated according to the response value of the fluorescent signal using the working curve.
[0029] In the method for detecting total amount of methylated cysteine, both reduced Hcy and oxidized Hcy can bind to the aptamer immobilized on the optical fiber, but the affinity of the aptamer to reduced Hcy is much higher than that to oxidized Hcy. When the serum is diluted 10,000 times for detection, the decrease of the fluorescent signal value is mainly caused by the competitive binding of reduced Hcy and the complementary strand of the aptamer to the aptamer immobilized on the optical fiber, and the concentration of reduced Hcy can be detected according to the fluorescent signal value. When the serum is diluted 1,000 times for detection, the decrease of the fluorescent signal value is caused by the competitive binding of reduced Hcy, oxidized Hcy, and the complementary strand of the aptamer to the aptamer immobilized on the optical fiber, and the total concentration of reduced and oxidized Hcy (tHcy) can be detected according to the fluorescent signal value. In addition, since the affinity of the aptamer to reduced Hcy is much higher than that to oxidized Hcy, the addition of TCEP to partially reduce oxidized Hcy in serum to free Hcy in the reduced state can improve the response value of the fluorescent signal, thereby improving the accuracy of the detection. The response value of the fluorescent signal can be regulated by adjusting the time of TCEP reduction reaction and the concentration of TCEP.
[0030] The present invention also provides a kit for detecting the total amount of methylated cysteine, comprising a complementary sequence of a Cy5.5-modified Hcy nucleic acid aptamer, a buffer, a reducing agent tris(2-carboxyethyl)phosphine (TCEP), and an interface regeneration reagent (0.5% sodium dodecyl sulfonate (SDS, pH 1.9).
[0031] In the aforementioned kit, the complementary sequence of the Hcy nucleic acid aptamer is: 5'-GATGCCTGTGAA-Cy5.5-3'.
[0032] In addition, in the aforementioned kits, TCEP is a commonly used reducing agent for Hcy detection. SDS is a commonly used surfactant and denaturing agent for double-stranded DNA.
[0033] Table 1. DNA probes used in this invention
[0034]
[0035] Cy5.5: Fluorescent group
[0036] All tests in the following examples were performed in a buffer solution (50 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 100 mM sodium chloride, 1 mM magnesium chloride, 20 mM potassium chloride, 1 mM calcium chloride, pH 7.4).
[0037] Example 1. Fabrication of Functionalized Optical Fibers
[0038] like Figure 3 As shown, the interface modification steps for optical fibers are as follows:
[0039] 1. Hydroxylation: After cleaning the optical fiber with an ultrasonic cleaner, the fiber is placed in a piranha solution (H2O2:H2SO4 = 1:3 v / v) and heated at 120°C for 1 hour. The fiber is then rinsed with ultrapure water, dried with an air pump, and stored at 70°C overnight.
[0040] 2. Silanization: The optical fiber is placed in a 2% (v / v) toluene solution of 3-aminopropyltriethoxysilane (APTS) and reacted at room temperature for 1 hour. The optical fiber is then cleaned with anhydrous toluene and dried with an air pump. It is then placed in an oven and dried at 180°C for 1 hour.
[0041] 3. Aldehydeation: The optical fiber was placed in a 2% (v / v) glutaraldehyde aqueous solution and reacted at room temperature for 3 hours, then washed with ultrapure water;
[0042] 4. Coupled with nucleic acid aptamers: The optical fiber was placed in an aqueous solution (500 nM, Table 1) of amino-modified nucleic acid aptamers and reacted at room temperature for 8 hours; then it was washed with ultrapure water.
[0043] 5. Reduction: The fiber was immersed in 3% (m / v) aqueous sodium borohydride solution and reacted at room temperature for 30 min; washed with ultrapure water; and the prepared fiber was stored at low temperature (4°C).
[0044] Before use, the fiber was sealed in 1% (w / v) aqueous Tween 80 solution at room temperature for 1 h, and then washed with ultrapure water until no bubbles were generated, and was ready for use.
[0045] Example 2. Ultra-sensitive detection of labeled reduced Hcy in serum using a fiber-optic sensor
[0046] The fiber-optic sensor of the present application is a signal reduction fluorescence sensing mode. Reduced Hcy and the fluorescence-labeled complementary DNA strand in the sample compete with the nucleic acid aptamer immobilized on the fiber for binding Figure 3 ). The higher the concentration of reduced (free) Hcy, the more nucleic acid aptamer immobilized on the fiber binds to it, and the less nucleic acid aptamer binds to the fluorescence-labeled complementary strand, and the lower the fluorescence response value. At the same time, the Tween 80 nanolayer on the fiber interface in situ enriches Hcy, achieving ultra-sensitive detection of Hcy.
[0047] When testing the labeled Hcy in the serum sample, no sample pretreatment is required. Only different concentrations of Hcy are added to the serum and mixed, and the final concentrations are 100 pM, 1 nM, 10 nM, 100 nM, 1 μM, 10 μM, 100 μM, 1 mM, 10 mM, and 100 mM, respectively. Then, the labeled serum sample is diluted 1,000 times in a buffer, and the complementary strand with Cy5.5 modification is added at a final concentration of 20 nM. The mixture is introduced into the evanescent wave fiber-optic sensing system through the following three steps. (1) Pump in the buffer for 30 seconds to clean the sample pipeline and the fiber reaction pool to ensure a stable baseline; (2) pump the mixture of the target and the complementary strand into the fiber reaction pool (20 seconds) and keep for 180 seconds to determine the fluorescence signal in real time; (3) pump in the washing buffer (0.5% SDS, pH 1.9) for 30 seconds to flush away the complementary strand bound to the fiber surface. Repeat (1)-(3), and the concentration of the target Hcy in (2) is increased in turn. Plot the working curve with the Hcy concentration as the abscissa and the relative fluorescence signal drop percentage as the ordinate.
[0048] The detection results are shown in Figure 4 . The detection limit is 0.16 nM (converted to the concentration in 100% serum), and the half-logarithmic linear kinetic interval is 1 nM to 100 mM (y = 4.33x + 75.96, R 2= 0.994). The LOD is lower than the method of serum dilution of 10,000 times (invention patent application number 202111382703.1), and the percentage of fluorescence reduction is higher at the same Hcy concentration. The concentration of free Hcy in normal human serum is 50 nM-0.3 μM, and when the serum is diluted by 1,000 times, the concentration of free Hcy is 50 pM-0.3 nM, which is 10 times higher than the free Hcy in serum diluted by 10,000 times, but still very small, so it will not cause a significant decrease in fluorescence signal. In serum, Hcy mainly exists in four forms, namely free Hcy, Hcy and Hcy disulfide, Hcy and Cys disulfide, and Hcy and plasma protein disulfide Figure 2 At the same Hcy concentration, the higher percentage of fluorescence reduction of serum samples diluted by 1,000 times indicates that the aptamer of Hcy should have affinity for oxidized Hcy, but weaker than that for free reduced Hcy. When the serum is diluted by 10,000 times, the aptamer does not bind to oxidized Hcy, and when the serum is diluted by 1,000 times, the binding between the two is enhanced, resulting in a larger decrease in fluorescence signal. This example demonstrates that the aptamer of Hcy not only has affinity for reduced Hcy, but also has affinity for oxidized Hcy, but is weaker than the former.
[0049] Example 3. Effect of reducing agent TCEP on the sensor
[0050] TCEP is a common reducing agent for Hcy detection, which can reduce oxidized Hcy to free Hcy. In order to test whether TCEP interferes with the detection of Hcy, we performed the following experiment. Different concentrations of Hcy were added to the serum and mixed, then diluted by 1,000 times in buffer, different concentrations of TCEP (final concentrations of 0 μM, 1 μM, 5 μM) were added and mixed, and then the complementary strand with Cy5.5 modification with a final concentration of 20 nM was added and mixed.
[0051] The results are shown in Figure 5 As the concentration of TCEP in the system increases, the working curve shows a semi-logarithmic linear relationship in the test range of 1 nM to 100 mM, and only the slope increases slightly. When no TCEP is added and 1 μM and 5 μM of TCEP is added, the slopes are 4.33 (y = 4.33x + 75.96, R 2 = 0.994), 5.44 (y = 5.44x + 80.99, R 2 = 0.976), and 6.02 (y = 6.02x + 86.35, R 2= 0.978). This data indicates that TCEP does not significantly interfere with the quantitative detection of Hcy. The slightly increased slope should be due to TCEP as a reducing agent, reducing a small amount of oxidized Hcy in serum to free Hcy. Since TCEP is added to the serum after 1000-fold dilution in the experiment, and the test is performed immediately, the amount of oxidized Hcy reduced is small, so the increase in slope is also small. In addition, this experimental result also confirms again that the affinity of Hcy aptamer to free Hcy is stronger than that to oxidized Hcy.
[0052] Example 4. Rapid detection of tHcy in patient serum samples using optical fiber sensor
[0053] In the method for detecting total amount of methylated cysteine of the present application, both reduced Hcy and oxidized Hcy can bind to the aptamer immobilized on the optical fiber, but the affinity of the aptamer to reduced Hcy is much higher than that to oxidized Hcy. When the serum is diluted 10000-fold for detection, the decrease in fluorescence signal value is mainly caused by the competitive binding of reduced Hcy and the complementary strand of the aptamer to the aptamer immobilized on the optical fiber, and the concentration of reduced Hcy can be detected according to the fluorescence signal value. When the serum is diluted 1000-fold for detection, the decrease in fluorescence signal value is caused by the competitive binding of reduced Hcy, oxidized Hcy, and the complementary strand of the aptamer to the aptamer immobilized on the optical fiber, and the total concentration tHcy of reduced and oxidized Hcy can be detected according to the fluorescence signal value.
[0054] The preparation steps of the optical fiber are the same as those in Example 1, and the optical fiber is prepared by hydroxylation, silanization, aldehyde group modification, coupling of the aptamer, and reduction steps. Before testing, the optical fiber is blocked with Tween 80 at a concentration of 1% (w / v). Real patient serum samples are taken, diluted 1 thousand times in buffer, and then mixed and incubated with 20 nM of the complementary strand of the Hcy aptamer labeled with the fluorescent group Cy 5.5. The detection steps are the same as those in Example 1. The tHcy concentrations of the 20 patient samples are measured by the enzyme cycle method (Table 2). The optical fiber sensor is used to test the 20 patient samples respectively, and the relative fluorescence signal change is calculated. The samples are divided into two groups A and B, each group containing 10 patient samples, and one optical fiber is used for each group. The samples are tested randomly, and each sample is tested three times. The tHcy concentrations of the samples and the fluorescence signal changes of the sensor are plotted Figure 6 . The results show that at the low concentration end (6.7-24.8 μM), there is a linear relationship between the percentage decrease in fluorescence signal and tHcy (y = 0.86x + 5.37, R 2 = 0.904); at the high concentration end (28.4-80.9 μM), there is also a linear relationship between the percentage decrease in fluorescence signal and tHcy (y = 0.28x + 16.26, R2 = 0.920). The results show that the concentration of tHcy tested by the method of the present application is in good agreement with the value measured by the enzyme cycling method.
[0055] Table 2. Patient serum samples
[0056]
[0057] Example 5. Accurate detection of tHcy in patient serum samples using optical fiber sensor
[0058] In the method for detecting total amount of methylated cysteine of the present application, both reduced Hcy and oxidized Hcy can bind to the nucleic acid aptamer immobilized on the optical fiber, but the affinity of the nucleic acid aptamer to reduced Hcy is much higher than that to oxidized Hcy. When the serum is diluted 1000 times for detection, the decrease in fluorescence signal value is caused by the competitive binding of reduced Hcy, oxidized Hcy, the complementary strand of the nucleic acid aptamer to the nucleic acid aptamer immobilized on the optical fiber, and the total concentration of reduced and oxidized Hcy, tHcy, can be detected according to the fluorescence signal value. Since the affinity of the nucleic acid aptamer to reduced Hcy is much higher than that to oxidized Hcy, theoretically, by adding TCEP to reduce part of the oxidized Hcy in the serum to free Hcy in the reduced state, the response value of the fluorescence signal can be increased, thereby improving the accuracy of detection. The response value of the fluorescence signal can be regulated by regulating the time of TCEP reduction reaction and the concentration of TCEP.
[0059] In order to verify whether the addition of TCEP can increase the signal response of the detection of patient real samples and further improve the accuracy of detection, TCEP was added to the patient serum to reduce part of the oxidized Hcy in the serum. Patient real serum samples were taken, 5 mM TCEP was added, mixed and allowed to stand for 1 h, then diluted 1000 times in buffer, and then mixed with 20 nM of the complementary strand of the Hcy nucleic acid aptamer labeled with the fluorescent group Cy 5.5, incubated, and then detected. The detection steps were the same as in Example 1. The tHcy concentrations of the 20 patient samples were measured by the enzyme cycling method. The optical fiber sensor was used to test the 20 patient samples respectively, and the relative fluorescence signal change was calculated. The test results of 10 patient samples (Group A) were plotted as a working curve (Figure 2). Figure 7 At the low concentration end (6.7-19.4 μM), the fluorescence signal reduction percentage was linearly related to tHcy (y = 0.85x + 19.9, R 2 = 0.969); at the high concentration end (20.8-80.9 μM), the fluorescence signal reduction percentage was also linearly related to tHcy (y = 0.29x + 35.1, R 2= 0.974). Using this working curve and the fluorescence signal change value, the tHcy concentration of other 10 patient samples (group B) was calculated (Table 3). The results showed that the tHcy concentration obtained according to this method was in good agreement with the value measured by the enzyme cycling method, with a high recovery rate (100.57 ± 8.06) and a small coefficient of variation (6.6 ± 2.7).
[0060] Table 3. Recovery rate and precision of the optical fiber sensor for testing tHcy in patient serum
[0061]
[0062]
[0063] [a] Mean ± standard deviation (n = 3).
[0064] Finally, it should be noted that the above examples are merely intended to illustrate the technical solutions of the present application, and are not intended to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should analyze and can modify or equivalently replace the technical solutions of the present application without departing from the essence and scope of the present application.
Claims
1. A method for detecting the total amount of methylated cysteine, characterized by, The evanescent wave optical fiber sensor is constructed by using the aptamer with high response to free Hcy and medium response to oxidized Hcy, and the sensor is based on a competitive detection mode. The fluorescently labeled complementary strand, reduced Hcy and oxidized Hcy compete with the aptamer fixed on the optical fiber for binding. The higher the concentration of reduced Hcy and oxidized Hcy is, the more aptamer fixed on the optical fiber binds to it, and the less aptamer binds to the fluorescently labeled complementary strand, and the lower the fluorescence response value is. The decrease in fluorescence signal is positively correlated with the concentration of tHcy in serum. The concentration of tHcy in serum is calculated according to the percentage of fluorescence reduction. In addition, the Tween 80 nanometer layer on the optical fiber interface in situ enriches Hcy, greatly improves the concentration of reduced Hcy and oxidized Hcy near the optical fiber interface, and further promotes the binding of the aptamer fixed on the optical fiber to the aptamer, so that the fluorescence response value is lower, and the detection sensitivity is higher. The mixture of serum and reducing agent tris(2-carboxyethyl) phosphine is diluted 1 thousand times in buffer, and then 20 nM of the complementary strand of the aptamer modified with Cy5.5 is added. The mixture is introduced into the optical fiber sensor through the following three steps: (1) pump in buffer for 30 seconds to clean the sample pipeline and optical fiber reaction pool to ensure the baseline is stable; (2) pump in the mixture of target and complementary strand for 20 seconds and keep for 180 seconds to determine the fluorescence signal in real time; (3) flush for 30 seconds by passing through 0.5% SDS, pH 1.9 washing buffer to flush away the complementary strand bound to the surface of the optical fiber. Repeat (1)-(3) to detect the next sample. The working curve is plotted with the concentration of tHcy as the abscissa and the percentage of relative fluorescence signal decrease as the ordinate. The tHcy in the real sample is detected by the method as described above. The concentration of tHcy is calculated by using the working curve according to the response value of the fluorescence signal.
2. A kit based on the method of detecting the total amount of methylated cysteine according to claim 1, characterized in that, It comprises the complementary sequence of the Hcy aptamer modified with the fluorescent group Cy5.5: 5'-GATGCCTGTGAA-Cy5.5-3', buffer, reducing agent tris(2-carboxyethyl) phosphine, and interface regeneration reagent 0.5% sodium dodecyl sulfonate, abbreviated as SDS, pH 1.9.
Citation Information
Patent Citations
Method for detecting methylated cysteine in serum
CN116148476A
Aptamer optical waveguide sensor and detection method using same
CN112400112A
Methods and compositions for assaying homocysteine
US20050009128A1