A molecular marker related to ascorbic acid content of tomato fruit and use thereof

By using molecular markers at 25bp nucleotide insertion/deletion sites and specific primer sets for PCR identification in tomato fruits, the problem of rapidly distinguishing ascorbic acid content in tomato fruits was solved, achieving efficient and accurate germplasm resource screening.

CN118910308BActive Publication Date: 2026-04-14HUAZHONG AGRI UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410991623.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-23
Publication Date
2026-04-14
Estimated Expiration
2044-07-23

AI Technical Summary

Technical Problem

Existing technologies fail to provide a rapid and accurate method for distinguishing the ascorbic acid content in tomato fruits, which affects the screening of tomato germplasm resources.

Method used

A molecular marker associated with ascorbic acid content in tomato fruit is provided. A 25bp nucleotide insertion/deletion site is used, and a specific primer set is designed for PCR amplification and electrophoresis identification to distinguish the genotype of tomato fruit.

Benefits of technology

It enables rapid and accurate identification of ascorbic acid content in tomato fruits, with a genotype detection result accuracy rate of up to 100%. It simplifies the operation, reduces costs, and is suitable for screening tomato germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118910308B_ABST
    Figure CN118910308B_ABST
Patent Text Reader

Abstract

The present application relates to the field of molecular biology, in particular to a kind of molecular marker related to the ascorbic acid content of tomato fruit development and its application, the present application is by screening the expression of ascorbic acid related gene-eGWAS data, identify a significant correlation with the ascorbic acid of tomato fruit structural variant (SV). The SV is located at the downstream 397bp of the rate-limiting enzyme GDP-L-galactose phosphorylase gene (GGP2, Solyc06g073320) of ascorbic acid synthesis pathway, it is a 25bp insertion / deletion at 42845487 of tomato chromosome 6. The present application further verifies the existence of the SV in resequencing tomato germplasm and develops molecular marker, and the results show that the molecular marker can be applied to the parent selection of high ascorbic acid tomato fruit selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker related to the ascorbic acid content in tomato fruit and its application. Background Technology

[0002] Tomatoes have a unique flavor and contain a large amount of flavor-enhancing nutrients, including sugars, acids, malic acid, and ascorbic acid. During long-term domestication and improvement processes, breeders have primarily focused on increasing economic traits such as tomato yield and resistance, neglecting the improvement of flavor and quality. Vitamin C plays a role in preventing scurvy and is therefore also known as ascorbic acid. As an antioxidant, ascorbic acid plays a crucial role in plant responses to biotic and abiotic stresses by regulating cell signaling pathways and acting as a cofactor in various physiological processes. Besides its important physiological and biochemical functions in plants, ascorbic acid is also an important nutrient that helps humans resist various diseases. Humans lack the gene for the final key enzyme in the ascorbic acid synthesis pathway and cannot produce ascorbic acid themselves, so they must obtain it from their diet. Tomatoes are rich in ascorbic acid and are widely enjoyed.

[0003] The D-mannose / L-galactose pathway is an important pathway for the synthesis of ascorbic acid in tomato fruits. The GDP-L-galactose phosphorylase encoded by the GGP gene is a key enzyme catalyzing the conversion of GDP-L-galactose to L-galactose-1-phosphate. Han Lei (2012) found that the expression level of the GGP gene was relatively high in the early stages of fruit development, but gradually decreased as the tomato fruit matured. Li Yan et al. (2021) found that after overexpressing the tomato's own GGP gene, the total ascorbic acid content in tomatoes at the color-breaking stage was significantly increased compared to the control material. However, after interfering with and inhibiting the tomato GGP gene, the total ascorbic acid content in tomato fruits was significantly decreased compared to the control, and the expression abundance of other genes in the D-mannose / L-galactose pathway, such as GMP, GME2, GPP1, and GPP2, was significantly altered. These research results suggest that the GGP gene, located upstream of the D-mannose / L-galactose pathway, may play a crucial role in the synthesis of ascorbic acid in tomatoes. Although there are many studies on the ascorbic acid content of tomato fruits, none of them provide a method to quickly identify and differentiate the levels of ascorbic acid in tomato fruits.

[0004] Therefore, there is an urgent need to provide a method that can distinguish the ascorbic acid content in tomato fruits to facilitate the screening of tomato germplasm resources. Summary of the Invention

[0005] In view of this, the present invention provides a molecular marker related to the ascorbic acid content of tomato fruit, which can quickly and accurately distinguish the ascorbic acid content of tomato fruit, thus facilitating the screening of tomato germplasm resources.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] One objective of this invention is to provide a molecular marker associated with ascorbic acid content in tomato fruit. The molecular marker is a 25bp nucleotide insertion / deletion at position 42845487 on chromosome 6 of tomato. When a 25bp insertion is present, the ascorbic acid content in the tomato fruit is low, and the genotype is SL. When the insertion is absent, the ascorbic acid content in the tomato fruit is high, and the genotype is SP. The nucleotide sequence of the molecular marker is: ATGCATGCTACAAAATATTAAAGTT.

[0008] The second objective of this invention is to provide a primer set for amplifying the aforementioned molecular markers.

[0009] In verifying the accuracy of the above molecular markers, the primer set used the following primers: forward primer: ATGTAATGTGGAGTTGGTGTGTG, and reverse primer: AAAAGAGTTGCGTGTTTATG A.

[0010] In the application of identifying tomato varieties, the primer set includes an inner primer set and an outer primer set. The inner primer set has the following components: forward primer Indel-Inside-F: TAGCACTTCCCTGCACAA ACT; reverse primer Indel-Inside-R: TCTGCAGTTTGTGCAACTTTAA; and outer primer set has the following components: forward primer Indel-Outside-F: GATGGTCTCAACACCCACAGTA; and reverse primer Indel-Outside-R: AATATTGGGACGGAGTAGAGTGTT.

[0011] The third objective of this invention is to provide an application of the above-mentioned molecular marker in identifying the ascorbic acid content of tomato fruits, the specific application of which is as follows:

[0012] Using the total DNA of the tomato to be tested as a template, PCR amplification and electrophoresis identification were performed using the primer set described above. When two bands of 669 bp (nucleotide sequence as shown in SEQ ID No. 2) and 475 bp (nucleotide sequence as shown in SEQ ID No. 3) appear simultaneously, the tomato genotype is SL. When two bands of 644 bp (nucleotide sequence as shown in SEQ ID No. 4) and 220 bp (nucleotide sequence as shown in SEQ ID No. 5) appear simultaneously, the tomato genotype is SP.

[0013] The nucleotide sequence SEQ ID No.2: GATGGTCTCAACACCCACAGT ACCATGGTTCCCGCCTAGGGTTTTCACGGCCCAGCTCTGGTGTTCATCGCATGTTATTATTTCATGAGTTTCCATCTCTAGCTGCCCTTGTGAAATATCACTTAAATAAGGCAAAACCATGTTCAATGTATTTGATGAAATCTGGTCTGTTCCTCTGTGAATTGAACCTTGTGTATTATTGCTTTTTTCTGGTATAAGCCATGTTCTATGTATATGTAATGTGGAGTTGGTGTGTGAAATGACCCATGTATGCTGTTTCTAATTAAGACAATACTAATATAAGTTTGATTTCCCTATTTATTCTCATCAAACTTTGTGCTTTTGATGTATAATTGCTTCCACTTGAATGACGATAGTGCTTTTGTGTATGTATTGGAGCGGGAAGTAGAATTATCACTCTTACTAGCACTTCCCTATGCATGCTACAAAATATTAAAGTTGCACAAACTGCAGACCAGGCTAAATATGTTACCCACTTGCAGAAGAAAACAAAATTTAGACTAAATTGTCTAAAAAGTTGTTCCCAAGGTTTGTAACAACTTAACTAAACCACTTATAAATGTTGTGTTAATCATAAACACGCAACTCTTTTAATTGAAATCAAAATACAACGAATAGAAAGATAAACACTCTACTCCGTCCCATATT。

[0014] The nucleotide sequence SEQ ID No.3: GATGGTCTCAACACCCACAGT ACCATGGTTCCCGCCTAGGGTTTTCACGGCCCAGCTCTGGTGTTCATCGCATGTTATTATTTCATGAGTTTCCATCTCTAGCTGCCCTTGTGAAATATCACTTAAATAAGGCAAAACCATGTTCAATGTATTTGATGAAATCTGGTCTGTTCCTCTGTGAATTGAACCTTGTGTATTATTGCTTTTTTCTGGTATAAGCCATGTTCTATGTATATGTAATGTGGAGTTGGTGTGTGAAATGACCCATGTATGCTGTTTCTAATTAAGACAATACTAATATAAGTTTGATTTCCCTATTTATTCTCATCAAACTTTGTGCTTTTGATGTATAATTGCTTCCACTTGAATGACGATAGTGCTTTTGTGTATGTATTGGAGCGGGAAGTAGAATTATCACTCTTACTAGCACTTCCCTATGCATGCTACAAAATATTAAAGTTGCACAAACTGCAGA。

[0015] The nucleotide sequence SEQ ID No.4: GATGGTCTCAACACCCACAGT ACCATGGTTCCCGCCTAGGGTTTTCACGGCCCAGCTCTGGTGTTCATCGCATGTTATTATTTCATGAGTTTCCATCTCTAGCTGCCCTTGTGAAATATCACTTAAATAAGGCAAAACCATGTTCAATGTATTTGATGAAATCTGGTCTGTTCCTCTGTGAATTGAACCTTGTGTATTATTGCTTTTTTCTGGTATAAGCCATGTTCTATGTATATGTAATGTGGAGTTGGTGTGTGAAATGACCCATGTATGCTGTTTCTAATTAAGACAATACTAATATAAGTTTGATTTCCCTATTTATTCTCATCAAACTTTGTGCTTTTGATGTATAATTGCTTCCACTTGAATGACGATAGTGCTTTTGTGTATGTATTGGAGCGGGAAGTAGAATTATCACTCTTACTAGCACTTCCCTGCACAAACTGCAGACCAGGCTAAATATGTTACCCACTTGCAGAAGAAAACAAAATTTAGACTAAATTGTCTAAAAAGTTGTTCCCAAGGTTTGTAACAACTTAACTAAACCACTTATAAATGTTGTGTTAATCATAAACACGCAACTCTTTTAATTGAAATCAAAATACAACGAATAGAAAGATAAACACTCTACTCCGTCCCATATT。

[0016] The nucleotide sequence SEQ ID No.5: TAGCACTTCCCTGCACAAACT GCAGACCAGGCTAAATATGTTACCCACTTGCAGAAGAAAACAAAATTTAGACTAAATTGTCTAAAAAGTTGTTCCCAAGGTTTGTAACAACTTAACTAAACCACTTATAAATGTTGTGTTAATCATAAACACGCAACTCTTTTAATTGAAATCAAAATACAACGAATAGAAAGATAAACACTCTACTCCGTCCCATATT。

[0017] Furthermore, the PCR reaction system described in the above application is as follows: 13 μL Taq Master buffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and H2O to bring the total to 25 μL.

[0018] The PCR amplification program is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 53.8~60℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, and a final extension at 72℃ for 5 min.

[0019] In some specific embodiments, preferably, the annealing temperature in the PCR amplification program is 59.2°C.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] (1) The molecular markers provided by this invention can quickly, efficiently and accurately identify the ascorbic acid content of tomato fruits. The results of genotype and gene detection were verified using 15 common commercial varieties and 4 wild tomato germplasms. The genotype and gene detection results were 100% consistent. It can be well applied to the screening of tomato germplasm resources and to distinguish the genotype of GGP2 in fruits of commercial varieties and breeding materials.

[0022] (2) The identification operation using ARMS-PCR is simple and only requires ordinary Taq enzyme, without the need for restriction endonuclease, thus the cost is low and the results can be obtained in 2-3 hours. In addition, through the exploration of annealing temperature and primer concentration ratio during amplification, the most suitable annealing temperature is found to be 53.8-60℃ and the optimal primer concentration ratio is 1:1:1:1, where the detection band is clearest and the results are more accurate. Attached Figure Description

[0023] Figure 1 The results of genome-wide association analysis of SV and gene expression levels.

[0024] Figure 2 The allele frequencies of SVs selected from the SP(P), SLC(C), heirloom(H), and modern(M) populations.

[0025] Figure 3 This is a graph showing the correlation between SV genotypes and gene expression levels.

[0026] Figure 4This is a graph showing the correlation between SV genotype and metabolite content.

[0027] Figure 5 This is a comparison of the sequencing results at this locus between two TS materials with extremely high ascorbic acid content from tomato fruits and four TS materials with extremely low ascorbic acid content from tomato fruits.

[0028] Figure 6 This is a population distribution map of ascorbic acid content in tomato fruits containing TS material.

[0029] Figure 7 The images show electrophoresis results of TS-181 and TS-189 at different annealing temperatures and different primer concentration ratios in Example 3 of this invention.

[0030] Figure 8 This is an electrophoresis image of 121 TS materials in Example 3 of the present invention at an annealing temperature of 59.2℃ and a primer concentration ratio of Indel-Outside-F:Indel-Outside-R:Indel-Inside-F:Indel-Inside-R of 1:1:1:1.

[0031] Figure 9 Electrophoresis images used to validate 15 commercial varieties.

[0032] Figure 10 Ascorbic acid content of 15 commercial tomato varieties and 4 high-Vc tomato inbred lines. Detailed Implementation

[0033] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.

[0034] Key experimental material sources and physicochemical parameters:

[0035] BWM-2, BWM-3, BWM-4, BWM-5, BWM-6, Youkang 28001, Provence, Lola, Jingfan 209, Pinfan 4925, Taomengxi, Fenbeibei, Zixia Fairy, Cuiqianxi, and Pinfan 5444 are all collected by domestic research institutes.

[0036] Example 1

[0037] This embodiment provides a method for obtaining molecular markers related to the ascorbic acid content of tomato fruits. The specific operation steps are as follows:

[0038] A total of 67 structural and regulatory genes related to tomato ascorbic acid metabolism were screened through literature review. The results of eGWAS were obtained by combining 71,684 structural variants (SVs) with transcriptome data from 305 tomato samples, referencing XinWang et al. Nature Communications (2020) 11:5817. Figure 1 A study found that 21 out of 67 vitamin C-related genes were associated with significant loci, including 12 genes associated with 12 cis loci. Genotypic analysis and correlation analysis between gene expression levels and metabolite content (Ye, et al. 2015) were performed on the associated cis loci. Figure 2-4 ), found at ch06_42845487 (Pvalue=3.78×10 ), -15 The SV (SV49680) of GGP2 can effectively distinguish the expression level of GGP2 (Solyc06g073320) and the ascorbic acid content in fruits in natural populations. Therefore, molecular markers were developed using the ascorbic acid-significantly associated variant site SV49680. The relevant software used included GEMMA, GraphPad Prism, and Excel 2023.

[0039] Example 2

[0040] This embodiment provides a method for detecting molecular markers related to the ascorbic acid content in tomato fruits. The specific operation steps are as follows:

[0041] S1. Among 122 natural population materials with confirmed genotypes and phenotypes, 90 materials showed a 25bp insertion at chromosome 642845487 of tomato, while 32 materials did not show a 25bp insertion at this locus. The P-value was 3.78 × 10⁻⁶. -15 Furthermore, the ascorbic acid content in tomato fruits with the 25bp insertion was significantly lower than that in fruits without the 25bp insertion (e.g., Figure 4 (As shown). From these natural population materials, materials with high ascorbic acid content, TS-223 and TS-181, and materials with low ascorbic acid content, TS-189 and TS-211 (e.g., ...). Figure 6 (As shown).

[0042] S2. PCR amplification and sequencing were performed using InDel detection primers F: ATGTAATGTGGAGTTGGTGTGTG, R: AAAAGAGTTGCGTGTTTATGA. The sequencing results were then compared. The PCR reaction mixture consisted of 13 μL Taq Masterbuffer, 1 μL DNA template, 1 μL each of forward and reverse primers, and H2O to a final volume of 25 μL. The PCR amplification program was: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, and a final extension at 72℃ for 5 min.

[0043] The results showed that no 25bp nucleotide sequence insertion was found in the selected TS materials with high ascorbic acid content, while a 25bp nucleotide sequence insertion was found in all selected TS materials with low ascorbic acid content in tomato fruits (e.g., Figure 5 (As shown). Therefore, this SV can be selected to develop molecular markers related to the ascorbic acid content in tomato fruits.

[0044] Example 3

[0045] This embodiment provides a method for identifying the ascorbic acid content in tomatoes using molecular markers related to the ascorbic acid content in tomato fruits. The specific steps are as follows:

[0046] (1) Primer design process

[0047] Based on the principles of ARMS-PCR and primer design, primers were designed using Primer 5.0. These primers include specific inner primers and common outer primers. The specific inner primers ensure their specific sites are located at the 3' end of the primer. They were synthesized by Qingke Biotechnology Co., Ltd. The specific primer sequences are as follows:

[0048] Indel-Outside-F:GATGGTCTCAACACCCACAGTA;

[0049] Indel-Outside-R:AATATGGGACGGAGTAGAGTGTT;

[0050] Indel-Inside-F:TAGCACTTCCCTGCACAAACT;

[0051] Indel-Inside-R:TCTGCAGTTGTGCAACTTTAA.

[0052] (2) Extraction of total DNA from the sample

[0053] Add 750 μL of CTAB solution to the sample and grind at 60 Hz for 90 s. After grinding, place in a water bath at 65 ℃ for 1-2 h. Add 750 μL of chloroform-isoamyl alcohol solution (chloroform:isoamyl alcohol volume ratio 24:1), invert 100 times, and centrifuge at 10000 rpm for 10 min. Take the supernatant, add 400 μL of isopropanol solution, and gently invert 20 times. Freeze at -20 ℃ for 10 min. After freezing, centrifuge at 10000 rpm for 5 min and discard the supernatant. Wash the precipitate with 75% alcohol, discard the alcohol, and place in a fume hood to allow the alcohol to evaporate completely. Add 50 μL of ddH2O to dissolve the DNA and store at -20 ℃ for later use.

[0054] (3) PCR amplification

[0055] To further investigate the effects of annealing temperature and primer concentration on the results during PCR, the following experiments were conducted using TS-189 and TS-181 from Example 2 as sample DNA templates:

[0056] Effects of annealing temperature and primer ratio on labeling detection performance

[0057] The PCR reaction system is as follows:

[0058] When the primer ratio is 1:1:1:1, the PCR reaction system includes 13 μL Taq Master buffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and H2O to bring the total to 25 μL.

[0059] When the primer ratio is 1:3:1:3, the PCR reaction system includes 13 μL Taq Master buffer, 1 μL DNA template, 0.5 μL Indel-Outside-F, 1.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O to bring the total to 25 μL.

[0060] When the primer ratio is 1:1:3:3, the PCR reaction system includes 13 μL Taq Master buffer, 1 μL DNA template, 0.5 μL Indel-Outside-F, 0.5 μL Indel-Outside-R, 1.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O to bring the total to 25 μL.

[0061] The PCR reaction conditions are as follows: The reaction solution is placed in a PCR instrument for amplification at a temperature gradient of 60℃-50℃, pre-denaturation at 94℃ for 3 min, denaturation at 94℃ for 30 s, annealing at 60℃~50℃ for 30 s, extension at 72℃ for 1 min, for 34 cycles, and finally extension at 72℃ for 5 min.

[0062] Agarose gel electrophoresis: Add 5 μL of PCR product to a 2% agarose gel and electrophorese at 150 V for 20 min. Observe the results on a gel imaging system (see attached image). Figure 7 (As shown).

[0063] Depend on Figure 7 The results showed that: the presence of a 669bp and a 475bp band indicated the SL genotype and the low ascorbic acid content phenotype in the fruit; the presence of a 644bp and a 220bp band indicated the SP genotype and the high ascorbic acid content phenotype in the fruit; and the presence of bands of 669bp, 475bp, 644bp, and 220bp indicated the heterozygous genotype. However, since the 669bp and 644bp bands were very similar in size, the presence of three bands in the gel imaging system indicated a heterozygous genotype.

[0064] When the primer ratio is 1:1:1:1 and the annealing temperatures are 60.0℃, 59.2℃, 58℃, 56.1℃, and 53.8℃, the amplified band sizes for TS-181 are 644bp and 220bp, and for TS-189 are 669bp and 475bp. Therefore, the primers are specific at these five annealing temperatures and can distinguish between DNA templates with genotypes SP and SL. When the annealing temperatures are 51.9℃, 50.7℃, and 50℃, the amplified band sizes for TS-181 are 644bp and 220bp, and for TS-189 are 669bp and 475bp, but the 669bp band is not significant. Therefore, the primers have weaker specificity at annealing temperatures of 51.9℃, 50.7℃, and 50℃.

[0065] When the primer concentration ratio is 1:3:1:3, there is almost no 220bp amplification band of TS-181 under this temperature gradient, so the specificity of this primer ratio is weak.

[0066] When the primer concentration ratio is 1:1:3:3, the 220bp band of TS-181 is almost non-existent at this temperature. The 644bp amplification band is not obvious at annealing temperatures of 53.8℃, 51.9℃, 50.7℃, and 50℃. Furthermore, the 475bp band of TS-189 is not obvious at this temperature gradient. Therefore, the specificity of this primer ratio is relatively weak.

[0067] Validation of the effects of annealing temperature and primer ratio on labeling detection effectiveness

[0068] To further verify the detection effect at an annealing temperature (59.2℃ selected from 53.8℃ to 60℃) and a primer concentration ratio of Indel-Outside-F:Indel-Outside-R:Indel-Inside-F:Indel-Inside-R of 1:1:1:1, ARMS-PCR amplification was performed using 122 TS materials from Example 2. The results are shown in [Figure 1]. Figure 8 .

[0069] Depend on Figure 8 The results showed that out of 122 DNA samples, 115 samples had ARMS-PCR amplified band sizes that matched the known genotypes from resequencing, while 7 samples had ARMS-PCR amplified band sizes that did not match the genotypes. Among these 7 discrepancies: 4 samples had the SP genotype, but amplified band sizes of 669 bp and 475 bp (SL genotype band sizes); 3 samples had the SL genotype, but amplified band sizes of 644 bp and 220 bp (SP band sizes). Therefore, the concordance rate between the band size and genotype amplified by ARMS-PCR using this primer was 94.26%, indicating that this molecular marker is feasible for detecting ascorbic acid content in tomato fruits.

[0070] Example 4

[0071] This embodiment uses commercial varieties and breeding varieties for relevant verification. The specific steps are as follows:

[0072] Fifteen commercial varieties (BWM-2, BWM-3, BWM-4, BWM-5, BWM-6, Youkang 28001, Provence, Lola, Jingfan 209, Pinfan 4925, Taomengxi, Fenbeibei, Zixiaxianzi, Cuiqianxi, Pinfan 5444) and four high-Vc tomato inbred lines (TS-50, TS-53, TS-56, TS-57) were selected. ARMS-PCR detection was performed using the molecular markers provided in Example 1, as described in Example 3. The detection results for the 15 commercial varieties and the four high-Vc tomato inbred lines are shown in [Figure 3]. Figure 8-10 .

[0073] Depend on Figure 2 , Figure 8-10The results show that, due to natural selection and domestication, modern large-fruited tomatoes, as well as commercial and breeding varieties, all have the SL genotype, and their ascorbic acid content is relatively low. However, germplasm resources with high ascorbic acid content exist in natural populations. Therefore, this molecular marker can be used to screen for germplasm with high ascorbic acid content in fruits within natural populations, broadening the range of parental selection and providing a pathway for breeding tomato varieties with high ascorbic acid content.

[0074] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0075] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of a molecular marker related to ascorbic acid content in tomato fruit in identifying ascorbic acid content in tomato fruit, characterized in that, The molecular marker is a 25 bp nucleotide insertion / deletion at position 42845487 on chromosome 6 of tomato, and the nucleotide sequence of the molecular marker is as follows: ATGCATGCTACAAAATATTAAAGTT; No 25bp nucleotide sequence insertion was found in materials with high ascorbic acid content in tomato fruits, while a 25bp nucleotide sequence insertion was found in materials with low ascorbic acid content in tomato fruits.

2. The application according to claim 1, characterized in that, The primer set for amplifying the molecular marker is as follows: The primer set includes the following primers: forward primer: ATGTAATGTGGAGTTGGTGTGTG, and reverse primer: AAAAGAGTTGCGTGTTTATGA.

3. The application according to claim 1, characterized in that, The primer set for amplifying the molecular marker includes an inner primer set and an outer primer set. The inner primer set has the following forward primers: Indel-Inside-F: TAGCACTTCCCTGCACAAACT and Indel-Inside-R: TCTGCAGTTTGTGCAACTTTAA. The outer primer set has the following forward primers: Indel-Outside-F: GATGGTCTCAACACCCACAGTA and Indel-Outside-R: AATATTGGGACGGAGTAGAGTGTT.

4. The application according to claim 3, characterized in that, The specific applications are as follows: Using the total DNA of the tomato to be tested as a template, PCR amplification and electrophoretic identification were performed using the primer set described in claim 3; When both bands of 669bp and 475bp are present, the tomato fruit shows low ascorbic acid content; when both bands of 644bp and 220bp are present, the tomato fruit shows high ascorbic acid content.

5. The application according to claim 4, characterized in that, The PCR reaction system consisted of 13 μL Taq Masterbuffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and H2O to bring the total to 25 μL. The PCR amplification program is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 53.8~60℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, and a final extension at 72℃ for 5 min.

6. The application according to claim 5, characterized in that, The annealing temperature in the PCR amplification program is 59.2℃.

Citation Information

Patent Citations

  • Molecular marker related to length of fruit stem of tomato fruit and application of molecular marker

    CN117512167A