Promoters for improving gene editing efficiency in dicot plants and applications thereof

By using the Arabidopsis thaliana promoter pAtEF1α to drive expression cassette combinations, the problem of low gene editing efficiency in dicotyledonous plants was solved, achieving efficient adenine and cytosine base editing and expanding the scope of applications.

CN118995713BActive Publication Date: 2026-05-08SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411289334.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-14
Publication Date
2026-05-08
Estimated Expiration
2044-09-14

AI Technical Summary

Technical Problem

In existing technologies, gene editing efficiency in dicotyledonous plants is low, especially when using common promoters such as p35S or pYao, it is difficult to achieve stable and heritable adenine base editing, and traditional meristem-specific promoters such as pAtRPS5A are difficult to apply widely.

Method used

The Arabidopsis promoter pAtEF1α was used to drive the expression of adenine base editing protein, cytosine base editing protein, Cas nuclease and guide RNA. An expression cassette combination was constructed and introduced into a recombinant vector to achieve efficient gene editing.

Benefits of technology

It improves the gene editing efficiency of dicotyledonous plants, especially the adenine base editing efficiency, with an average A>G editing efficiency 2.11 times that of traditional promoters. It is applicable to a variety of dicotyledonous plants such as Arabidopsis thaliana and tomato, achieving efficient cytosine base editing and gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995713B_ABST
    Figure CN118995713B_ABST
Patent Text Reader

Abstract

The present application relates to a promoter pAtEF1 alpha for improving gene editing efficiency of dicotyledon plants and application thereof, and belongs to the field of plant genetic engineering.The pAtEF1 alpha promoter can be used for expression of adenine base editing protein, cytosine base editing protein, Cas nuclease and gRNA.The present application further provides an expression cassette group containing the pAtEF1 alpha promoter and a recombinant vector containing the expression cassette group.The pAtEF1 alpha promoter can be widely applied to the fields of gene editing and base editing of dicotyledon plants, and has wide application in genetic improvement of dicotyledon crops such as tomato and biosynthesis of high-value metabolites.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to promoters for improving gene editing efficiency in dicotyledonous plants and their applications. Background Technology

[0002] Single nucleotide polymorphisms (SNPs) are a crucial factor in plant evolution under natural conditions, with alleles resulting from SNP variations conferring numerous important agricultural traits. Gene editing technology based on the CRISPR / Cas system relies on a single Cas nuclease and guide RNA to efficiently cleave target DNA, making it an important tool for gene function research and crop genetic improvement; however, it suffers from relatively low precision. Base editing technology, developed from CRISPR / Cas gene editing technology, can efficiently and precisely perform targeted base mutations in the genome without causing double-strand breaks, making it a powerful tool for the precise introduction of SNPs into the genome. Base editing technology mainly includes two types of base editing proteins: adenine base editing proteins (ABEs), typically composed of the nCas9-D10A nickase and an artificially evolved adenosine deaminase, capable of mutations from A to G; and cytosine base editing proteins (CBEs), generally composed of the nCas9-D10A nickase and a cytosine deaminase, capable of mutations from C to T.

[0003] In the field of dicotyledonous plants, the editing efficiency of single-base editing proteins, especially ABE, is greatly affected by promoter selection. Kang et al. found that using the common p35S or pYao promoter to drive the expression of ABE7.10 could hardly produce effective editing in transgenic Arabidopsis, but replacing the pAtRPS5A promoter could induce up to 85% A>G editing at the same target site (KANG BC, YUN JY, KIM ST, et al. Precision genome engineering through adenine baseediting in plants[J].Nat Plants,2018,4(7):427-431).

[0004] There are various promoters used for gene editing (ABE) in dicotyledonous plants. Using the conventional constitutive p35S or pAtUbi promoters to drive ABE easily results in numerous chimeric lines and makes it difficult to obtain plants with stable, heritable mutations. The meristematic-specific promoter pAtRPS5A, when paired with ABE, can effectively produce stable and heritable mutant plants; however, no similar promoters have been reported in China. Therefore, there is an urgent need for a domestically developed and controllable promoter for achieving efficient gene editing in dicotyledonous plants. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a promoter for improving the gene editing efficiency of dicotyledonous plants and its application. This promoter can be used to drive the expression of adenine base editing proteins, cytosine base editing proteins, Cas nucleases and guide RNAs. This promoter can be widely used in gene editing and base editing fields of dicotyledonous plants.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a promoter for improving the gene editing efficiency of dicotyledonous plants, the promoter being called pAtEF1α, wherein the promoter pAtEF1α is any one of the following:

[0008] a) The nucleotide sequence of the promoter pAtEF1α is shown in SEQ ID NO:1;

[0009] b) A polynucleotide molecule that has 75% or more identity with the nucleotide sequence defined in a) and has pAtEF1α promoter function; or,

[0010] c) A multinucleotide molecule that hybridizes to the nucleotide sequence defined in a) or b) and has the function of the pAtEF1α promoter.

[0011] In some embodiments, the promoter has 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% sequence identity with SEQ ID NO:1.

[0012] Secondly, the present invention provides an expression cassette assembly for adenine base editing in dicotyledonous plants, the expression cassette assembly comprising a first expression cassette and a second expression cassette, the first expression cassette being an adenine base editing protein expression cassette and the second expression cassette being a guide RNA expression cassette.

[0013] In some implementations, the first expression cassette is operatively linked by a nucleotide sequence of the promoter pAtEF1α to a multinucleotide coding sequence of an adenine base editing protein.

[0014] In some specific embodiments, the polynucleotide coding sequence of the adenine base editing protein is formed by fusing the nucleotide sequence of adenosine deaminase with the nucleotide sequence of nCas9-D10A from the 5' end to the 3' end. The nucleotide sequence of adenosine deaminase is shown in SEQ ID NO:3 from position 5,703 to position 6,254 from the 5' end, and the nucleotide sequence of nCas9-D10A is shown in SEQ ID NO:3 from position 6,351 to position 10,532 from the 5' end.

[0015] In some specific embodiments, the adenosine deaminase includes TadA-TadA7.10, TadA8e, TadA8s, TadA9, or TadA-TadA7.10, TadA8e, TadA8s, TadA9 carrying the V106W mutation. V106W indicates that the valine (V) at position 106 of the adenosine deaminase is replaced by tryptophan (W), which typically reduces the off-target activity of the adenosine deaminase.

[0016] In some specific implementations, the second expression box is obtained using any of the following connection methods:

[0017] a) The nucleotide sequence of the promoter pAtEF1α is operatively linked to a multinucleotide coding sequence of the tRNA-mediated guide RNA expression system, or a multinucleotide coding sequence of the binuclease-mediated guide RNA expression system, or a multinucleotide coding sequence of the Cys4-mediated guide RNA expression system; or,

[0018] b) Operable linking the guide RNA to a multinucleotide coding sequence via the AtU6-26 promoter or the AtU6-1 promoter.

[0019] Thirdly, the present invention provides an expression cassette set for cytosine base editing in dicotyledonous plants, the expression cassette set comprising a first expression cassette and a second expression cassette, the first expression cassette being a cytosine base editing protein expression cassette and the second expression cassette being a guide RNA expression cassette; and at least one of the two expression cassettes contains the promoter pAtEF1α.

[0020] In some specific embodiments, the cytosine base editing protein expression cassette includes a nucleotide sequence of a cytosine base editing protein, the sequence being formed by fusing the nucleotide sequences of cytidine deaminase, nCas9-D10A, and uracil glycosidase inhibitor UGI from the 5' end to the 3' end. The nucleotide sequence of cytidine deaminase is shown in SEQ ID NO:4 from position 1 to position 588 of the 5' end, the nucleotide sequence of nCas9-D10A is shown in SEQ ID NO:4 from position 637 to position 4,785 of the 5' end, and the nucleotide sequence of uracil glycosidase inhibitor UGI is shown in SEQ ID NO:4 from position 4,807 to position 5,088 of the 5' end.

[0021] In some specific implementations, the cytidine deaminase includes rAPOBEC1, PmCDA1, hAID, hAPOBEC3A, hAPOBEC3B, hAPOBEC3C, hAPOBEC3G, and AID10.

[0022] Fourthly, the present invention provides an expression cassette set for gene editing in dicotyledonous plants, the expression cassette set comprising a first expression cassette and a second expression cassette, wherein the first expression cassette is a Cas nuclease expression cassette, the second expression cassette is a guide RNA expression cassette, and at least one of the two expression cassettes contains the promoter pAtEF1α.

[0023] In some specific implementations, the Cas nucleases include SpCas9, SaCas9, ScCas9, LbCas12a, Cas12i, Cas12f, and variants SpCas9-NG, SpRY, SpG, and SaKKH.

[0024] In some specific embodiments, the adenine base editing protein, cytosine base editing protein, and Cas nuclease are further fused with at least one nuclear localization signal peptide at their respective N-terminus or C-terminus. Studies have shown that the nuclear localization sequence (NLS) can typically interact with nuclear delivery vectors, thereby enabling the target protein to be delivered into the cell nucleus. Generally, an NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the protein surface, but other types of NLS are also known. Non-limiting examples of NLS include amino acid sequences such as PKKKRKV or KRPAATKKAGQAKKKK.

[0025] It is important to note that during the preparation of the aforementioned expression cassette, various DNA fragments can be manipulated to provide DNA sequences that are in the correct orientation or within the correct reading frame. To achieve this, adaptors or linkers can be used to ligate the DNA fragments, or further manipulations can be performed to provide convenient restriction enzyme sites, etc.

[0026] Fifthly, the present invention provides a recombinant vector comprising the pAtEF1α promoter as described above.

[0027] In some specific embodiments, the recombinant vector provided by the present invention further comprises the aforementioned expression cassette combination for improving the efficiency of adenine base editing in dicotyledonous plants, which includes the promoter pAtEF1α.

[0028] In other specific embodiments, the recombinant vector provided by the present invention further comprises the aforementioned expression cassette assembly for cytosine base editing in dicotyledonous plants, which includes the promoter pAtEF1α.

[0029] In other specific embodiments, the recombinant vector provided by the present invention further comprises the aforementioned expression cassette assembly for gene editing in dicotyledonous plants, which includes the promoter pAtEF1α.

[0030] It should be noted that the recombinant vector provided by this invention may further include a selectable marker gene for selecting transformed cells or tissues. The selectable marker gene includes genes conferring antibiotic resistance or herbicide resistance. Suitable selectable marker genes include, but are not limited to: chloramphenicol resistance genes, hygromycin resistance genes, streptomycin resistance genes, zizomycin resistance genes, sulfonamide resistance genes, glyphosate resistance genes, and glufosinate resistance genes. The selectable marker gene may also be a red fluorescent protein gene, a cyan fluorescent protein gene, a yellow fluorescent protein gene, etc.

[0031] In some specific implementations, the recombinant vector provided by the present invention is expressed in dicotyledonous plants.

[0032] In some specific implementation plans, dicotyledonous plants include Arabidopsis thaliana, tomato, soybean, tobacco, potato, rapeseed, cotton, Chinese cabbage, poplar, rose, Chinese rose, peach, pear, plum, apple, and papaya.

[0033] In a sixth aspect, the present invention provides a method for targeted editing of plant genomes, wherein a recombinant vector containing the aforementioned expression cassette combination is introduced into a plant, ultimately causing changes in the plant gene sequence.

[0034] In some specific implementations, the method involves first constructing a recombinant vector by combining an adenine base editing expression cassette containing the promoter pAtEF1α, then introducing the recombinant vector into dicotyledonous plants such as Arabidopsis thaliana or tomato, and finally obtaining plants in which the adenine base at the target site undergoes A>G substitution.

[0035] In some other specific implementations, the method involves first constructing a recombinant vector by combining a cytosine base editing expression cassette containing the promoter pAtEF1α, then introducing the recombinant vector into dicotyledonous plants such as Arabidopsis thaliana, and finally obtaining plants in which the cytosine bases at the target site undergo C>T substitution.

[0036] In some other specific implementations, the method involves first constructing a recombinant vector by combining gene editing expression cassettes containing the promoter pAtEF1α, then introducing the recombinant vector into dicotyledonous plants, and finally obtaining plants in which small base insertions or deletions occur at the target sites.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] 1. This invention is the first to clone and utilize the Arabidopsis promoter pAtEF1α (SEQ ID NO:1);

[0039] 2. Compared to the traditional pAtRPS5A promoter, the ABE system driven by the pAtEF1α promoter has an average A>G base editing efficiency that is 2.11 times higher (55% vs. 26%) when editing the same multiple targets.

[0040] 3. The pAtEF1α promoter is also widely used for efficient A>G editing in other dicotyledonous plants such as tomatoes;

[0041] 4. The pAtEF1α promoter can be used to express tRNA-mediated multiplex guide RNA expression systems;

[0042] 5. The pAtEF1α promoter can also be used to achieve efficient cytosine base editing and gene editing. Attached Figure Description

[0043] Figure 1 A schematic diagram illustrating the efficient adenine base editing in transgenic Arabidopsis using the ABE system expressed by the pAtEF1α promoter (A and B represent schematic diagrams of binary vectors expressing the ABE system using pAtRPS5A and pAtEF1α respectively; C and D represent schematic diagrams of the detailed adenine base editing of three endogenous targets in transgenic Arabidopsis using the two systems respectively).

[0044] Figure 2A schematic diagram illustrating the efficient adenine base editing in transgenic tomatoes using the pAtEF1α promoter-driven ABE system (A is a schematic diagram of the pAtEF1α-driven ABE system expressed in a binary vector in tomatoes; B and C are schematic diagrams showing the detailed adenine base editing of two endogenous target sites in transgenic tomatoes by this system).

[0045] Figure 3 A schematic diagram illustrating the efficient use of the pAtEF1α promoter for cytosine base editing in transgenic plants (A represents a schematic diagram of the binary vector of the pAtEF1α-driven CBE system; B represents a schematic diagram showing the detailed cytosine base editing of three endogenous target sites in transgenic Arabidopsis thaliana by this system; C represents a schematic diagram showing the editing at the AtCER10 site of a representative homozygous C>T editing line).

[0046] Figure 4 This diagram illustrates how the pAtEF1α promoter can be used for efficient gene editing in transgenic plants (A represents a schematic diagram of the binary vector of the pAtEF1α-driven gene editing system; B represents a detailed schematic diagram of gene editing at three endogenous target sites in transgenic Arabidopsis thaliana; C represents a schematic diagram of the editing at the AtBAK1 site in a representative homozygous gene-editing line). Detailed Implementation

[0047] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. The terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods; and the experimental materials used, unless otherwise specified, are all obtainable through conventional commercial channels.

[0048] All primers used in the following examples were synthesized by the Guangzhou branch of Sangon Biotech (Shanghai) Co., Ltd., and all first-generation sequencing was performed by the Guangzhou branch of Beijing Qingke Biotechnology Co., Ltd.; 2×Phanta Max Master Mix high-fidelity DNA polymerase was purchased from Nanjing Novozymes Co., Ltd.; the ClonExpress II One Step Cloning Kit recombinase kit was purchased from Novozymes Co., Ltd. The pCAMBIA1300 binary vector used in the experiments was stored in our laboratory and could be commercially purchased from Shanghai Maokang Biotechnology Co., Ltd. (catalog number: MF3701-2UG). All endonucleases used in vector construction were purchased from New England Biotechnology (Beijing) Co., Ltd. High-throughput sequencing technology was performed by Beijing Novogene Co., Ltd. All methods were performed according to the supplier's recommended usage instructions.

[0049] Example 1: Evaluation of the editing activity of the pAtEF1α promoter-driven ABE system in transgenic Arabidopsis thaliana.

[0050] 1. Construction of the pAtEF1α promoter-driven ABE system

[0051] 1.1 Cloning of the pAtEF1α promoter

[0052] The pAtEF1α promoter sequence (SEQ ID NO: 1) was cloned using the first 2,005 bp of the AtEF1α gene (AT5G60390) as the pAtEF1α promoter. Using self-designed specific primers 1 and 2 and 2×Phanta Max Master Mix high-fidelity DNA polymerase, the pAtEF1α promoter sequence was cloned using the Arabidopsis thaliana Col-0 genome as a template.

[0053] Primer 1 (5'-3'): CTAGACTAGGCAATATTTTCATGTCA (SEQ ID NO: 6);

[0054] Primer 2 (5'-3'): AGCTGTCAAAACAAAAACAAAAATC (SEQ ID NO: 7);

[0055] 1.2 Construction of adenine base editing binary vector

[0056] To rigorously compare the activity of the pAtEF1α promoter and the pAtRPS5A promoter in driving the ABE expression system to edit endogenous plant targets, the same ABE and the same gRNA expression system must be used. The specific steps are as follows:

[0057] First, the binary vector for expressing the pAtEF1α ABE system was constructed: This was achieved through the commercial synthesis of a vector by Sangon Biotech (Shanghai) Co., Ltd. Figure 1 The T-DNA vector sequence shown in B is the binary vector for obtaining the pAtEF1α expression ABE system, and its nucleotide sequence is shown in SEQ ID NO:3. Figure 1As shown in Figure B, the binary vector comprises a first expression cassette and a second expression cassette. The first expression cassette is an adenine base editing protein expression cassette, including the pAtEF1α promoter, the ABE8e-V106W expression cassette (i.e., the adenine base editing protein expression cassette, including the V106W mutant TadA8e (TadA8e-V106W) and nCas9-D10A), the E9t terminator, p2*35S, and HygR elements, and is driven by the pAtEF1α promoter to express the ABE8e-V106W expression cassette. The second expression cassette is a guide RNA expression cassette, which is the expression cassette of a tRNA-mediated multiple guide RNA expression system targeting three plant endogenous AtCER10, AtBAK1, and AtFLC, driven by the pAtEF1α promoter. The two pAtEF1α promoters independently drive either the ABE8e-V106W expression cassette or the tRNA-mediated multiple guide RNA expression system expression cassette.

[0058] The nucleotide sequence of the adenine base editing expression frame of the first expression cassette in this embodiment is shown in SEQ ID NO:3 from position 5,703 to position 10,532 from the 5' end;

[0059] The promoter of the second expression box in this embodiment can also be the AtU6-26 promoter;

[0060] The expression cassette of the second expression cassette in this embodiment can also be a binuclease-mediated guide RNA expression system; the expression cassette of the second expression cassette in this embodiment can also be a Cys4-mediated guide RNA expression system.

[0061] 2. Construction of a binary vector expressing the ABE system via the promoter pAtRPS5A

[0062] Cloning of the 2.1pAtRPS5A promoter

[0063] Reference (TSUTSUI H, HIGASHIYAMA T. pKAMA-ITACHI vectors for highly efficient CRISPR / Cas9-mediated gene knockout in Arabidopsis thaliana[J]. Plant & cell physiology, 2017, 58(1):46-56.) shows that the pAtRPS5A promoter sequence (SEQ ID NO:2) was amplified from the Arabidopsis genome using the same method as in step 1.1.

[0064] 2.2 Construction of a binary vector expressing the ABE system via the promoter pAtEF1α

[0065] The two pAtEF 1α promoters in the binary vector of the pAtEF1α expression ABE system obtained in step 1.2 above were replaced one by one with the pAtRPS5A promoter through simple enzyme digestion and ligation, thereby obtaining the following... Figure 1 The pAtRPS5A binary vector shown in Figure A expresses the ABE system.

[0066] In this embodiment, the gRNA target sequence information (5'-3') is as follows:

[0067] AtCER10: ACCGAATCGGGGAGGTCAAGGGG (SEQ ID NO: 8);

[0068] AtBAK1: TAGTCAACGGTCAGCGATCTCGG (SEQ ID NO: 9);

[0069] AtFLC: TGACATGCAATTTTTTTCCAAGG (SEQ ID NO: 10).

[0070] 3. Genetic transformation in Arabidopsis thaliana

[0071] The constructed binary vectors were transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and Arabidopsis thaliana plants were then transformed using the pollen tube introduction method. Specifically, GV3101 bacterial suspension containing the target vector was inoculated at a ratio of 1:100 into liquid LB medium containing kanamycin (50 mg / L) and cultured for 2 days at 28°C and 220 rpm. 5000g of bacterial cells were collected, the medium was discarded, and the cells were resuspended in a 5% sucrose solution containing 0.05% Silwet L77. Flowering Arabidopsis thaliana plants were taken, inverted to completely immerse the inflorescence in the Agrobacterium bacterial suspension, gently stirred for about 10 seconds, and then placed in a humid, dark environment for 1 day before being transferred to a normal growth environment until mature seeds were harvested.

[0072] 4. Screening and genotyping of transgenic positive lines

[0073] The mature seeds obtained above were sown under sterile conditions on a sterile 1 / 2 MS medium containing 50 mg / L hygromycin B. In solid culture medium. After about 10 days, the rooted hygromycin-positive seedlings were transferred to soil for recovery culture. Half a month later, the leaf genome of the transgenic positive seedlings was extracted using a rapid plant genomic DNA extraction system purchased from Tiangen Biotech (Beijing) Co., Ltd. Target gene-specific primers were designed for PCR, and high-throughput genotyping of the transgenic seedlings was performed using the Hi-TOM method (after obtaining the sequencing data, the sequencing data can be uploaded to the Hi-TOM online analysis website (http: / / www.hi-tom.net / hi-tom / ) to obtain detailed mutation sequences and corresponding genotype information for each sample and each locus). The high-throughput sequencing primer information for the three target sites is as follows: AtCER10-F (5'-3'):

[0074] GGAGTGAGTACGGTGTGCAATTTCCTCATCTGGGTCTTCC (SEQ ID NO: 11); AtCER10-R (5'-3'):

[0075] GAGTTGGATGCTGGATGGACCTTCAATCACATTTTGGAAACA (SEQ ID NO: 12);

[0076] AtBAK1-F(5'-3'):

[0077] GGAGTGAGTACGGTGTGCGGAAATATCTTCTTCCTCCTTTCG (SEQ ID NO: 13);

[0078] AtBAK1-R(5'-3'):

[0079] GAGTTGGATGCTGGATGGGTATCCACCCGTTGACTTAATTTG (SEQ ID NO: 14);

[0080] AtFLC-F(5'-3'):

[0081] GGAGTGAGTACGGTGTGCAATGTCGTGAAGAAGCTTTTTAGC (SEQ ID NO: 15);

[0082] AtFLC-R(5'-3'):

[0083] GAGTTGGATGCTGGATGGTAAGGAATCTCTAAAGGTAAGAAACAATCA (SEQ ID NO: 16).

[0084] 5. Results:

[0085] Analysis of adenine base editing at three endogenous targets in transgenic Arabidopsis showed that the A>G editing efficiency of the pAtEF1α-expressing ABE system comprehensively exceeded that of the pAtRPS5A-driven ABE system. Figure 1 C), the average editing efficiency of the former is approximately 2.1 times that of the latter. Figure 1 D, and for each editable A base at all target sites, the former showed a significant improvement in editing efficiency compared to the latter. Figure 1 D). The results of this embodiment fully demonstrate that the pAtEF1α promoter provided by the present invention can effectively improve the adenine base editing efficiency in Arabidopsis thaliana (compared to the traditional pAtRPS5A promoter).

[0086] Example 2: Evaluation of the editing activity of the pAtEF1α promoter-driven ABE system in transgenic tomatoes

[0087] 1. Construction of a binary vector for editing tomato adenine bases

[0088] Will as Figure 1 In the binary vector shown in B, the gRNA expression cassette was replaced with a nucleotide fragment encoding gRNA containing multiple endogenous targets in tomato through simple enzyme digestion and ligation, thus constructing a binary vector for editing tomato genes using the pAtEF1α-driven ABE system. Figure 2 A).

[0089] The gRNA target sequence information (5'-3') is as follows:

[0090] SlLin5: CAAGTATGGCTAAAACCTTAGTGG (SEQ ID NO: 17);

[0091] SlMYB12: TTCGAAGGGATTATTGAGATGCGG (SEQ ID NO: 18);

[0092] 2. Genetic transformation of tomatoes

[0093] Referring to the "Arabidopsis genetic transformation" method in Example 1, the aforementioned binary vector was introduced into Agrobacterium GV 3101, and Wuhan Boyuan Biotechnology Co., Ltd. was commissioned to create transgenic tomatoes.

[0094] 3. Identification of base-edited tomatoes was carried out in accordance with the method described in Example 1, "Screening of transgenic positive lines and identification of genotypes".

[0095] 4. Results

[0096] Analysis of adenine base editing at two endogenous targets, SlLin5 and SlMYB12, in transgenic tomatoes revealed that the pAtEF1α promoter-driven ABE system can efficiently achieve A>G editing in transgenic tomatoes, with editing efficiencies of 97.3% and 83.8%, respectively. Figure 2 B). Further analysis shows that ( Figure 2 C) This system also expands the editing window of ABE8e-V106W in tomato to a certain extent, to approximately A3-A12 (positions 21-23 in NGG). These results indicate that the pAtEF1α promoter can be used for efficient adenine base editing in transgenic tomatoes, suggesting that the activity of this promoter has a broad spectrum in dicotyledonous plants.

[0097] Example 3: Evaluation of the editing activity of the pAtEF1α promoter-driven CBE system in transgenic Arabidopsis thaliana.

[0098] 1. Construction of a binary carrier for a CBE system driven by the pAtEF1α promoter

[0099] Will Figure 1 The adenine base editing expression cassette of the binary vector shown in B (i.e., the ABE8e-V106W expression cassette, including TadA8e-V106W and nCas9-D10A, the sequence of which is shown in SEQ ID NO:3 from position 5,703 to position 10,532 of the 5' end) was replaced by a simple enzyme digestion and ligation with the cytosine base editing protein expression cassette of the CBE system (i.e., AID10-nCas9-D10A-UGI, the sequence of which is shown in SEQ ID NO:4); This yielded the following results: Figure 3 A shows the binary editing vector of the CBE system. The AID10-nCas9-D10A-UGI system has been publicly published by the applicant team (XIONG X, LI Z, LIANG J, et al. A cytosine baseeditor toolkit with varying activity windows and target scopes for versatile gene manipulation in plants[J]. Nucleic Acids Res,2022,50(6):3565-3580.).

[0100] 2. Genetic transformation of Arabidopsis thaliana, screening of transgenic positive lines, and identification of genotypes.

[0101] Perform the same method as described in Example 1.

[0102] 3. Results

[0103] To expand the versatility of the pAtEF1α promoter, construct as follows: Figure 3 A shows a CBE expression vector driven by the pAtEF1α promoter. Transgenic Arabidopsis thaliana was created using this vector via Agrobacterium-mediated genetic transformation. Genotyping results indicated that pAtEF1α can be used for highly efficient cytosine base editing in the dicotyledonous plant Arabidopsis thaliana, achieving up to 44.7% C>T targeted editing. Figure 3 B), and can directly obtain homozygous base-edited plants ( Figure 3 C).

[0104] Example 4: Activity assessment of the pAtEF1α promoter-driven Cas9 gene editing system in transgenic plants

[0105] Construction of a binary vector for the Cas9 gene editing system driven by the 1pAtEF1α promoter

[0106] Will Figure 1 The ABE8e-V106W expression cassette of the binary vector shown in B was replaced with Cas9 nuclease (SEQ ID NO:5) after simple enzyme digestion and ligation. Specifically, the ABE8e-V106W polynucleotide coding sequence shown in SEQ ID NO:3 from position 5,703 to position 10,532 of the 5' end was replaced with the sequence SEQ ID NO:5; This yielded the following result: Figure 4 Gene editing vector shown in A.

[0107] 2. Genetic transformation of Arabidopsis thaliana, screening of transgenic positive lines and identification of genotypes

[0108] Perform the same method as described in Example 1.

[0109] 3 Results

[0110] To further investigate whether the pAtEF1α promoter can be used for Cas9 gene editing, a model was constructed as follows: Figure 4 A shows a Cas9 expression vector driven by the pAtEF1α promoter. Transgenic Arabidopsis thaliana was created using this vector via Agrobacterium-mediated genetic transformation. Genotyping of the transgenic positive plants showed that the pAtEF1α promoter is also suitable for efficient gene editing in the dicotyledonous plant Arabidopsis thaliana, achieving effective gene editing in up to 93.2% of the transgenic plants. Figure 4 B), and can directly obtain homozygous mutant lines ( Figure 4 C).

[0111] All the above examples demonstrate that the pAtEF1α promoter can be used to achieve efficient adenine base editing, cytosine base editing, and gene editing in dicotyledonous plants.

[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A promoter for improving gene editing efficiency in dicotyledonous plants, characterized in that, The promoter is called pAtEF1α, and the nucleotide sequence of the promoter pAtEF1α is shown in SEQ ID NO:

1.

2. An expression cassette assembly for improving gene editing efficiency in dicotyledonous plants, characterized in that, The expression cassette assembly includes a first expression cassette and a second expression cassette, wherein the first expression cassette is an adenine base editing protein expression cassette, and wherein the first expression cassette contains the pAtEF1α promoter sequence as described in claim 1; and the second expression cassette is a guide RNA expression cassette.

3. The expression box assembly according to claim 2, characterized in that, The pAtEF1α promoter nucleotide sequence in the first expression cassette is operatively linked to the multinucleotide coding sequences of the adenine base editing protein expression cassette, the E9t terminator, the p2*35S, and the HygR element in sequence. The adenine base editing protein expression cassette is formed by fusing adenosine deaminase with the nucleotide sequence of nCas9-D10A from the 5' end to the 3' end; The adenosine deaminase is any one of TadA8e, TadA8s, or TadA8e or TadA8s carrying the V106W mutation.

4. The expression box assembly according to claim 2, characterized in that, The second expression box is obtained through any of the following connection methods: a) The nucleotide sequence of the promoter pAtEF1α as described in claim 1 is operatively linked to a multinucleotide coding sequence of a tRNA-mediated guide RNA expression system, or a dinucleotide coding sequence of a binuclease-mediated guide RNA expression system, or a multinucleotide coding sequence of a Cys4-mediated guide RNA expression system; or, b) The nucleotide sequence of the AtU6-26 promoter or the AtU6-1 promoter is operatively linked to the multinucleotide coding sequence of the guide RNA.

5. An expression cassette assembly for cytosine base editing in dicotyledonous plants, characterized in that, The expression cassette assembly includes a first expression cassette and a second expression cassette, wherein the first expression cassette is a cytosine base editing protein expression cassette and the second expression cassette is a guide RNA expression cassette; and at least one of the two expression cassettes contains the promoter pAtEF1α as described in claim 1; The cytosine base editing protein expression cassette is composed of nucleotides of the following elements operably linked together in sequence: The promoter pAtEF1α, cytosine base editing protein expression cassette, E9t terminator, p2*35S and HygR element as described in claim 1; The cytosine base editing protein expression cassette consists of the nucleotide sequences of cytidine deaminase, nCas9-D10A, and uracil glycosidase inhibitor UGI. The cytidine deaminase is AID10.

6. An expression cassette assembly for gene editing in dicotyledonous plants, characterized in that, The expression cassette set includes a first expression cassette and a second expression cassette, wherein the first expression cassette is a Cas nuclease expression cassette and the second expression cassette is a guide RNA expression cassette; at least one of the two expression cassettes contains the promoter pAtEF1α as described in claim 1; The Cas nuclease is SpCas9, SaCas9, or ScCas9.

7. A recombinant vector, characterized in that, The recombinant vector comprises the expression cassette combination as described in any one of claims 2-6.

8. The application of the recombinant vector according to claim 7 in gene editing of dicotyledonous plants, characterized in that, The dicotyledonous plant is Arabidopsis thaliana or tomato.

9. A method for targeted editing of plant genomes, characterized in that, Includes the step of introducing the recombinant vector of claim 7 into a plant.

Citation Information

Patent Citations

  • Nucleotide sequence and corresponding polypeptide for endowing plant with adjusted growth velocity and biomass

    CN101370938A