Moso bamboo PeSND1 gene, application thereof and plant vector

Abstract

The invention discloses a phyllostachys pubescens PeSND1 gene, application thereof and a plant vector, belongs to the technical field of plant molecular biology, and comprises a protein consisting of a nucleotide sequence SEQ ID NO.1 and an amino acid sequence SEQ ID NO.2 in a sequence table. The invention provides a moso bamboo PeSND1 gene for regulating and controlling secondary cell wall components as well as an encoding protein and application of the moso bamboo PeSND1 gene. The PeSND1 gene overexpression vector is transferred into wild dendrocalamus latiflorus through an agrobacterium-mediated method, and the result shows that compared with a wild strain, the stem diameter, the cell wall thickness, the lignin content and the cellulose content of an overexpression strain are obviously changed. The result provides a theoretical basis for research on bamboo secondary cell wall component regulation and control.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, in particular to a bamboo PeSND1 gene and an application thereof, and a plant vector. Background Art

[0002] Phyllostachys sedulis is a perennial evergreen plant of the genus Phyllostachys in the Poaceae family. It is the most widely planted, distributed and applied economic bamboo species in my country. As a large scattered bamboo species, Phyllostachys sedulis plays an important role in maintaining ecology and wood safety. Cell wall biosynthesis is the key to determining wood properties. Cell wall components (cellulose, hemicellulose and lignin) are deposited in specific cell secondary walls, affecting wood properties and the efficient utilization of wood fiber organisms. At present, there is still a lack of comprehensive understanding of bamboo cell wall biosynthesis and regulation. Exploring the key genes that regulate the synthesis of bamboo cell wall components and using biotechnology and other means to obtain new materials with improved wood properties will greatly improve its utilization value.

[0003] Previous studies have shown that the regulation of plant secondary cell wall biosynthesis involves a complex regulatory network of multiple transcription factor families, small RNAs, and structural genes. Plants have specific transcriptional switches that regulate secondary cell walls, and multiple transcription factors (such as NAC, MYB) participate in the formation of secondary cell walls by regulating the synthesis of secondary cell wall components (such as cellulose, hemicellulose, and lignin). The NST- and SND-subgroup transcription factors in the Arabidopsis NAC family were found to act as transcriptional switch factors, regulating the synthesis of secondary cell walls in vascular tissue vascular cells and fiber cells, respectively. The first type of VND (vascular-related NACdomain) gene family VND1-7 is believed to be involved in vascular cell development. The second type includes

[0004] NST3 / SND1 (NACsecondarywallthickeningpromotingfactor3 / secondarywall-associatedNACdomainprotein1), NST1 and NST2, are involved in initiating the thickening of the secondary wall of intervascular fiber cells and xylem fiber cells. The first layer of the multi-level regulatory network for wood formation in poplars includes PtrSND1-B1 and its subfamily members PtrSND1-A1, PtrSND1-A2, and PtrSND1-B2. Rice OsSWN1 is a homologous gene of SND1, which is involved in regulating the synthesis of rice secondary cell walls and affects the content of lignin in biological tissues.

[0005] The transcription factors that have been published so far that regulate plant cell wall synthesis are mostly genes such as SND1 in model plants such as Arabidopsis thaliana and poplar, while the function of the SND1 gene in bamboo has not yet been reported. Summary of the invention

[0006] The object of the present invention is to provide a bamboo PeSND1 gene and its application and plant vector to solve the problems raised in the above background technology.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] A bamboo PeSND1 gene comprises a nucleotide sequence of SEQ ID NO.1 and a protein composed of an amino acid sequence of SEQ ID NO.2 in a sequence table.

[0009] As a further embodiment of the present invention: wherein the PeSND1 nucleotide sequence is as shown in SEQ ID NO.1.

[0010] As a further solution of the present invention: wherein, the moso bamboo secondary cell wall component regulatory gene PeSND1 is used in regulating the content of secondary cell wall components of latifolia bamboo including lignin cellulose.

[0011] A plant vector, comprising a pCAMBIA1300-PeSND1 plant expression vector in which a multiple cloning site region is sequentially connected to a 35S promoter, a PeSND1 gene, a flag tag and a terminator. As a further embodiment of the present invention: wherein,

[0012] As a further embodiment of the present invention, the vector comprises a host bacterium that overexpresses the vector.

[0013] As a further scheme of the present invention: wherein, the primer pair used to clone the bamboo secondary cell wall component regulatory gene PeSND1 comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a bamboo PeSND1 gene for regulating secondary cell wall components, its encoded protein and application. The PeSND1 gene overexpression vector was transferred into wild-type bamboo by Agrobacterium-mediated method, and the results showed that the stem diameter, cell wall thickness, lignin and cellulose content of the overexpression strain were significantly changed compared with the wild-type strain. The results provide a theoretical basis for studying the regulation of bamboo secondary cell wall components. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is an amino acid comparison diagram of the conserved domain of the protein encoded by the PeSND1 gene of the present invention.

[0017] Figure 2 This is a bar graph showing the analysis results of the expression pattern of the PeSND1 gene of the present invention in different lignified tissues.

[0018] Figure 3 This is the in situ hybridization diagram of the PeSND1 gene of the present invention.

[0019] Figure 4 Schematic diagram of the vector of the present invention.

[0020] Figure 5 This is a graph showing PCR identification of the PeSND1 gene overexpressing plant and detection of PeSND1 gene expression level in the present invention.

[0021] Figure 6 The figures are the phenotypes of the PeSND1 gene overexpressing plants and wild-type plants of the present invention, lignin staining of stem cross sections and transmission electron microscopy images.

[0022] Figure 7 It is a bar graph of stem diameter, cell wall thickness, lignin and cellulose content of the PeSND1 gene overexpressing plants and wild-type plants of the present invention. DETAILED DESCRIPTION

[0023] See also Figures 1 to 7 : The embodiments of the present invention are described in detail below. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0024] Example 1

[0025] The present invention discloses a bamboo secondary cell wall component regulatory gene PeSND1, wherein the bamboo secondary cell wall component regulatory gene PeSND1 has a nucleotide sequence as shown in SEQ ID NO.1, and a protein encoded by the bamboo secondary cell wall component regulatory gene PeSND1 is a protein composed of the amino acid sequence of SEQ ID NO.2 in the sequence table; and the bamboo secondary cell wall component regulatory gene PeSND1 is used in regulating the content of secondary cell wall components of latifolia bamboo, including lignin cellulose.

[0026] The invention provides a plant overexpression vector, which is a pCAMBIA1300-PeSND1 plant expression vector in which a 35S promoter, the PeSND1 gene, a flag tag and a terminator are sequentially connected in a multiple cloning site region.

[0027] The present invention contains a host fungus of the plant overexpression vector and a primer pair for cloning the bamboo secondary cell wall component regulatory gene PeSND1. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0028] A genetically engineered host cell, the host cell contains the plant overexpression vector, or the exogenous PeSND1 sequence of the bamboo secondary cell wall component regulatory gene is integrated into its genome. The specific steps are as follows:

[0029] 1. Materials

[0030] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0031] 2. Methods

[0032] 2.1 Analysis of protein sequences encoded by PeSND1 gene in Phyllostachys pubescens

[0033] The PeSND1 gene was searched using the bamboo database, and the corresponding protein sequence (SEQ ID NO.2) was found. According to the characteristics of the PeSND1 gene, the PeSND1 protein sequence domain was analyzed, and the NOapical meristem (NAM) ( Figure 1 ) domain.

[0034] 2.2 Analysis of PeSND1 gene expression pattern

[0035] 2.2.1 Detection of the relative expression of PeSND1 gene in different parts of bamboo shoots by real-time fluorescence quantitative method

[0036] According to the lignification law in the development process of bamboo shoots, that is, the lower internodes lignify first, and the upper part of the same internode lignifies first, 2.5-meter-high bamboo shoots were selected, and the 22nd section (about 3 cm), 18th section (about 7 cm, divided into upper and lower parts), and 13th section (about 15 cm, divided into upper, middle and lower parts) were taken from top to bottom. They were named S1 to S6, quickly frozen in liquid nitrogen, and then frozen in a -80°C refrigerator for later RNA extraction.

[0037] The RNA extraction procedure was based on the Tiangen Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441), and the RNA was reverse transcribed into the first strand of cDNA using the Takara Reverse Transcription Kit. The fluorescent quantitative PCR primers used TIP41 (F: 5′-AAAATCATTGTAGGCCATTGTCG-3′; R: 5′-ACTAAATTAAGCCAGCGGGAGTG-3′) as the internal reference gene, and the quantitative reaction used the Takara quantitative kit. The reaction system was 20 μL, each component was 10 μL of dye mixture, 2 μL of cDNA template, 0.4 μL of each upstream and downstream primer (10 μmol / L), and finally filled with deionized water to 20 μL. The PCR reaction parameters were as follows: 95°C, 3 min; 95°C, 10 s; 60°C, 31 min, a total of 40 cycles. The data were processed using the 2–ΔΔCT method.

[0038] The primer sequences are:

[0039] PeSND1-F-1: 5′-CCAAGAGCTTTGCAGGATCG-3′

[0040] PeSND1-R-1: 5′-GCGGCCTTTGTAGAAGACGA-3′

[0041] Each experiment was repeated three times, and the experimental operation was repeated at least three times. The results are shown in Figure 2 As shown in the figure, during the lignification process of bamboo shoots, the expression level of PeSND1 gene increased with the increase of lignification degree.

[0042] 2.2.2 In situ expression of PeSND1 in bamboo stems

[0043] According to the DIG-RNA labeling kit (Roche, Switzerland), DIG-labeled sense probe and antisense probe were synthesized. The sense probe was the experimental group, and the antisense probe was the negative control group. The probe sequences were:

[0044] AGAGCTTTGCAGGATCGGGTCGGGGCCTCAGAACGACTGGTACTTCTTCAGCCACAAGGACAAGAAGTATCCGACGGGGACGCGGACGAACCGTGCGACGGCGGCCGGATTCTGGAAGGCGACGGGGCGCGACAAGGCCATCTTCACCA

[0045] According to the PeSND1 gene expression in 2.2.1, sample S4 was selected for FAA fixation. After paraffin embedding, the wax block was sliced ​​into 7 μm slices using a microtome. The slides were placed in a 37-degree oven overnight, dewaxed with xylene, and dehydrated with ethanol gradient. The slides were digested in 1ug / ml proteinase K at 37 degrees for 30 minutes, and rinsed with 1XPBS 3 times, 5 minutes each time. Take an appropriate amount of 37-degree preheated DIG-EASY-HYB buffer to soak the slides for 30 minutes, remove the slides, and add DIG-EASY-HYB buffer with probes for soaking. The probe concentration is about 10-50pg / ml. Place at 42 degrees for about 18 hours. Rinse the slides twice with 2XSSC at room temperature, and rinse the slides twice with 0.5XSSC at 65 degrees at room temperature, 30 minutes each time. Rinse the slide with washing buffer for 5 minutes, incubate in biocking solution for 2 hours, incubate in antibody solution at 37 degrees for 2 hours (or overnight at 4 degrees), wash twice with washing buffer for 15 minutes each time, and balance in detection buffer for 5 minutes. Incubate the slide in substrate colorimetric solution in the dark. After the purple color appears, rinse with TE buffer and take a picture. The results are as follows: Figure 3 The results showed that the vascular bundle sheath of bamboo stems showed a darker purple signal, indicating that the PeSND1 gene was specifically expressed in the vascular bundle sheath cells.

[0046] 2.3 Cloning of the PeSND1 protein coding sequence from Phyllostachys pubescens

[0047] Normally grown bamboo shoots were selected, and RNA of the bamboo shoots was extracted and reverse transcribed into cDNA. PCR amplification was performed using the cDNA of the bamboo shoots as a template according to the gene sequence published in the bamboo genome database to obtain PCR amplification products.

[0048] The primer sequences are:

[0049] PeSND1-F-2: 5′-TCGACGTTTGAAACACACCAGAC-3′

[0050] PeSND1-R-2: 5′-CGCCATGTCTCGGTCCATAA-3′

[0051] The PCR reaction program was as follows: 98°C, pre-denaturation for 10 min; 98°C, denaturation for 20 s; 58°C, annealing for 20 s; 72°C, extension for 2 min, 30 cycles; 72°C, renaturation for 10 min; and storage at 10°C.

[0052] The PCR amplification product was detected by agarose gel electrophoresis with a mass ratio of 1%, and the electrophoresis band consistent with the length of the target gene was cut and recovered. The recovered fragment was connected to the pBLUE-T vector (purchased from Beijing Aidelai Biotechnology Co., Ltd.) to obtain the connection product. The connection product was transformed into Escherichia coli competent DH5α cells, and the plasmid was extracted. The extracted plasmid was used as a template, and PeSND1-F-2 and PeSND1-R-2 were used as primers for PCR amplification verification. At the same time, the plasmid was double-digested with KpnI and XbaI for detection, and the positive clones were screened and sent to a sequencing company for sequencing. The sequencing results were compared using DNAMAN software, and the results were consistent with the prediction. The obtained recombinant plasmid was named T-PeSND1.

[0053] 2.4 Construction of the bamboo PeSND1 gene overexpression vector pCAMBI1300-PeSND1

[0054] pCAMBIA1300 vector map Figure 3 As shown, T-PeSND1 was double-digested with KpnI and XbaI to obtain a small target fragment, and pCAMBI1300 was double-digested with KpnI and XbaI to obtain a large target fragment. The two fragments were ligated using T4 ligase to construct the vector pCAMBI1300-PeSND1 ( Figure 4 ).

[0055] 2.5 Obtaining and identifying transgenic bamboo plants overexpressing PeSND1

[0056] 2.5.1 Obtaining transgenic bamboo overexpressing PeSND1:

[0057] pCAMBI1300-PeSND1 was transformed into Agrobacterium competent EHA105 by electroporation transformation method, and the grown colonies were verified by PCR amplification using PeSND1-F-2 and PeSND1-R-2 as primers. Positive single colonies were selected for shaking, and when the OD value was 0.6, the bacteria were collected and resuspended in the infection solution. The callus tissue induced by the anthers of Dendrobium latifolium was used as the receptor material for infection. After three days of co-cultivation, the callus tissue was transferred to a screening medium containing hygromycin and cephalosporin, and resistant callus was obtained and differentiated into seedlings.

[0058] 2.5.2 PCR identification of transgenic bamboo overexpressing PeSND1:

[0059] DNA from transgenic and wild-type bamboo leaves was extracted using the CTAB method, and PCR molecular detection was performed using primers 35S-F and PeSND1-R-3. Amplification program: 94℃5min; denaturation: 94℃30s; annealing: 55℃30s; extension: 72℃30s, 28 cycles; total extension: 72℃7min. After the reaction, the PCR product was taken, subjected to 1% agarose gel electrophoresis, and observed in a gel imaging system. Six transgenic positive plants were obtained after testing ( Figure 5 A).

[0060] The primer sequences are:

[0061] 35S-F:5′-CCGACAGTGGTCCCAAAGAT-3′

[0062] PeSND1-R-1:5′-GCGGCCTTTGTAGAAGACGA-3′

[0063] 2.5.3 Detection of PeSND1 gene expression in transgenic bamboo overexpressing PeSND1:

[0064] Total RNA was extracted from PeSND1 transgenic positive plants using the method in 2.2, and reverse transcribed into cDNA using transgenic negative plants as controls. Real-time fluorescence quantitative PCR analysis was performed using PeSND1-F-1 and PeSND1-R-1 as primers. The results showed that the expression level of PeSND1 in transgenic positive plants was more than 10 times higher than that in the controls ( Figure 5 B).

[0065] 2.6 Phenotypic analysis of transgenic bamboo overexpressing PeSND1

[0066] 2.6.1 Measurement of stem diameter of transgenic bamboo overexpressing PeSND1

[0067] At the same time, the transgenic PeSND1 bamboo and the control plants were planted in a greenhouse. After 6 months, two strains, PeSND1-OE1 and PeSND1-OE2, were selected for phenotypic analysis based on the expression level analysis. The second internode of the lignified aboveground part was measured with a vernier caliper, and the results showed that the stems of the overexpression strains were significantly thicker than those of the control strains.

[0068] 2.6.2 Lignin staining analysis of transgenic bamboo stems overexpressing PeSND1

[0069] The second internode of the aerial part of the transgenic bamboo overexpressing PeSND1 and the control plant were taken, and the 0.5 cm stem segment in the middle of the internode was cut for FAA fixation, paraffin embedding, and made into 8 μm sections. After dewaxing, phloroglucinol staining was performed. The results showed that the staining of the mechanical tissue and vascular tissue of the transgenic plant was darker than that of the control strain.

[0070] 2.6.3 Comparative analysis of cell wall thickness of transgenic bamboos overexpressing PeSND1

[0071] The second internode stem segment was fixed with 2.5% glutaraldehyde, then fixed with osmium acid, gradient dehydrated, and embedded, and then made into 50 nm slices for transmission electron microscopy observation. The results showed that the cell wall of the transgenic plant was significantly thicker than that of the control strain.

[0072] 2.6.4 Determination of lignin cellulose content in transgenic bamboo overexpressing PeSND1

[0073] The stems of the transgenic bamboo plants overexpressing PeSND1 and the control plants were dried, ground and weighed to measure the lignin and cellulose contents. The lignin content was determined by acetylation method, and the cellulose content was determined by anthrone sulfate colorimetry. The results showed that the lignin and cellulose contents of the transgenic plants were higher than those of the control plants ( Figure 5 ).

[0074] What is described above is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A PeSND1 gene of moso bamboo, characterized in that: The protein comprises a nucleotide sequence of SEQ ID NO.1 and an amino acid sequence of SEQ ID NO.2 in the sequence list.

2. The bamboo PeSND1 gene according to claim 1, characterized in that The nucleotide sequence of PeSND1 is shown in SEQ ID NO.

1.

3. An application of the PeSND1 gene of bamboo, characterized in that: Application of the bamboo secondary cell wall component regulatory gene PeSND1 in regulating the secondary cell wall components of bamboo including the content of lignocellulose.

4. A plant carrier, characterized in that: The invention relates to a pCAMBIA1300-PeSND1 plant expression vector, which comprises a 35S promoter, a PeSND1 gene, a flag tag and a terminator connected in sequence to a multiple cloning site region.

5. The carrier according to claim 4, characterized in that The vector includes a host bacterium that overexpresses the vector.

6. The carrier according to claim 4, characterized in that The primer pair used for cloning the bamboo secondary cell wall component regulatory gene PeSND1 comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

Images