Accurate positioning method for upland cotton defoliant sensitivity QTL qSD-A05

Abstract

The invention relates to the technical field of gene engineering, and discloses a precise positioning method of upland cotton defoliating agent sensitivity QTL qSD-A05, which comprises the following steps: firstly, detecting a major QTL for controlling the upland cotton defoliating agent sensitivity in an upland cotton A05 chromosome through initial positioning, and naming the major QTL as qSD-A05; carrying out continuous multi-generation selfing, and selecting by adding a molecular marker, so as to construct a near-isogenic line of qSD-A05; and carrying out near-isogenic line abscission development cytology observation, carrying out fine positioning on the qSD-A05 by utilizing a map-based cloning method, and finally positioning the qSD-A05 between the marker M11 and the marker M12. In the invention, a new cotton control QTL is finely positioned, the major QTL is positioned in an AO5 chromosome and between markers M11 and M12, the physical distance is about 180kb, molecular markers on two sides can be used for molecular marker-assisted selective breeding, the markers M11 and M12 are utilized to carry out genotype analysis on upland cotton germplasm resources, and in combination with a defoliating agent sensitive phenotype, the molecular markers can be used for identifying the cotton quality of the upland cotton germplasm resources. The real effect of the site in the upland cotton population is verified.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for accurately locating a defoliant sensitivity QTL qSD-A05 in upland cotton. Background Art

[0002] Promoting the centralized boll opening and defoliation of machine-picked cotton in Xinjiang through chemical methods has become an important part of machine-picked cotton planting, and the defoliation effect directly affects the efficiency and quality of cotton harvesting and processing. The research on cotton defoliants has undergone two updates from high-acting chlorate defoliants to butyl phosphate, and then to the widely used thidiazuron today, thus achieving a greener, safer and more efficient production. Thiidiazuron is a cotton defoliant with cytokinin activity. Compared with butyl phosphate and chlorate defoliants, it is highly efficient and low-toxic, and it does not damage cotton plants, which is conducive to maximizing the transfer of nutrients in the leaves to cotton bolls, and has minimal environmental pollution. For this reason, thidiazuron and its compound defoliants are adopted by most cotton producing countries. Existing studies have shown that the defoliation effect of defoliants is related to the type of defoliant, weather conditions and spraying method, as well as the cotton variety. Different varieties have different responses to defoliants. After spraying the same concentration and amount of defoliants on different varieties, the defoliation speed and effect are different. Some cotton varieties currently grown in production are slow to respond to defoliants, which affects the effect of mechanical picking and increases the impurity rate of machine-picked cotton, thereby increasing the number of flower cleaning times in the later processing process and reducing the quality of cotton fibers; in addition, the multiple spraying of defoliants due to poor defoliation effects also further increases the cost of cotton production and affects farmers' income. Therefore, the analysis of the genetic basis of cotton's sensitivity to defoliants will lay the foundation for the genetic improvement of cotton's sensitivity to defoliants (SD), which is an important part of machine-picked cotton breeding.

[0003] The phenotype of cotton after defoliant treatment is a quantitative trait controlled by micro-effect polygenes. At present, there are relatively few reports on the positioning of genes related to cotton defoliant sensitivity by forward genetics, and most of the known related genes are obtained by reverse genetics. Some genes participate in the separation of abscission cells by directly participating in the degradation of abscission cell walls, thereby leading to leaf shedding. For example, GhCEL1 encodes a C-terminal carbohydrate binding region α2 cellulase, which is specifically expressed in the abscission layer of cotton leaves. Increasing the expression of this gene can increase the cellulase activity of abscission cells and reduce the strength of leaf shedding, thereby promoting leaf shedding; GhCEL1, GhPG and GhACS are induced by the cotton defoliant thidiazuron, and GhCEL1 and GhPG are specifically expressed in the abscission zone of cotton, which promotes the shedding of cotton leaves and the ripening of fruits by promoting the degradation of the interlayer of abscission cells and the primary cell wall. Some genes participate in the formation of petiole abscission layer by participating in hormone metabolism pathways, such as GhCKX3, which encodes a cytokinin oxidase / dehydrogenase. The gene is induced by ethylene and activates the cytokinin degradation pathway. The cytokinin content in the abscission layer of GhCKX3 RNAi plants increases, thereby reducing the response to ethylene, and then delaying the activation of abscission cells, resulting in a delayed leaf shedding phenotype; the response of cotton leaves to defoliants is affected by the combined effects of multiple hormones, and thiadiazole promotes cotton leaf shedding by regulating the relationship between ethylene, auxin and cytokinin. In addition, defoliant treatment is also an abiotic stress for cotton. Defoliant treatment breaks the balance of active oxygen metabolism and causes irreversible damage to photosynthesis, promoting the shedding of cotton leaves. This process involves changes in the expression of most photosynthesis and active oxygen metabolism-related genes. In summary, the research on the genetic basis of cotton sensitivity to defoliants is relatively weak, and the research on the functional genes involved is relatively small. Therefore, the cloning and functional analysis of cotton defoliant sensitivity genes based on forward genetics will help to analyze the genetic basis of cotton sensitivity to defoliants and develop functional molecular markers for genetic improvement of machine-picked cotton.

[0004] Cotton's sensitivity to defoliants is a complex quantitative trait controlled by multiple genes. The sensitivity of cotton to defoliants directly affects the defoliation effect, which in turn affects the mechanical harvesting quality of cotton. Therefore, the analysis of this trait is conducive to the effective mining of excellent genotypes and has a positive impact on machine-picked cotton breeding. However, so far, the precise positioning and cloning of cotton defoliant sensitivity are still very limited. Summary of the invention

[0005] In order to make up for the above shortcomings, the present invention provides a method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton, aiming to finely locate a major effect QTL qSD-A05 that controls the defoliant sensitivity of upland cotton, develop molecular markers closely linked to it, and evaluate the breeding effect of qSD-A05 to clarify the important significance of qSD-A05 for breeding applications.

[0006] To achieve the above object, the present invention provides the following technical solution: a method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton, comprising the following steps:

[0007] Firstly, a major QTL controlling defoliant sensitivity in upland cotton was detected on chromosome A05 through preliminary mapping and named qSD-A05.

[0008] Through continuous self-pollination for several generations and selection with molecular markers, a near-isogenic line of qSD-A05 was constructed.

[0009] Developmental cytological observation of the abscission layer of the near-isogenic lines was performed, and qSD-A05 was finely located using the map-based cloning method, and finally qSD-A05 was located between markers M11 and M12.

[0010] Preferably, M11 and M12 are respectively:

[0011] M11_F: ATGCCTGACCAAAATCCAGC;

[0012] M11_R: AGCAACTGTACATGAAAACGGAA;

[0013] M12_F:AGTTAAGAAAGGCTGCAAACCG;

[0014] M12_R: TAAGCCTATTCGGACGAGCG.

[0015] Preferably, the initial positioning method comprises the following steps:

[0016] An F2 segregating population was constructed. During the cotton boll opening period, the F2 plants were treated with defoliants. The defoliation rate was counted one week after the treatment. A DNA pool was constructed from the F2 segregating population. The BSA-seq method was used to initially locate the gene controlling the defoliant sensitivity. A defoliant sensitivity QTL locus was identified at the end of chromosome AO5.

[0017] Subsequently, the F2 individual plant and 10 SNP markers within the interval were used and located between markers M3 and MI5, named qSD-A05.

[0018] Preferably, the method further comprises the following steps:

[0019] A heterozygous plant in the qSD-A05 target region was selected in the F3 generation, and self-pollination and molecular marker selection were performed for three consecutive generations to create qSD-A05HIF and construct a segregating population.

[0020] The markers M3 and M15 on both sides of the qSD-A05 interval were used to analyze the genotype of the individual plants and screen the recombinant plants. All the recombinant plants were self-pollinated and kept as seeds. At the same time, the five polymorphic markers M5, M8, M11, M12 and M13 in the interval were used to encrypt the markers and perform genotype analysis on the recombinant plants. Through the encryption of the markers of the recombinant plants, the inter-stacked lines of qSD-A05 were constructed.

[0021] Through the progeny test results of the recombinant family, qSD-A05 was located between markers M11 and M12. According to the reference genome of upland cotton TM-1, the physical distance between the two markers was 180 kb.

[0022] Preferably, during the genotype analysis, the specific steps of the single plant DNA extraction method are as follows:

[0023] S1. Add 700 μL CTAB into a mortar, take an appropriate amount of fresh young leaves and grind them on ice until homogenized, then transfer to a 2 mL centrifuge tube;

[0024] S2, 65℃ water bath for 40min, invert several times to mix;

[0025] S3, after cooling to room temperature, add equal volumes of chloroform and isoamyl alcohol, shake gently to mix for 15 minutes, and centrifuge at 12000 rpm for 10 minutes;

[0026] S4, take 200 μL of supernatant into another new 1.5 mL centrifuge tube, add twice the volume of ice ethanol, shake gently to mix, and let stand for 30 minutes;

[0027] S5, centrifuge at 12000 rpm for 10 min, discard the supernatant, and wash the precipitate twice with 75% ethanol;

[0028] S6. Centrifuge and remove the supernatant. Place at room temperature to dry, add 100 μL ddH2O to dissolve, and store at -20°C for later use.

[0029] Preferably, the CTAB is 83.5 mM Tris-HCl, pH 8.0, 16.7 mM EDTA, pH 8.0, 1.17 M NaCl, 1.67% CTAB.

[0030] Preferably, the method is applied to cotton defoliants.

[0031] The present invention has the following beneficial effects:

[0032] The present invention has carried out fine positioning of a new QTL controlling cotton, and located the major effect QTL on chromosome AO5, between markers M11 and M12, with a physical distance of about 180kb. The molecular markers on both sides can be used for molecular marker-assisted selection breeding, and the genotype analysis of upland cotton germplasm resources was carried out using markers M11 and M12, combined with the defoliant sensitivity phenotype, to verify the real effect of this site in the upland cotton population. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a schematic diagram of the defoliant sensitivity analysis of Xinluzhao 57 and Nan 2 in the present invention; wherein A: Xinluzhao 57 and Nan 2 treated with defoliants for 0, 5 and 7 days; B: defoliation rate on the seventh day after defoliant treatment.

[0034] Figure 2 This is a scanning electron microscope observation image of abscission layer cells of cotton leaves after being treated with a defoliant in the present invention;

[0035] Figure 3 For the present invention Figure 3 The initial positioning and fine positioning analysis diagram of qSD-A05; among them,

[0036] A: SNP frequency distribution of chromosome A05 by BSA sequencing; B: F2 population verification positioning results; C: qSD-A05 fine positioning. (A, Xinluzao 57 genotype; B, Nan2 genotype; H, heterozygous genotype; N, number of individual plants used for statistical analysis; p<0.001; NS, not significantly different). DETAILED DESCRIPTION

[0037] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Reference Figure 1-Figure 3 The present invention provides an embodiment: a method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton, comprising the following steps:

[0039] Firstly, a major QTL controlling defoliant sensitivity in upland cotton was detected on chromosome A05 through preliminary mapping and named qSD-A05.

[0040] Through continuous self-pollination for several generations and selection with molecular markers, a near-isogenic line of qSD-A05 was constructed.

[0041] Cytological observation of abscission layer development in near-isogenic lines facilitated the fine positioning of qSD-A05 by positional cloning, and qSD-A05 was finally located between markers M11 and M12.

[0042] M11_F:ATGCCTGACCAAAATCCAGC

[0043] M11_R:AGCAACTGTACATGAAAACGGAA

[0044] M12_F:AGTTAAGAAAGGCTGCAAACCG

[0045] M12_R:TAAGCCTATTCGGACGAGCG

[0046] The inventors used markers M11 and M12 to conduct genotyping analysis on 200 upland cotton germplasm resources, and combined with the defoliant sensitivity phenotypes of the 200 germplasm resources to verify the true effect of this site in the upland cotton population.

[0047] The following is an introduction with reference to specific embodiments.

[0048] Embodiment 1:

[0049] 1.1 Experimental Materials

[0050] Upland cotton varieties Xinluzao 57, Nan 2 and qSD-A05 near-isogenic lines, and progeny mapping populations constructed from near-isogenic lines. 200 upland cotton germplasm resources.

[0051] 1.2 Test methods

[0052] 1.2.1. Development of molecular markers for target regions

[0053] Based on the genome of Upland Cotton TM-1, InDel markers were developed according to the results of BSA-seq second-generation sequencing, and then amplified in parental materials (Xinluzao 57 and Nan 2). Polymorphism analysis was then performed by capillary electrophoresis, and markers with polymorphism and clear bands were selected for population genotype analysis.

[0054] 1.2.2 Field trials and phenotypic identification

[0055] Two upland cotton materials with significant differences in sensitivity to defoliants were identified, Xinluzao 57 and Nan 2. Xinluzao 57 was a defoliant-sensitive material, while Nan 2 was a defoliant-insensitive material. After defoliant treatment (Bayer Detox, 12 ml / mu, diluted with 4 OL of water), the defoliation rate of Xinluzao 57 was significantly higher than that of Nan 2 ( Figure 1 A), on the 7th day after treatment, the leaf-shedding rate of Nan 2 was 40%, and that of Xinluzao 57 was 61% ( Figure 1 B). In addition, the results of the investigation of some important agronomic traits of the two parents showed that the plant height and the height of the first node of the fruiting branch of Xinluzao 57 were significantly higher than those of Nan 2, while the number of fruiting branches and the number of effective bolls were significantly lower than those of Nan 2. There were no significant differences in the number of effective bolls and single boll weight between the two materials (Table 1).

[0056] 1.2.3 Genotype analysis

[0057] Genotype analysis involves DNA extraction and PCR amplification. The required primers are shown in Table 3.

[0058] The CTAB method was used to extract the DNA of individual strains. The specific steps are as follows:

[0059] 1. Add 700 μL CTAB (83.5 mM Tris-HCl, pH 8.0, 16.7 mM EDTA, pH 8.0, 1.17 M NaCl, 1.67% CTAB) in a mortar, take an appropriate amount of fresh young leaves and grind them on ice until homogenized, and transfer them to a 2 mL centrifuge tube;

[0060] 2.65℃ water bath for 40min, invert several times to mix;

[0061] 3. After cooling to room temperature, add an equal volume of chloroform:isoamyl alcohol (24:1, V / V), shake gently to mix for about 15 minutes, and centrifuge at 12000 rpm for 10 minutes;

[0062] 4. Take 200 μL of supernatant into another new 1.5 mL centrifuge tube, add twice the volume of ice ethanol, shake gently to mix, and let stand for 30 minutes;

[0063] 5. Centrifuge at 12000rpm for 10min, discard the supernatant, and wash the precipitate twice with 75% ethanol;

[0064] 6. Centrifuge and remove the supernatant. Leave to dry at room temperature, add 100 μL ddH2O to dissolve, and store at -20℃ for later use.

[0065] PCR reaction system:

[0066]

[0067] PCR reaction procedure:

[0068]

[0069] The genotype of individual plants was determined by capillary electrophoresis.

[0070] 2. Results and Analysis

[0071] 2.1. Initial positioning of qSD-A05

[0072] Two upland cotton materials with significant differences in sensitivity to defoliants were identified, Xinluzao 57 and Nan 2. Xinluzao 57 was a defoliant-sensitive material, while Nan 2 was a defoliant-insensitive material. After defoliant treatment (Bayer Detox, Germany, 12 mL / mu, diluted with 40 L of water), the defoliation rate of Xinluzao 57 was significantly higher than that of Nan 2 ( Figure 1 A), on the 7th day after treatment, the leaf-shedding rate of Nan 2 was 40%, and that of Xinluzao 57 was 61% ( Figure 1 B). In addition, the results of the investigation of some important agronomic traits of the two parents showed that the plant height and the height of the first node of the fruiting branch of Xinluzao 57 were significantly higher than those of Nan 2, while the number of fruiting branches and the number of effective bolls were significantly lower than those of Nan 2. There were no significant differences in the number of effective bolls and single boll weight between the two materials (Table 1).

[0073] Table 1 Agronomic traits survey table of parental materials:

[0074]

[0075]

[0076] 1.2 Observation and analysis of parental abscission layer cytology

[0077] The cell wall of abscission cells is degraded, leading to cell separation, which in turn causes leaf shedding. Therefore, the integrity of the cells in the abscission layer section of the petiole can reflect the separation state of the abscission cells. The better the integrity of the cells in the abscission layer section, the better the development of the abscission layer and the easier it is for the organ to fall off. Therefore, in order to explore the changes in the morphology of cotton abscission cells before and after defoliant treatment, scanning electron microscopy was performed on the abscission layer sections 1 day after defoliant treatment, and on the 5th and 7th days after treatment. The results showed that: 1 day after treatment, the cells in the abscission layer section of Nan 2 leaves showed a state of cell wall rupture, while some cells of Xinlu Zao 57 showed a complete spherical morphology; on the 5th day after treatment, most of the cells in the abscission layer section of Nan 2 leaves showed a state of cell wall rupture, a small number of cells showed a spherical state, and most of the cells in the abscission layer section of Xinlu Zao 57 showed a complete spherical morphology; on the 7th day after treatment, the number of intact cells in Nan 2 began to increase, but there were still incomplete broken cells, while almost all the cells in the abscission layer section of Xinlu Zao 57 showed a complete spherical state ( Figure 2 The above results show that after defoliant treatment, the abscission layer formation rate of Xinluzao 57 is significantly faster than that of Nan 2, which can well explain the difference in the defoliant sensitivity of the two upland cotton materials.

[0078] Xinluzao 57 and Nan 2 were used as parents to construct an F2 segregation population. At the cotton boll opening stage, 3000 F2 plants were treated with defoliants, and the defoliation rate was counted one week after the treatment. Fifty materials with extreme defoliation rates were selected from each F2 segregation population to construct a DNA pool. The BSA-seq (mixed extreme pool sequence) method was used to initially locate the gene controlling defoliant sensitivity, and a defoliant sensitivity QTL locus was identified at the end of chromosome AO5 ( Figure 3 A); 284 F2 plants and 10 SNP markers within the interval were used to further verify the site and locate it between markers M3 and MI5 ( Figure 3 B), 1.5Mb interval, and named the site QTLSensitivetodefoliants-A05 (qSD-A05). In order to further fine-tune the gene, we selected a heterozygous plant in the qSD-A05 target segment in the F3 generation, self-pollinated for three consecutive generations and assisted in molecular marker selection to create qSD-A05HIF, and constructed a large segregation population for qSD-A05 fine positioning. Next, we used markers (M3, M15) on both sides of the qSD-A05 interval to perform genotyping analysis on 5000 plants (HIF self-pollination population), screened 84 recombinant plants, and all these recombinant plants were self-pollinated for seed preservation. At the same time, we used 5 polymorphic markers in the interval (M5, M8, M11, M12, M13) to encrypt the markers and perform genotyping analysis on the recombinant plants. Through the encryption of the recombinant plant markers, we obtained 8 recombinant types and constructed a trans-stacked system of qSD-A05. These eight recombinant families were self-pollinated and used for progeny testing. The progeny testing of the recombinant families was used to determine whether the progeny of the heterozygous single plant containing the qSD-A05 locus were separated and whether the difference was significant, that is, whether there was a significant difference in the defoliation rate between the homozygous Xinlu Zao 57 genotype and the Nan 2 genotype. The progeny test results showed that there was a significant difference in the defoliation rate between the two genotype individuals between the M11-M12 markers. Therefore, based on the results of the progeny test, we located qSD-A05 between markers M11 and M12. According to the Wuhan University Upland Cotton TM-1 reference genome, the physical distance between the two markers was about 180kb ( Figure 3 C). To further narrow down the candidate interval of qSD-A05, genotype analysis was performed on 6000 HIF self-pollination materials using markers M11 and M12, and 9 recombinant plants were screened. All these recombinant plants were self-pollinated and kept as seeds. Molecular markers were developed and encrypted, and secondary cross-stacked lines were constructed for fine positioning.

[0079] The present invention has carried out fine positioning of a new cotton QTL, and the main effect QTL is positioned on chromosome AO5, between markers M11 and M12, with a physical distance of about 180kb, and the molecular markers on both sides can be used for molecular marker-assisted selection breeding.

[0080] Table 3, left and right primer names, sequences and positions of positioning markers:

[0081]

[0082]

[0083] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton, characterized by: The following steps are involved: Firstly, a major QTL controlling defoliant sensitivity in upland cotton was detected on chromosome A05 through preliminary mapping and named qSD-A05. Through continuous self-pollination for several generations and selection with molecular markers, a near-isogenic line of qSD-A05 was constructed. Developmental cytological observation of the abscission layer of the near-isogenic lines was performed, and qSD-A05 was finely located using the map-based cloning method, and finally qSD-A05 was located between markers M11 and M12.

2. The method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton according to claim 1, characterized in that: The M11 and M12 are respectively: M11_F: ATGCCTGACCAAAATCCAGC; M11_R: AGCAACTGTACATGAAAACGGAA; M12_F:AGTTAAGAAAGGCTGCAAACCG; M12_R: TAAGCCTATTCGGACGAGCG.

3. The method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton according to claim 1, characterized in that: The method for initial positioning comprises the following steps: An F2 segregating population was constructed. During the cotton boll opening period, the F2 plants were treated with defoliants. The defoliation rate was counted one week after the treatment. A DNA pool was constructed from the F2 segregating population. The BSA-seq method was used to initially locate the gene controlling the defoliant sensitivity. A defoliant sensitivity QTL locus was identified at the end of chromosome AO5. Subsequently, the F2 individual plant and 10 SNP markers within the interval were used and located between markers M3 and MI5, named qSD-A05.

4. The method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton according to claim 3, characterized in that: The following steps are also included: A heterozygous plant in the qSD-A05 target region was selected in the F3 generation, and self-pollination and molecular marker selection were performed for three consecutive generations to create qSD-A05HIF and construct a segregating population. The markers M3 and M15 on both sides of the qSD-A05 interval were used to analyze the genotype of the individual plants and screen the recombinant plants. All the recombinant plants were self-pollinated and kept as seeds. At the same time, the five polymorphic markers M5, M8, M11, M12 and M13 in the interval were used to encrypt the markers and perform genotype analysis on the recombinant plants. Through the encryption of the markers of the recombinant plants, the inter-stacked lines of qSD-A05 were constructed. Through the progeny test results of the recombinant family, qSD-A05 was located between markers M11 and M12. According to the reference genome of upland cotton TM-1, the physical distance between the two markers was 180 kb.

5. The method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton according to claim 4, characterized in that: During the genotype analysis, the specific steps of the single plant DNA extraction method are as follows: S1. Add 700 μL CTAB into a mortar, take an appropriate amount of fresh young leaves and grind them on ice until homogenized, then transfer to a 2 mL centrifuge tube; S2, 65℃ water bath for 40min, invert several times to mix; S3, after cooling to room temperature, add equal volumes of chloroform and isoamyl alcohol, shake gently to mix for 15 minutes, and centrifuge at 12000 rpm for 10 minutes; S4, take 200 μL of supernatant into another new 1.5 mL centrifuge tube, add twice the volume of ice ethanol, shake gently to mix, and let stand for 30 minutes; S5, centrifuge at 12000 rpm for 10 min, discard the supernatant, and wash the precipitate twice with 75% ethanol; S6. Centrifuge and remove the supernatant. Place at room temperature to dry, add 100 μL ddH2O to dissolve, and store at -20°C for later use.

6. The method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton according to claim 5, characterized in that: The CTAB is 83.5 mM Tris-HCl, pH 8.0, 16.7 mM EDTA, pH 8.0, 1.17 M NaCl, 1.67% CTAB.

7. The method for accurately locating the defoliant sensitivity QTL qSD-A05 in upland cotton according to claim 1, characterized in that: The method was applied to the precise positioning of cotton defoliants and upland cotton defoliant sensitivity QTL qSD-A05.

Images