Construction and application of a targeted exosome chimeric antigen receptor molecule for treating HIV infection

By constructing expression vectors for CD3, CD4, or CD8 nanobodies and the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, and preparing exosomes using 293F cell suspension culture, the risks of collection and viral recombination in CAR-T cell therapy were solved, achieving a highly efficient and low-cost HIV treatment method with significant antiviral effects.

CN119120571BActive Publication Date: 2026-03-17WUHAN UNIV OF SCI & TECH
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411271118.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-11
Publication Date
2026-03-17
Estimated Expiration
2044-09-11

AI Technical Summary

Technical Problem

Existing CAR-T cell therapies for HIV treatment have several drawbacks, including the risk of HIV exposure during collection, immune system rejection, viral homologous recombination, and high costs. Furthermore, they cannot effectively eliminate HIV viral reservoirs.

Method used

We constructed expression vectors for CD3, CD4, or CD8 nanobodies and the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid. Exosomes were prepared by suspension culture of 293F cells. Exosomes were used as vectors for in vitro preparation of CAR-T cells, avoiding the risks of viral transduction and homologous recombination. High-affinity broad-spectrum neutralizing antibodies were used as CAR structures to achieve mass production.

Benefits of technology

It achieves a highly efficient and low-cost CAR-T therapy that does not require the extraction of T cells from the patient's body, has significant antiviral effects, can neutralize more than 98% of HIV-1 strains, and the exosomes can cross multiple barriers with low immunogenicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119120571B_ABST
    Figure CN119120571B_ABST
Patent Text Reader

Abstract

The application discloses a kind of targeted exosome chimeric antigen receptor molecules for treating HIV infection and its application, belong to the field of biological medicine technology.The application is packaged into targeted exosome by coding anti-HIV CAR mRNA directionally.The nano antibody sequence of targeted CD3, CD4, CD8+T receptor on T cell is fused to the N-terminal of LAMP-2B to construct specific targeting plasmid, so that the targeted peptide is expressed on the surface of exosome membrane, the expression plasmid containing RNA binding protein L7A and exosome tag protein CD63 is constructed, and the exosome loaded with CAR mRNA and targeted to T cell is obtained by three-plasmid co-transfection of HEK293F cells containing C / D box CAR plasmid.The exosome can construct human CAR-T cell when incubated with PBMC in vitro or back into humanized mouse in vivo, and has significant killing virus infected cell activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the construction and application of a targeted exosomal chimeric antigen receptor molecule for the treatment of HIV infection. Background Technology

[0002] Human immunodeficiency virus (HIV) is a pathogen that causes immune system deficiencies, primarily attacking the human immune system and weakening its resistance to infection, potentially leading to acquired immunodeficiency syndrome (AIDS). As the terminal stage of HIV infection, AIDS is characterized by immune failure, making patients susceptible to severe infections and cancer. Although progress has been made in treatment since the 1980s, particularly with the development of antiretroviral therapy, HIV / AIDS remains a major challenge in global public health, especially in many developing countries, where its impact is particularly profound. Therefore, prevention, treatment, and increased awareness of HIV / AIDS have become the focus of international efforts.

[0003] Highly active antiretroviral therapy (HAART), currently the mainstream treatment for HIV / AIDS, significantly reduces HIV-1 viral load to almost undetectable levels. However, this treatment fails to eradicate the HIV reservoir and requires lifelong medication; once discontinued, the virus rapidly relapses. While achieving significant success in controlling HIV-1 infection and reducing viral load to undetectable levels, it still cannot effectively eliminate the HIV reservoir. Furthermore, lifelong antiretroviral medication is required, and the virus rebounds rapidly after discontinuation, leading to poor adherence, drug resistance, and significant side effects. CAR-T cell therapy (Chimeric Antigen Receptor T-cell Therapy) is primarily an innovative therapy for treating hematologic malignancies such as leukemia and lymphoma. CAR-T therapy modifies the patient's own T cells, giving them a stronger anti-tumor ability to attack and destroy malignant tumor cells. Although CAR-T therapy has achieved significant success in treating diseases such as leukemia, its application in HIV treatment still faces a series of challenges. Therefore, as of now, CAR-T therapy is not a mainstream treatment for HIV (human immunodeficiency virus).

[0004] The use of CAR-T cell therapy for HIV treatment has significant limitations, including:

[0005] 1. Although universal CAR-T cell therapy eliminates the need to extract T cells from patients and reduces the risk of HIV exposure, thereby improving safety, this therapy also brings potential life-threatening risks, mainly manifested in the patient's immune system's possible rejection of allogeneic T cells (host-graft reaction, HvGR) and the possibility of donor T cells triggering graft-versus-host disease (GvHD).

[0006] 2. Autologous CAR-T cells are collected from the patient's own tissue, which can effectively avoid the immune system's rejection of allogeneic T cells. However, there are many risks involved, including the risk of HIV exposure during the collection process, high requirements for the patient's own T cells, the presence of toxins throughout the preparation process, high biosafety requirements, long experimental cycles, and high costs.

[0007] Both different CAR-T therapies prepare CAR-T cells through third-generation lentivirus transduction and reinfuse them into the patient's body, which carries the risk of viral homologous recombination and viral evolution. Summary of the Invention

[0008] The purpose of this invention is to provide a method for constructing and applying a targeted exosomal chimeric antigen receptor molecule for treating HIV infection, thereby addressing the problems existing in the prior art. This invention aims to provide a novel CAR-T therapy that does not require the extraction of T cells from the patient, is simple to operate, highly versatile, and low-cost, and can be used in the future development and treatment of HIV infection drugs.

[0009] To achieve the above objectives, the present invention provides the following solution:

[0010] One of the technical solutions of this invention is a nanobody expression vector targeting CD3, CD4, or CD8. The nanobody expression vector targeting CD3, CD4, or CD8 uses EF-1α as a promoter, and a Kozak sequence, a GNSTM glycosylation sequence, a target gene, and Lamp2b are sequentially linked downstream of the promoter. The target gene is a CD3, CD4, or CD8 gene. The nucleotide sequence of CD3 is shown in SEQ ID NO:4, the nucleotide sequence of CD4 is shown in SEQ ID NO:5, and the nucleotide sequence of CD8 is shown in SEQ ID NO:6.

[0011] The second technical solution of the present invention is a PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, wherein the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid carries a CAR structure + CDbox; the nucleotide sequence of the CAR structure + CDbox is shown in SEQ ID NO:7.

[0012] The third technical solution of the present invention is a PCDNA3.1CD63-L7Ae / ZSGreen plasmid, wherein the PCDNA3.1CD63-L7Ae / ZSGreen plasmid carries CD63-L7Ae or CD63-ZSGreen; wherein the nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8, and the nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:9.

[0013] The fourth technical solution of the present invention is a method for preparing exosomes, comprising the following steps:

[0014] The exosomes were obtained by co-transfecting 293F cells with the CD3, CD4 or CD8 nanobody expression vector, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid and the PCDNA3.1CD63-L7Ae / ZSGreen plasmid, and then purified.

[0015] The fifth technical solution of the present invention is the exosomes obtained by the preparation method.

[0016] The sixth technical solution of the present invention is the application of the exosomes in the preparation of drugs for treating diseases caused by HIV.

[0017] The seventh technical solution of the present invention is a drug for treating diseases caused by HIV, comprising the exosomes.

[0018] Based on the above technical solution, the present invention has the following technical effects:

[0019] This invention utilizes molecular docking to screen for bnab with higher affinity for target HIV-1 strains from existing broad-spectrum neutralizing antibodies. The technical solution provided by this invention can produce fully human antibodies. Existing technologies use 293T cells for recombinant antibody expression; however, the adherent properties and contact inhibition of 293T cells result in low yields. This invention, using 293F cells in suspension culture, enables large-scale production of recombinant antibodies.

[0020] Compared to traditional CAR-T cell therapy, which uses third-generation lentivirus transduction to prepare CAR-T cells in vitro, the treatment method established in this invention does not require T cell acquisition and involves no viral transduction. CAR exo can achieve targeted preparation of CAR-T cells in vivo, thus the method established in this invention is more conducive to the development of new CAR-T drugs, which is crucial for the treatment of HIV / AIDS. Another advantage of the method established in this invention is the selection of a broad-spectrum neutralizing antibody capable of neutralizing over 98% of HIV-1 as the scFv for the CAR structure, offering broad coverage and high affinity. Yet another advantage is the selection of exosomes as the CAR carrier, which can cross multiple barriers and exhibits low immunogenicity.

[0021] This invention utilizes the HEK293F exosome expression system to obtain high-purity exosomes that specifically target CD3, CD4, and CD8+ T cells and are converted into CAR-T cells in vivo. The exosomes are coupled to the L7AE protein via the exosome marker protein CD63, and the CDbox structure on the CAR mRNA expression plasmid is specifically bound to the protein and mRNA. These exosomes are then co-transfected into HEK293F cells with a nanobody expression plasmid that specifically targets CD3, CD4, and CD8+ T cells to obtain exosomes. This invention is the first to achieve in vivo CAR-T construction using CAR-exo and demonstrate significant antiviral effects in an HIV-infected mouse model. The in vivo preparation of CAR-T cells using exosomes allows for mass production, is virus-free, and eliminates the risk of homologous recombination. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 A schematic diagram of the construction of the BRD-PTK-CD3 / CD4 / CD8-Lamp2b plasmid;

[0024] Figure 2 A schematic diagram of the construction of the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid;

[0025] Figure 3 A schematic diagram of the construction of the PCDNA3.1CD63-L7Ae / ZSGreen plasmid;

[0026] Figure 4 Image showing the results of flow cytometry detection of CAR molecule expression in HEK293F cells;

[0027] Figure 5 This is a schematic diagram showing the results of exosome purification.

[0028] Figure 6 Figures showing the results of NTA analysis of exosomes (A) and electron microscopy (B);

[0029] Figure 7 The image shows the results of nanoflow cytometry analysis of exosomes.

[0030] Figure 8 For observing cell targeting results using laser confocal microscopy;

[0031] Figure 9The image shows the results of in vitro detection of exosome-specific CAR-T cell formation.

[0032] Figure 10 The results of the cytotoxicity test are based on the calcein assay.

[0033] Figure 11 The results are for the detection of perforin by granzyme B; where A is granzyme B and B is perforin.

[0034] Figure 12 To detect CAR+ results;

[0035] Figure 13 The image shows the antiviral effect of in vivo CAR-exo in an HIV humanized mouse model; where A is a flowchart, B is the imaging results of CAR-exo in HIV-infected mice, and C is the quantitative imaging results of small animals.

[0036] Figure 14 The results are for total DNA and RNA quantification analysis; where A represents the total DNA quantification results of peritoneal macrophages and bone marrow virus, and B represents the total RNA quantification results of peritoneal macrophages and bone marrow virus.

[0037] Figure 15 The results are the quantitative analysis results of viral DNA before integration into mouse tissues; where A is the quantitative PCR amplification curve, B is the standard curve, and C is the quantitative results of viral DNA before integration into mouse spleen and blood tissues. Detailed Implementation

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0043] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0044] This invention provides a nanobody expression vector targeting CD3, CD4, or CD8. The nanobody expression vector uses EF-1α as a promoter, and downstream of the promoter are sequentially linked a Kozak sequence, a GNSTM glycosylation sequence, a target gene, and Lamp2b. The target gene is the CD3, CD4, or CD8 gene. The nucleotide sequence of CD3 is shown in SEQ ID NO:4, the nucleotide sequence of CD4 is shown in SEQ ID NO:5, and the nucleotide sequence of CD8 is shown in SEQ ID NO:6.

[0045] In some specific embodiments, the expression vector for the CD3, CD4, or CD8 nanobody targets uses the BRD-PTK plasmid as its backbone.

[0046] This invention also provides a PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, wherein the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid carries a CAR structure + CDbox; the nucleotide sequence of the CAR structure + CDbox is shown in SEQ ID NO:7.

[0047] In some specific embodiments, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid uses the PCDNA3.1 plasmid as its backbone.

[0048] This invention also provides a PCDNA3.1CD63-L7Ae / ZSGreen plasmid, wherein the PCDNA3.1CD63-L7Ae / ZSGreen plasmid carries CD63-L7Ae or CD63-ZSGreen; wherein the nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8, and the nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:9.

[0049] In some specific embodiments, the PCDNA3.1CD63-L7Ae / ZSGreen plasmid uses the PCDNA 3.1 plasmid as its backbone.

[0050] This invention also provides a method for preparing exosomes, comprising the following steps:

[0051] The exosomes were obtained by co-transfecting 293F cells with the CD3, CD4 or CD8 nanobody expression vector, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid and the PCDNA3.1CD63-L7Ae / ZSGreen plasmid, and then purified.

[0052] In some specific embodiments, the 293F cells are in mid-log phase, with a viable cell density of 2 × 10⁻⁶. 6 ~3×10 6 .

[0053] In some specific embodiments, the purification is specifically as follows: centrifuge at 300g for 5 min and collect the supernatant, centrifuge at 3000g for 30 min and collect the supernatant, centrifuge at 10000g for 1 h and collect the supernatant, filter at 0.22 μM, centrifuge at 100000g for 90 min, resuspend and wash with an equal volume of PBS, centrifuge at 100000g for 90 min again, and resuspend in 1640 complete culture medium.

[0054] The present invention also provides exosomes obtained by the preparation method described above.

[0055] In some specific embodiments, the exosomes contain amino acid sequences as shown in SEQ ID NO.1 to SEQ ID NO.3.

[0056] This invention also provides the use of the exosomes in the preparation of drugs for treating diseases caused by HIV.

[0057] This invention also provides a drug for treating HIV-induced diseases, including the exosomes.

[0058] Example 1

[0059] Construction of a specific CD3, CD4, and CD8 exosome packaging system

[0060] The specific steps are as follows:

[0061] 1. Construction of expression plasmids targeting CD3, CD4, and CD8 nanobodies

[0062] The amino acid sequence of Anti-CD3-Lamp2b is shown in SEQ ID NO:1:

[0063] *;

[0064] The amino acid sequence of Anti-CD4-Lamp2b is shown in SEQ ID NO:2:

[0065] MVCFRLFPVPGSGLVLVCLVLGAVRSYAGNSTMGSGEVQLLESGGGLVQPGGSLKLSCAASGFTFNTYAMNWVRQAPGKGLEWVARIRSKYNNYATYYADSVKDRFTISRDDSKNTAYLQMNNLKTEDTAVYYCVRHGNFGNSYVSWFAYWGQGTLVTVSSGGGGSGGGGSGGGGSELVVTQEPSLTVSPGGTVTLTCRSSTGAVTTSNYANWVQQKPGQAPRGLIGGTNKRAPGTPARFSGSLLGGKAALTLSGVQPEDEAEYYCALWYSNLWVFGGGTKLTVLGSGSGSGGSSLELNLTDSENATCLYAKWQMNFTVRYETTNKTYKTVTISDHGTVTYNGSICGDDQNGPKIAVQFGPGFSWIANFTKAASTYSIDSVSFSYNTGDNTTFPDAEDKGILTVDELLAIRIPLNDLFRCNSLSTLEKNDVVQHYWDVLVQAFVQNGTVSTNEFLCDKDKTSTVAPTIHTTVPSPTTTPTPKEKPEAGTYSVNNGNDTCLLATMGLQLNITQDKVASVININPNTTHSTGSCRSHTALLRLNSSTIKYLDFVFAVKNENRFYLKEVNISMYLVNGSVFSIANNNLSYWDAPLGSSYMCNKEQTVSVSGAFQINTFDLRVQPFNVTQGKYSTAQECSLDDDTILIPIIVGAGLSGLIIVIVIAYVIGRRKSYAGYQTLGSGYPYDVPDYA*;

[0066] The amino acid sequence of Anti-CD8-Lamp2b is shown in SEQ ID NO:3:

[0067] MVCFRLFPVPGSGLVLVCLVLGAVRSYAGNSTMGSGQLQLVESGGGLVQAGGSLRLSCAASGLTFEDYAIGWFRQAPGKEREGISCIRIYDGNTYSAESVKGRFTISSDNAKNQVYLQINTLKPEDTAVYYCAAGSYYSCSVYPDYDMDYWGKGTLVTVSSGSGSGSGGSSLELNLTDSENATCLYAKWQMNFTVRYETTNKTYKTVTISDHGTVTYNGSICGDDQNGPKIAVQFGPGFSWIANFTKAASTYSIDSVSFSYNTGDNTTFPDAEDKGILTVDELLAIRIPLNDLFRCNSLSTLEKNDVVQHYWDVLVQAFVQNGTVSTNEFLCDKDKTSTVAPTIHTTVPSPTTTPTPKEKPEAGTYSVNNGNDTCLLATMGLQLNITQDKVASVININPNTTHSTGSCRSHTALLRLNSSTIKYLDFVFAVKNENRFYLKEVNISMYLVNGSVFSIANNNLSYWDAPLGSSYMCNKEQTVSVSGAFQINTFDLRVQPFNVTQGKYSTAQECSLDDDTILIPIIVGAGLSGLIIVIVIAYVIGRRKSYAGYQTLGSGYPYDVPDYA*;

[0068] The nucleotide sequence of Anti-CD3-Lamp2b is shown in SEQ ID NO:4:

[0069]

[0070] The nucleotide sequence of Anti-CD4-Lamp2b is shown in SEQ ID NO:5:

[0071]

[0072] The nucleotide sequence of Anti-CD8-Lamp2b is shown in SEQ ID NO:6:

[0073]

[0074] Taking the BRD-PTK plasmid as an example, the specific experimental methods are described below: The CD3, CD4, and CD8 nanobodies were synthesized by Sangon Biotech Co., Ltd. When designing primers, homologous fragments of the expression vector were introduced at both ends of the nanobodiment fragments. The targeted expression vector BRD-PTK-Lamp2b was purchased from Invivo. The linearized vector was obtained through double enzyme digestion. The restriction sites of the BRD-PTK-Lamp2b vector were AgeI and BsrGI. The product was subjected to 0.7% agarose gel electrophoresis, and the gel was excised and collected in Eppendorf tubes. The corresponding fragments were recovered using a Tiangen agarose gel extraction kit, and the purity and concentration of the product were determined. Homologous recombination technology was used to recover fragments from the above-mentioned vectors and add them to Eppendorf tubes at a 1:2 molar ratio with nanobody fragments. Exnase II homologous recombinase (Vazyme) and 5×CE buffer were added, and the reaction was carried out at 37°C for 0.5 hours. 10 μL of the ligation solution was taken out and added to 100 μL of Stbl3 competent cells. After incubation on ice for 10 min, the cells were heat-shocked at 42°C for 45 s. After the reaction was completed, 500 μL of SOC medium was added and the cells were cultured at 37°C and 220 rpm for 1 hour. After 1 hour, the Eppendorf tubes were centrifuged at 4000 rpm for 1 min to remove 400 μL of excess liquid. The remaining liquid was spread onto LB agar plates containing amp and incubated at 37°C for 12 hours. Single colonies were picked from each plate and inoculated into 5 mL of LB liquid medium, incubated at 37°C and 220 rpm for 12 hours. Plasmids were extracted using a Tiangen miniprep kit to obtain plasmid BRD-PTK-CD3 / CD4 / CD8-Lamp2b. This plasmid was sent to Sangon Biotech (Shanghai) Co., Ltd. for first-generation sequencing verification and was found to be correct. A schematic diagram of plasmid construction is shown below. Figure 1 As shown.

[0075] 2. Construction of CAR mRNA expression plasmid and exosome packaging plasmid

[0076] The nucleotide sequence of the CAR structure + C / D box is shown in SEQ ID NO:7:

[0077]

[0078] Taking the PCDNA 3.1 plasmid as an example, the specific experimental method is described as follows: The single-chain antibody sequence of the broad-spectrum neutralizing antibody VRC01 was synthesized by Shanghai Bioengineering Co., Ltd. When designing primers, homologous fragments of the expression vector were introduced at both ends of the CAR fragment, and simultaneously, the N6 signal peptide, STREP2, Hinge, CD28TM+ICD, 4-1BB, and CD3ζ were inserted to obtain the CAR mRNA expression plasmid. The expression vector PCDNA 3.1 was purchased from Invivo. A linearized vector was obtained through double enzyme digestion. The restriction sites for the PCDNA 3.1 vector were NheI and BamHI. The product was subjected to 0.7% agarose gel electrophoresis, and the gel was excised and collected in Eppendorf tubes. The corresponding fragments were recovered using a Tiangen agarose gel extraction kit, and the purity and concentration of the product were determined. Homologous recombination technology was used to recover the above-mentioned vector fragments and nanobody fragments, adding them to Eppendorf tubes at a 1:2 molar ratio. Exnase II homologous recombinase (Vazyme) and 5×CE buffer were added, and the mixture was incubated at 37°C for 0.5 hours. 10 μL of the ligation solution was added to 100 μL of Stbl3 competent cells, incubated on ice for 10 min, and then heat-shocked at 42°C for 45 s. After this, 500 μL of SOC medium was added, and the cells were incubated at 37°C and 220 rpm for 1 hour. After 1 hour, the Eppendorf tubes were centrifuged at 4000 rpm for 1 min to remove 400 μL of excess liquid. The remaining liquid was plated on LB agar plates containing amp and incubated at 37°C for 12 hours. Single colonies were picked from each plate and inoculated into 5 mL of LB liquid medium, incubated at 37°C and 220 rpm for 12 hours. Plasmids were extracted using a Tiangen miniprep kit to obtain plasmid PCDNA3.1-N6SP-VRCO1 CAR-CDbox. A schematic diagram of plasmid construction is shown below. Figure 2 As shown.

[0079] 3. Construction of CD63 exosome packaging plasmid

[0080] The nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8:

[0081]

[0082] The nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:9:

[0083]

[0084] Taking the PCDNA 3.1 plasmid as an example, the specific experimental method is described as follows: The single-chain antibody sequence of the exosome marker protein CD63 was synthesized by Shanghai Bioengineering Co., Ltd. When designing primers, homologous fragments of the expression vector were introduced at both ends of the CD63 fragment, and L7Ae / ZSGreen was ligated to obtain the CD63 expression plasmid. The expression vector PCDNA 3.1 was purchased from Invivo and linearized by double enzyme digestion. The restriction sites of the PCDNA 3.1 vector were NheI and NotI. The product was subjected to 0.7% agarose gel electrophoresis, and the gel was excised and collected in Eppendorf tubes. The corresponding fragments were recovered using a Tiangen agarose gel extraction kit, and the purity and concentration of the product were determined. Homologous recombination technology was used to recover the above-mentioned vector fragments and nanobody fragments, adding them to Eppendorf tubes at a 1:2 molar ratio. Exnase II homologous recombinase (Vazyme) and 5×CE buffer were added, and the reaction was carried out at 37°C for 0.5 hours. 10 μL of the ligation solution was added to 100 μL of Stbl3 competent cells, incubated on ice for 10 min, and then heat-shocked at 42°C for 45 s. After this, 500 μL of SOC medium was added, and the cells were cultured at 37°C and 220 rpm for 1 hour. After 1 hour, the Eppendorf tubes were centrifuged at 4000 rpm for 1 min to remove 400 μL of excess liquid. The remaining liquid was plated on LB agar plates containing amp and cultured at 37°C for 12 hours. Single colonies were picked from each plate and inoculated into 5 mL of LB liquid medium, cultured at 37°C and 220 rpm for 12 hours, and plasmids were extracted using a Tiangen miniprep kit to obtain plasmid PCDNA3.1CD63-L7Ae / ZSGreen. A schematic diagram of plasmid construction is shown below. Figure 3 As shown.

[0085] Example 2: Preparation and purification of CAR-targeted exosomes

[0086] The specific steps are as follows:

[0087] 1. 293F cell resuscitation and culture

[0088] Thaw rapidly in a 37°C water bath. Transfer all contents of the cryovial to a 15mL centrifuge tube, add 4mL of HEK293F medium, gently mix, centrifuge at 300*g for 5 min, aspirate the supernatant, add 25mL of fresh, preheated HEK293F medium, mix well, and transfer to a 125mL shake flask. Incubate at 37°C in a 5% CO2 incubator with a shaker at 120-140rpm. When the viable cell density reaches 2×10⁻⁶ cells / mL... 6 ~3×10 6 When the cell count is 1000 / mL, passage the cells. The cell viability should be ≥90% and in mid-log phase.

[0089] 2. Exosome packaging

[0090] When the live cell density reaches 2×10 6 ~3×10 6 Simultaneously, the targeting plasmid, CD63 expression plasmid, and CAR plasmid were co-transfected into 293F cells. The cell suspension was gently pipetted approximately 20 times using a 10 mL pipette to obtain a single-cell suspension. 25 μg of the plasmid DNA mixture (PCDNA3.1CD63-L7Ae / ZSGreen, PCDNA3.1-N6SP-VRCO1 CAR-CDbox, and BRD-PTK-anti CD3 / CD4 / CD8-Lamp2b co-transfected) was added to 1 mL of HEK293F medium. 75 μL of filtered and sterilized PEI (polyethyleneimine) solution (1 mg / mL) was added to 1 mL of F medium. The mixture was thoroughly mixed using a pipette and allowed to stand for 5 min. After mixing, the mixture was incubated at room temperature for 30 min. The DNA / PEI mixture was then slowly added dropwise to the cells. 24 hours after transfection, supplement with 1 / 50 culture volume of L-glutamine and 1 / 20 culture volume of serum-free protein. 48 hours later, collect 1×10⁻⁶ samples. 6 After staining with FITC-G4S linker for 30 min, flow cytometry detected successful expression of CAR molecules in HEK293F cells. The results are as follows: Figure 4 As shown.

[0091] 3. Exosome purification

[0092] 72 h after transfection, the supernatant was collected after centrifugation at 300 g for 5 min, centrifuged at 3000 g for 30 min to remove cell debris, and centrifuged at 10000 g for 1 h. The supernatant was then filtered through 0.22 μM medium, centrifuged at 100000 g for 90 min, resuspended in an equal volume of PBS, washed, and centrifuged again at 100000 g for 90 min. The cells were then resuspended in 1640 g of complete culture medium. The purification process is as follows. Figure 5 As shown.

[0093] 4. Electron microscopy and NTA analysis of exosomes

[0094] The sample cell was rinsed with deionized water, and the instrument was calibrated with polystyrene microspheres (100 nm). The sample cell was then rinsed with 1× PBS buffer (Biological Industries, Israel). The sample was diluted with 1× PBS buffer and injected for analysis. NTA results showed that the purified exosomes were of a size of 30-150 nm. Figure 6(A) Prepared suspensions of exosomes, viruses, bacteria, etc. Pipette 20 μl of the suspension onto a copper grid and allow it to adsorb naturally for 5-10 minutes. Then, use filter paper to remove excess droplets and allow it to air dry slightly. Next, pipette 20 μL of 2% phosphotungstic acid solution onto the copper grid and let it stand for 3-5 minutes. Use filter paper to remove excess droplets and allow it to air dry under an incandescent lamp. Observe the purified exosomes under a transmission electron microscope and photograph the results as shown below. Figure 6 B.

[0095] 5. Exosome nanoflow cytometry detection

[0096] The exosome stock solution was diluted with 1×PBS to 1×10⁻⁶. 8 Particles / mL were added to each sample, along with 1 test of anti-human-CD63-PE and anti-G4S-linker-FITC flow cytometry antibodies for staining. The expression of exosome-specific marker proteins CD63 and CAR was detected. Results showed that CAR protein was successfully expressed on the exosome membrane surface. Figure 7 ).

[0097] Example 3: In vitro validation of the targeting properties of exosomes

[0098] With 2×10 5 PBMC target cells were seeded at a density in 12-well plates. After 24 hours, the culture medium was removed, and the cells were incubated for another 24 hours with a ZSGreen exocrine body suspension concentration of 1 mg / mL. The specific steps are as follows:

[0099] 1. Observation of cell targeting using laser confocal microscopy

[0100] Cells were washed with pre-cooled PBS buffer to remove residual culture medium. Immediately, 4% paraformaldehyde (PFA) fixative was added. Fixation was performed at room temperature for 15 min. After washing with PBS to remove residual fixative, cells were treated with 0.5% Triton X-100 for 5 min, followed by PBS washing to remove permeabilization solution. Excess PBS was removed from the slides, and the slides were mounted with mounting medium. After the mounting medium solidified, observation was performed using laser confocal microscopy. The results showed that the specifically targeted CAR-exo successfully fused with the target cells. Figure 8 ).

[0101] Example 4: Exosome-mediated in vitro targeted CAR-T cell formation

[0102] With 2×10 5PBMC target cells were seeded at a density in 12-well plates. After 24 hours, the culture medium was removed by centrifugation, and the cells were resuspended with exocrine secretions containing CAR mRNA specifically targeting CD3, CD4, and CD8 to a concentration of 1 mg / mL. The cells were incubated for another 24 hours. The supernatant was discarded, and 1 mL of FBS washing buffer (containing 2% FBS + PBS) was added and the cells were resuspended by centrifugation at 500g for 5 min. The supernatant was then discarded. 100 μL of 1 μg / mL anti-G4S Linker-FITC was added to each centrifuge tube, followed by the addition of anti-hu-CD3-APC-cy7, anti-hu-CD4-APC, and anti-hu-CD8-BV421 to a final concentration of 1 μg / mL in each centrifuge tube to resuspend the cells. The cells were incubated at 4°C in the dark for 30 minutes, washed three times, centrifuged at 500 g for 5 minutes, washed three times with 200 μL FBS washing buffer, and then analyzed by flow cytometry. The flow cytometry results showed that the exosomes purified by this method successfully targeted PBMCs in vitro and were transformed into CAR-T cells.

[0103] Example 5: In vitro targeted modification of T cells and their killing effect

[0104] Cultured positive target cells (293T-trimer-NL4-EGFP) and negative target cells (MLV-293T) were collected separately. After counting with a hemocytometer, the corresponding number of cells from each cell type were transferred to labeled 15mL centrifuge tubes. 10mL of LDM MEM complete medium was added to each tube, and the cells were centrifuged at 300g for 5 minutes, discarding the supernatant. 0.3mL of complete medium was added to each tube to resuspend the cells, bringing the cell density to 1×10⁻⁶ cells / mL. 6 / mL. Add 10μL of 2.5 mM Calcein-AM to 1mL of cell suspension to make the working solution concentration 25μM, and incubate at 37℃ for 30min. After 30min incubation, remove the target cells from the incubator, add 10mL of tumor-killing buffer to each tube of target cells, centrifuge at 300g for 5min, and discard the supernatant. Repeat the washing three times, and resuspend the cells in each tube with 3mL of complete culture medium. At this time, the cell suspension density is 1×10⁻⁶. 5 / mL, 100μL of cells per well, three replicates. CAR-targeted CAR-T cells and untreated PBMCs were collected, and the effector cells per well were calculated at effector-target ratios of 100:1, 25:1, 5:1, 1:1, 0.1:1, and 0.01:1, respectively.

[0105] Mark the areas on the 96-well plate with transparent U-shaped wells, and add 100 μL of target cells labeled with Calcein-AM to the corresponding wells.

[0106] Add 1 μg / μL of exosomes to the corresponding wells, performing 3 replicates for each dilution, and finally add complete culture medium to 200 μL; add 100 μL of lysis buffer and 100 μL of tumor-killing buffer to the corresponding wells (3 replicates each). Place the U-bottom 96-well plate in a 37°C thermostatic incubator and incubate for 12 hours.

[0107] 1. Calcein detection

[0108] Remove the 96-well plate from the incubator, centrifuge at 500g for 10 min, and collect 150 μL of supernatant from each well, transferring it to a flat-bottomed 96-well plate. Measure the absorbance of each well using a microplate reader with fluorescence colorimetry. Spectrophotometer settings: excitation wavelength 485 / 20 nm; emission wavelength 530 / 25 nm; scan each well for 0.1 to 1 s. Calcein detection results indicate that CAR-T cells constructed using CAR-exo targeting exhibit dose-dependent cytotoxicity against a simulated HIV-infected cell model. Figure 10 ).

[0109] 2. Granulase perforin detection

[0110] After co-incubation in the previous step, the supernatant was used to detect the granzyme B and perforin content in the supernatant using the Solarb human granzyme B and human perforin ELISA kits. The results were consistent with the calcein killing results. Figure 11 ).

[0111] Example 6: Humanized mouse modeling and in vivo targeted CAR-T cell formation

[0112] This part of the experiment was conducted in an SPF-grade animal facility. Suitable 6-week-old NPG mice were selected and, after 3 days of acclimatization, divided into 4 groups of 5 mice each, maintaining relative uniformity in weight and condition among the four groups. In an SPF-grade barrier environment, all four groups of mice were simultaneously injected via tail vein with 200 μL of human PBMCs resuspended in physiological saline (5 × 10⁶). 6 Immunological reconstitution was performed only on humanized mice. At week 5, approximately 150 μL of submandibular venous blood was collected from mice transplanted with human PBMCs. The blood was anticoagulated with EDTA, and then twice the volume of whole blood was added with erythrocyte lysis buffer. The cells were lysed on ice for 10 min, centrifuged at 500g for 10 min, and the supernatant was discarded. The cells were resuspended in 100 μL of physiological saline. HuCD45+ antibody was added, and the cells were stained at 4℃ for 30 min. After washing three times, the proportion of surviving human CD45+ lymphocytes in the peripheral blood was detected by flow cytometry. When the proportion of human CD45+ in the peripheral blood was greater than 45%, 3 × 10⁶ cells were injected intravenously via the tail vein. 11Photons / dose of CD3, CD4, CD8, and FLAG-targeted exosomes for treatment. Two days after injection, blood was collected from the submandibular vein of mice, and flow cytometry analysis of CAR+ cells in peripheral blood PBMCs showed that this study is the first to successfully transform T cells into CAR-T cells using CAR-exo exosomes in humanized mice. Figure 12 ).

[0113] Example 7: Targeted exosome in vivo therapy

[0114] 1. Small animal imaging detection of antiviral effects

[0115] This part of the experiment was conducted in a biosafety level 3 laboratory. The HIV-1 NL4-3 strain is a wild-type virus of the X4 strain and has the ability to infect peripheral blood CD4+ T cells. Five NPG mice from each of the four groups were intraperitoneally injected with 4 × 10⁴ NPG cells. 5 HIV-1 NL4_3-nanoluconide virus TCID 50 / mL / animal was administered via intraperitoneal injection of furimazine 50μg / animal weekly after infection. Imaging was used to detect viral replication in vivo. Viral activity was assessed when the fluorescence signal ROI value reached 10. 6 ~10 7 The number of photos per second is sufficient to determine if the infection model has been successfully constructed.

[0116] Exosomes possess the unique ability to interact with recipient cells. Exosomes are extracellular vesicles composed of cell membranes that attach to target cells via a series of surface adhesion proteins and carrier ligands (tetrapeptides, integrins, CD11b, and CD18 receptors), delivering their payload to the target cells. Exosomes, depending on their characteristics and origin, exhibit specific cell-specific properties, which can be used to target diseases for therapeutic purposes.

[0117] The design of the HIV-infected mouse model and treatment experiment is shown in the diagram. Figure 13 In humanized mice, starting on day 14 post-infection, 1×10⁻⁶ mice were administered intravenously via tail vein weekly. 11 Photons / Treatment only, CAR-exo exosome antiviral efficacy results as follows: Figure 13 As shown in Figure B, the fluorescence quantification results are as follows: Figure 13 As shown in Figure C. The results indicate that CAR-exo has a significant antiviral effect in a humanized mouse model of HIV infection.

[0118] 2. Molecular virology testing for antiviral efficacy

[0119] Quantitative analysis of viral DNA and RNA from mouse peritoneal macrophages and bone marrow:

[0120] Total DNA and RNA were extracted from peritoneal macrophages and bone marrow of mice 5 weeks after treatment. The copy number of the gag gene in the spleen and blood tissue of infected mice was quantified using real-time quantitative PCR (Tables 3 and 4) with specific gag primers and probes (Table 2). Simultaneously, β-globin was used as an internal reference gene, and the copy number of the β-globin gene per μL of infected mice was quantified using specific β-globin primers and probes. After standardization, the copy number per 10 μL of infected mice was calculated. 6 Copy number of gag gene DNA in tissue cells. After reverse transcription RT, total RNA was quantified by real-time quantitative PCR using specific gag primers and probes (Table 2) to determine the copy number of the gag gene in RNA from infected mouse spleen and blood tissues. The human GADPH gene was used as an internal reference gene, and specific human GADPH primers and probes were used to quantify the RNA concentration per μL. After standardization, the copy number of gag gene RNA per μg of RNA was calculated.

[0121] Table 1 Primers and probes for quantitative real-time PCR

[0122] Primer name Primer sequence (5′→3′) Size (bp) Gag-F GGACCAGGAGCGACACTAGAA 21 Gag-R CAGCCAAAACTCTTGCTTTATGG 22 Gag-P FAM-GTGCTAAGCAGTTGGTGGT-MGB 19 HGADPH-F ACAGCCTCAAGATCATCAGCA 21 HGADPH-R ATGAGTCCTTCCACGATACCA 21 HGADPH-P FAM-GTGCTAAGCAGTTGGTGGTGCAGGA-MGB 25 β-globin F CACAAGTATCACTAAGCTCGCTTTCT 26 β-globin R TCATAATATCCCCCAGTTTAGTAGTTGG 28 β-globin-P FAM-CTGTCCAATTTCTATTAAAG-MGB 20 LTR-R GGCGCCACTGCTAGAGATTTT 21 Alu-R CTCACGCCTGTAATCCCAGCA 21

[0123] Table 2. Quantitative Real-Time PCR Reaction System

[0124] reaction system Amount added (µL) 2×AceQ qPCR Probe Master Mix 12.5 Upstream primer (HIV-1 12.0F) 90 µmol / L 0.5 Downstream primer (HIV-1 12.0R) 90 µmol / L 0.5 TaqMan probe (HIV-1 12.0P) 10 µmol / L 0.5 Water (free of RNase and DNase) 10 template 1

[0125] Table 3 Real-time quantitative PCR reaction procedure

[0126]

[0127] The results of total DNA and RNA quantification are as follows: Figure 14 As shown in Figures A and B. The results showed that CAR-exo significantly reduced the viral DNA and RNA load in peritoneal macrophages and bone marrow cells of HIV-humanized mice.

[0128] 3. Quantification of pre-integration viral DNA in mice

[0129] To quantify HIV copies of the pre-integrated virus in mouse cells, this invention first prepared an integration standard curve and used two-step PCR amplification, including a first round of 12 cycles of linear amplification (Table 5), followed by nested real-time quantitative PCR detection (Tables 3 and 4).

[0130] This invention uses the genomic DNA of Jurkat-EGFP-mCherry double-labeled cells constructed in our laboratory as an integrated HIV standard. The Jurkat-EGFP-mCherry double-labeled cells are infected by co-transfection with HIV NL4-3 plasmid with envelope gp120 deficiency and vesicular stomatitis virus (VSV-G) envelope plasmid. After infection with the cells, the pseudovirus cannot replicate to produce progeny viruses. After 20 passages of cells, the non-integrated HIV genome is reduced to extremely low copies or even absent. The total genomic DNA of the cells after 20 passages is extracted, and the integrated HIV genome standard is absolutely quantified and used as a standard for detecting HIV-1 pre-integration.

[0131] The concentration of integrated HIV genomic DNA was 10. 5 The standard, with a copy number per µL, was serially diluted 10-fold while simultaneously adding genomic DNA from uninfected cells to ensure the same total DNA concentration across all concentration gradients and consistent amplification efficiency. The integration standard was pre-amplified for 12 cycles using the first-round specific Alu-LTR pre-amplification primers (Table 2). The test samples were pre-amplified using either the first-round specific Alu-LTR pre-amplification primers or a single LTR primer. The amplification products were then subjected to a second round of nested PCR amplification using gag-specific primers (Table 2). The difference between the Alu-LTR pre-amplification and the single LTR primer amplification yielded the pre-integration viral genome copy number. Simultaneously, the copy number was standardized based on the previously determined β-globin gene copy number per µL, and the result was calculated for every 10 µL of β-globin gene. 6 The copy number of HIV viral DNA in cells before integration. Integration standard curve results are shown below. Figure 15 The results of measuring the pre-integration viral load in the spleen and peripheral blood of HIV-infected mice (A and B) are as follows: Figure 15 C and D. The results showed that CAR-exo successfully reduced the HIV proviral load in the spleen and peripheral blood of HIV-infected mice.

[0132] Table 4. First-round pre-amplification PCR reaction procedure

[0133]

[0134] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A method for preparing an exosome, characterized by, The method comprises the following steps: The target CD3 or CD8 nanobody expression vector is co-transfected with the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, the PCDNA3.1CD63-L7Ae plasmid and the PCDNA3.1CD63-ZSGreen plasmid into 293F cells, and the exosomes are obtained by purification; The target CD3 nanobody expression vector takes EF-1a as a promoter, and sequentially connects a Kozak sequence and an Anti-CD3-Lamp2b fragment downstream of the promoter; the sequence of the Anti-CD3-Lamp2b fragment is shown as SEQ ID NO: 4, The target CD8 nanobody expression vector takes EF-1a as a promoter, and sequentially connects a Kozak sequence and an Anti-CD8-Lamp2b fragment downstream of the promoter; the sequence of the Anti-CD8-Lamp2b fragment is shown as SEQ ID NO: 6; The PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid carries a CAR structure + CDbox; the nucleotide sequence of the CAR structure + CDbox is shown as SEQ ID NO: 7; The PCDNA3.1CD63-L7Ae plasmid carries CD63-L7Ae; the nucleotide sequence of the CD63-L7Ae is shown as SEQ ID NO: 8; The PCDNA3.1CD63-ZSGreen plasmid carries CD63-ZSGreen; the nucleotide sequence of the CD63-ZSGreen is shown as SEQ ID NO:

9.

2. The production method according to claim 1, characterized by, The purification is specifically as follows: 300g centrifugation for 5min to take supernatant, 3000g centrifugation for 30min to take supernatant, 10000g centrifugation for 1h to take supernatant, 0.22μM filtration, 100000g centrifugation for 90min, equal volume PBS resuspension and washing, 100000g centrifugation for 90min again, and 1640 complete medium resuspension.

3. The exosomes obtained by the preparation method of claim 1 or 2.

4. The use of the exosomes of claim 3 in the preparation of a drug for treating HIV infection.

5. A medicament for the treatment of HIV infection, characterized in that, The exosomes of claim 3 are included.

Citation Information

Patent Citations

  • VC-CAR molecule and application thereof to HIV-1 infection cell clearing

    CN106279432A

  • Engineered exosome and application thereof in rapid generation of CAR-T cells

    CN117887666A

  • Preparation and application of bispecific heavy chain antibody targeting GPC3 and CD3

    CN118955723A

  • Targeted extracellular vesicles comprising membrane proteins with engineered glycosylation sites

    US20170087087A1