Design method and application of CAR-T cell model targeting human TROP2

Abstract

The invention relates to a design method of a CAR-T cell model targeting human TROP2 and application of the CAR-T cell model in triple negative breast cancer. The method comprises the following steps: obtaining protein sequences of a light chain and a heavy chain by utilizing a sequence of a targeting drug of the human TROP2; comparing the protein sequences of the light chain and the heavy chain with the sequence of the drug protein, and removing the same sequence part to obtain a variable protein sequence; transforming the variable protein sequence into a base sequence to respectively obtain base sequences of a light chain variable region and a heavy chain variable region, and adding a signal peptide and a connecting region to synthesize two base sequences to obtain a human TROP2 antibody sequence fragment; the preparation method comprises the following steps: synthesizing plasmids carrying a human TROP2 antibody sequence fragment by taking an SFG retroviral vector as a skeleton; and enabling the human T cells to express a target gene through transfection. In the embodiment, the nucleic acid sequence of the human TROP2 antibody as shown in SEQ ID NO.1 and SFG are used as carriers, a retrovirus transfection system is used for constructing a TROP2. CAR-T cell model, the functionality of the TROP2. CAR-T cell on the triple negative breast cancer is defined, and a new method is provided for clinical treatment of the triple negative breast cancer.

Description

Technical Field

[0001] The disclosed embodiments relate to the field of genetic engineering technology, and in particular to a design method for a CAR-T cell model targeting human TROP2 and its application, for example, for triple-negative breast cancer. Background Art

[0002] Breast cancer is the most common malignant tumor in women worldwide. Triple-negative breast cancer (TNBC) accounts for 10%-20% of all breast cancer pathological types, with a high recurrence and metastasis rate and a poor prognosis. Due to the biological characteristics of TNBC itself, there is a lack of effective targets and targeted treatment is impossible. Therefore, TNBC urgently needs to explore new treatment methods. Currently, immunotherapy based on chimeric antigen receptor (CAR) T cells that directly guide the patient's immune system to recognize and eradicate tumor cells expressing tumor-associated antigens (TAAs) is being explored as a treatment for TNBC.

[0003] As an emerging immunotherapy, CAR-T has achieved excellent results in the field of tumor research and clinical treatment. CD19 CAR-T is used for relapsed and refractory childhood and adult acute lymphoblastic leukemia, with a complete remission rate of up to 90% (NCT01044069). However, in most solid tumors, the effect of CAR-T immunotherapy is still not ideal. Due to the lack of ideal target antigens in solid tumors and the presence of complex immunosuppressive factors in their tumor microenvironment, the therapeutic effect of CAR-T is significantly affected. At present, most solid tumors, including breast cancer, still do not have efficient and safe CAR-T therapies available for clinical application. As a treatment method for TNBC under exploration, CAR-T immunotherapy has many bottlenecks to overcome, the most critical of which is to determine specific tumor antigens and design effective CAR-T molecules.

[0004] Therefore, it is necessary to improve one or more problems existing in the above-mentioned related technical solutions.

[0005] It should be noted that this section is intended to provide background or context for the technical solutions of the present disclosure stated in the claims. The description herein is not admitted to be prior art by virtue of being included in this section. Summary of the invention

[0006] The purpose of the embodiments of the present disclosure is to provide a design method for a CAR-T cell model targeting TROP2, thereby overcoming one or more problems caused by the limitations and defects of related technologies, at least to a certain extent.

[0007] The present disclosure provides a method for designing a CAR-T cell model targeting TROP2, comprising the following steps:

[0008] S100, obtain the human TROP2 antibody sequence;

[0009] S200, construction of viral vector carrying target gene;

[0010] Wherein, S100 includes steps S101-S103:

[0011] S101, using the sequence of the drug targeting human TROP2 to obtain the protein sequences of the light chain and heavy chain;

[0012] S102, comparing the protein sequences of the light chain and the heavy chain with sequences of other drug proteins other than the targeted drug, removing identical sequence portions, and obtaining variable protein sequences;

[0013] S103, converting the variable protein sequence into a base sequence to obtain the base sequences of the light chain variable region and the heavy chain variable region, respectively, adding a signal peptide and a linker region to synthesize two base sequences, and obtaining a human TROP2 antibody sequence fragment;

[0014] S200 includes steps S201-S202:

[0015] S201, using gene cloning technology and SFG retroviral vector as the backbone, synthesized a plasmid carrying the human TROP2 antibody sequence fragment;

[0016] S202, expressing target genes in artificial T cells by transfection.

[0017] In one embodiment of the present disclosure, other drug proteins besides the targeted drug include HER2.

[0018] In one embodiment of the present disclosure, in S103, after adding the signal peptide and the linker region, the corresponding base sequences are synthesized with the light chain variable region and the heavy chain variable region in front as partitions.

[0019] In one embodiment of the present disclosure, in S103, SFG is used as a carrier to convert the variable protein sequence into a base sequence to obtain the base sequences of the light chain variable region and the heavy chain variable region, respectively.

[0020] In one embodiment of the present disclosure, the nucleic acid sequence of the human TROP2 antibody is shown as SEQ ID NO.1.

[0021] In one embodiment of the present disclosure, the nucleic acid sequence of the viral vector carrying the target gene is shown as SEQ ID NO.2.

[0022] The present invention also provides a viral vector, which is obtained by using the method for designing a CAR-T cell model targeting TROP2 described in any of the above embodiments.

[0023] The present invention also provides a cell medicine composition, which comprises the virus vector.

[0024] The present invention also provides an application of the pharmaceutical composition, using the viral vector or the pharmaceutical composition in the preparation of a drug for treating breast cancer.

[0025] The technical solution provided by the embodiments of the present disclosure may have the following beneficial effects:

[0026] The design method of the CAR-T cell model targeting TROP2 in the disclosed embodiments uses the nucleic acid sequence of the human TROP2 antibody shown in SEQ ID NO.1 and SFG as a vector, and utilizes a retroviral transfection system to construct a TROP2.CAR-T cell model, thereby clarifying the functionality of TROP2.CAR-T cells against triple-negative breast cancer, and providing a new method for the clinical treatment of triple-negative breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings herein are incorporated into the specification and constitute a part of the specification, illustrate embodiments consistent with the present disclosure, and together with the specification are used to explain the principles of the present disclosure. Obviously, the accompanying drawings described below are only some embodiments of the present disclosure, and for ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without creative work.

[0028] Figure 1 A flowchart showing a method for designing a TROP2-targeting CAR-T cell model in an exemplary embodiment of the present disclosure;

[0029] Figure 2 A flowchart showing a method for designing a TROP2-targeting CAR-T cell model in yet another exemplary embodiment of the present disclosure;

[0030] Figure 3 A structural diagram showing a SFG carrier in an exemplary embodiment of the present disclosure;

[0031] Figure 4 A schematic diagram showing tumor cell plating in an exemplary embodiment of the present disclosure is shown;

[0032] Figure 5 A schematic diagram of a co-cultivation experiment in an exemplary embodiment of the present disclosure is shown;

[0033] Figure 6 A diagram showing the culture results of four types of tumor cells in a co-culture experiment in an exemplary embodiment of the present disclosure;

[0034] Figure 7 The expression of Daudi cell line and Daudi-TROP2 in the exemplary embodiment of the present disclosure is shown;

[0035] Figure 8 The killing of tumor cells by CAR.TROP2 with different expressions in the exemplary embodiments of the present disclosure is shown;

[0036] Fig. 9 The division and proliferation of CAR.TROP2 cells after co-culture with Daudi cell lines and Daudi-TROP2 cells in an exemplary embodiment of the present disclosure are shown;

[0037] Fig.10 A diagram showing an in situ tumor in vivo experiment plan in an exemplary embodiment of the present disclosure;

[0038] Fig.11 A diagram showing the results of detecting bioluminescent signals of tumors in mice in an exemplary embodiment of the present disclosure;

[0039] Fig.12 A diagram showing the results of the treatment with CAR19 and TROP2.CAR-T for the orthotopic tumor model of triple-negative breast cancer in NSG mice in an exemplary embodiment of the present disclosure;

[0040] Fig.13 A diagram showing a plan of an in vivo experiment on lung metastasis in an exemplary embodiment of the present disclosure;

[0041] Fig.14 A diagram showing the monitoring of bioluminescent signals of tumors in mice according to an exemplary embodiment of the present disclosure. DETAILED DESCRIPTION

[0042] Example embodiments will now be described more fully with reference to the accompanying drawings. However, example embodiments can be implemented in a variety of forms and should not be construed as limited to the examples set forth herein; rather, these embodiments are provided so that the disclosure will be more comprehensive and complete and to fully convey the concepts of the example embodiments to those skilled in the art. The described features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0043] In addition, the accompanying drawings are only schematic illustrations of the embodiments of the present disclosure and are not necessarily drawn to scale. The same reference numerals in the figures represent the same or similar parts, and their repeated descriptions will be omitted. The experimental methods in the embodiments are conventional methods unless otherwise specified. The experimental materials used in the embodiments are conventional biochemical reagents unless otherwise specified.

[0044] This example embodiment provides a design method for a CAR-T cell model targeting TROP2, please refer to Figure 1 and Figure 2 , the method may include steps: S100 and S200.

[0045] Specifically, S100, obtaining human TROP2 antibody sequence;

[0046] S200, construct a viral vector carrying the target gene.

[0047] Further, S100 includes steps S101-S103:

[0048] S101, using the sequence of the drug targeting human TROP2 to obtain the protein sequences of the light chain and heavy chain.

[0049] S102, comparing the protein sequences of the light chain and heavy chain with the sequences of other drug proteins (such as HER2) other than the targeted drug, removing the identical sequence parts, and obtaining variable protein sequences.

[0050] S103, converting the variable protein sequence into a base sequence, obtaining the base sequences of the light chain variable region and the heavy chain variable region respectively, adding a signal peptide and a connecting region to synthesize two base sequences, and obtaining a human TROP2 antibody sequence fragment. The nucleic acid sequence of the human TROP2 antibody is as shown in SEQ ID NO.1 5'→3':

[0051] CAGGTTCAACTCCAGCAGTCAGGCTCAGAATTGAAGAAGCCTGGAGCCAGCGTGAAAGTCTCCTGCAAAGCAAGCGGATATACCTTTACAAACTATGGCATGAATTGGGTGAAACAAGCACCTGGCCAGGGCCTTAAATGGATGGGCTGGATAAACACCTATACAGGTGA ACCAACCTACACCGACGACTTCAAGGGCAGGTTTGCCTTCTCCCTGGACACGAGTGTGAGTACCGCCTACCTCCAGATTTCTTCTTTGAAGGCCGATGATACCGCCGTGTACTTTTGCGCAAGAGGAGGCTTCGGTAGCAGTTACTGGTACTTTGATGTTTGGGGCCAGG GTTCACTCGTCACCGTGAGTTCAATTCAGTTGACTCAATCCCCCAGTTCCCTTTCAGCCTCTGTTGGGGACCGGGTCAGCATCACTTGCAAGGCATCACAGGATGTGTCCATTGCAGTGGCTTGGTATCAACAGAAACCAGGGAAGGCCCCTAAGTTGCTCATCTATAGC GCATCTTACCGCTATACCGGGGTGCCTGATAGGTTTAGCGGCAGTGGCTCCGGCACTGACTTTACTCTGACAATCTCTAGCCTGCAGCCTGAGGACTTTGCCGTTTACTACTGCCAGCAGCACTATATCACGCCCCTTACCTTCGGTGCTGGAACAAAGGTCGAGATCAAG

[0052] Specifically, the variable protein sequence is converted into a base sequence using SFG as a carrier to obtain the base sequences of the light chain variable region and the heavy chain variable region, respectively. After adding the signal peptide and the connecting region, the light chain variable region and the heavy chain variable region are partitioned in front to synthesize the corresponding base sequences.

[0053] Please refer to Figure 3 , S200 includes steps S201-S202:

[0054] S201, using gene cloning technology and SFG retroviral vector as the backbone, synthesized a plasmid carrying the human TROP2 antibody sequence fragment;

[0055] S202, the artificial T cells are made to express the target gene by transfection. The nucleic acid sequence of the viral vector carrying the target gene is shown in SEQ ID NO.2 5'→3':

[0056]

[0057] In this embodiment, the nucleic acid sequence of the human TROP2 antibody shown in SEQ ID NO.1 and SFG are used as vectors, and a TROP2.CAR-T cell model is constructed using a retroviral transfection system to clarify the functionality of TROP2.CAR-T cells against triple-negative breast cancer, providing a new method for the clinical treatment of triple-negative breast cancer.

[0058] The specific construction process of the TROP2-targeting CAR-T cell model of the present application is described below.

[0059] Example 1: Acquisition of human TROP2 antibody sequences

[0060] First, we found Sacituzumab, the current TROP2 targeted drug, and obtained the protein sequences of the light chain and heavy chain based on its public sequence. By comparing with the sequences of HER2 or other drug proteins, we removed the same parts and obtained the variable regions. Then, we converted the protein sequence into a base sequence, and obtained the base sequences of the light chain variable region VL and the heavy chain variable region VH, respectively. On this basis, we added the signal titanium SP and the linker region, and used VL and VH in front as a distinction, and synthesized two base sequences to obtain the antibody sequence fragment, as shown in SEQ ID NO.1.

[0061] Example 2: Plasmid construction

[0062] Using gene cloning technology, SFG retroviral vectors are used as the backbone to synthesize plasmids carrying different gene fragments (SFG.TROP2 (VH-VL).28Z), and human T cells are transfected to stably express specific target genes. CAR with CD28 molecules as co-stimulatory signals connects the gene encoding the anti-human TROP2 antibody scFV to the extracellular, transmembrane and intracellular domains of the human CD28 molecule and CD3 (intracellular segment encoding gene) through the CD8a hinge region.

[0063] First, the DNA fragments of VL and VH were obtained by synthesis, and SFG was used as the vector (vector) as shown in the structure diagram Figure 3 As shown. The two parts in the figure are the parts that Insert needs to overlap with Vector. The parts that VH and VL need to overlap are Linker and the initial end bases. Take SFG.TROP2(VL-VH).28Z as an example. Then TROP2Linker_VH_F+TROP2VH_Hinge_R can get Linker part + VH + Hinge part. Finally, homologous recombination connection with Vector can be performed to obtain SFG.TROP2(VL-VH).28Z plasmid.

[0064] The SFG.TROP2(VH-VL).28Z plasmid was constructed based on the same method.

[0065] The functionality of CAR.TROP2 in the treatment of triple-negative breast cancer is verified below.

[0066] Human T cells were made to stably express CAR.TROP2 through a retroviral stable transfection system (the experimental data takes VH-VL as an example).

[0067] 1. In vitro experiments

[0068] 1. The GFP fluorescent protein was stably expressed in MDA-MB-231, MDA-MB-468, HCC1806 and HCC1937 cells through the stable transfection system, in preparation for the next in vitro experiment. After transfection, the expression rate of GFP fluorescent protein was close to 100% through flow cytometry sorting.

[0069] 2. Evaluate the killing function of TROP2CAR-T cells by co-culturing with target tumor cells (triple-negative breast cancer cells).

[0070] First, a single round of in vitro tumor killing experiment was used to evaluate the tumor killing ability of genetically modified TROP2 CAR-T cells. The tumor cell line used was a human triple-negative breast cancer cell line that was positive for TROP2 expression. The tumor cell lines used in the in vitro killing experiment all stably expressed GFP for direct observation in FACS.

[0071] 3. Construction of CAR-T cells expressing TROP2 antibody

[0072] According to the prepared SFG.TROP2(VH-VL)(IRES)mcherry plasmid, 293T cells were transfected to obtain the corresponding retroviral suspension. The CAR plasmid was transfected into activated human PBMCs by the retroviral stable transfection method, and the control group SFG.CD19.28z and SFG.TROP2(VH-VL)(IRES)mcherry plasmids were transfected respectively. The cells used for functional experiments were guaranteed to have a transfection efficiency of more than 80%.

[0073] 4. Cultivation of human T cells

[0074] (1) The transfected human T cells are cultured in T cell culture medium, IL7 (10 ng / mL) and IL-15 (5 ng / mL) are added, and fresh culture medium containing the above cytokines is supplemented every 3 days. Generally, the cells are cultured until the 12th to 14th day after the initial transfection, which is the same time point as the clinical T cell adoptive therapy, and the cells can be collected for subsequent experiments. The phenotype of T cells expanded by this in vitro culture is similar to effector-memory T cells (TEM) and memory T cells (TM). All cells are replaced with old culture medium one day before co-culture with tumor cells and resuspended in T cell culture medium without IL7+IL-15. The purpose of this step is to remove the interference of IL7+IL-15 on T cell function during the culture process, that is, "rest".

[0075] (2) Preparation before the co-culture experiment of triple-negative breast cancer cells.

[0076] Prepare cells the day before the functional experiment. First, observe the cell status under an inverted microscope. The cells need to grow well and the density should reach more than 50% of the bottom area of ​​the T25 culture flask. Take the cells to be passaged and place them in a biosafety cabinet. Aspirate the old culture medium, add an appropriate amount of 1×PBS to rinse, and aspirate the PBS; add an appropriate amount of 0.05% trypsin-EDTA solution to the culture flask. Be careful not to impact the cells with the added liquid. Try to add it gently from the side wall so that the liquid covers the cell surface and place it in a cell culture incubator for digestion. When it is observed under an inverted microscope that almost all cells have become rounded, the distance between cells has increased, and they have not fallen off the flask wall, immediately add complete culture medium containing 10% FBS to terminate digestion. The cell digestion time is 3 to 5 minutes to avoid excessive digestion and damage to the cells; repeatedly blow the cells with a pipette, pay attention to moderate strength and sufficient blowing; transfer the obtained single cell suspension into a 15mL centrifuge tube and centrifuge at 400g for 5 minutes at room temperature. After discarding the supernatant, add fresh culture medium, gently blow to make the cells evenly distributed, and take 200ul of cell suspension for counting using flow cytometer. The final number is 1×10 5 / well density is evenly placed in a 12-well plate. See the schematic diagram of the plate laying for Figure 4 , taking MDA-MB-231 and MDA-MB-468 as examples.

[0077] (3) Tumor killing experiment

[0078] Three groups of CAR-T cells were RESTed while plating. After overnight, the three groups of CAR-T cells were counted separately, and the number of positively expressed cells was calculated by staining. After calculation according to different E:T ratios, they were added to the corresponding wells. 1 ml of T cell culture medium was added to the Turmor only wells, which was recorded as D0. At D3, the supernatant suspension cells and the adherent cells in the wells were collected at the same time, and the number of remaining tumor cells and CAR-T cells was determined by flow cytometry. Verified by more than 3 donors, compared with the negative reference group CAR19 cells, which are also CAR-T cells, CAR.TROP2 cells have a clear killing function, and can also show a strong killing function when the tumor load increases ( Figure 5 and Figure 6 ), CD3 staining represents CAR-T cells, GFP represents tumor cells, E represents effector T cells, and T represents tumor cells.

[0079] (4) Tumor-specific killing experiment

[0080] In order to verify the target specificity of CAR.TROP2 cells in killing tumor cells, we selected Daudi cells that do not express TROP2 antigen and conducted corresponding experiments. First, we prepared the SFG.TROP2.i.NGFR plasmid through molecular cloning technology. Cells transfected with this plasmid can express TROP2 antigen. We used the retroviral stable transfection system to transform Daudi cells from a cell line that does not express TROP2 to a cell line that expresses TROP2, and used flow cytometry to detect whether the overexpression was successful. Figure 7 , constructed a Daudi cell line expressing TROP2 antigen.

[0081] After constructing the cell line, CAR.TROP2 cells were used to perform killing experiments on the two cell lines. The experimental method is similar to that mentioned above. It should be noted that the Daudi cell line is a suspension cell and does not need to be plated one day in advance. Sufficient cells can be taken for the experiment on the same day, and the co-culture killing experiment of suspension cells can be carried out in a 24-well plate. Verified by more than 3 donors, CAR.TROP2 cells have no killing function on Daudi cells that do not express TROP2 ( Figure 8 ), while Daudi-TROP2 cells overexpressing TROP2 could be killed, demonstrating the specificity of CAR.TROP2 cell killing.

[0082] (5) CTV staining to evaluate the proliferation ability of CAR-T cells after tumor activation

[0083] Fluorescent dye CTV is a fluorescent dye that can label living cells in vitro or in vivo. The fluorescence intensity of CTV will gradually decrease as the cells divide and proliferate, and the labeled fluorescence is evenly distributed to the two daughter cells, so its fluorescence intensity is half of that of the parent cell. Therefore, observing the number of times the cell fluorescence intensity decreases can be used to evaluate the cell division and proliferation. In this application, the CellTraceTM Violet Cell Proliferation Kit was used for experiments. The CTV staining method was used to evaluate the division ability of T cells. After the cells were labeled with CTV dye, CAR.TROP2 cells were activated with different tumors. The method was similar to co-culture. The prepared T cells and tumor cells were placed in a 24-well plate at a certain ratio. On the 3rd and 5th days after activation, the distribution status of the cell CTV dye was detected by flow cytometry. The results showed that the division and proliferation ability of CAR.TROP2 was significantly improved after being activated by tumor cells that positively expressed TROP2 ( Fig. 9 ).

[0084] 2. In vivo experiments

[0085] 1. In-situ model:

[0086] In order to observe the effect of CAR.TROP2 cells on tumor therapy in vivo and verify the in vitro research results, a triple-negative breast cancer model was established using NSG immunodeficient mice to conduct in vivo tumor killing studies ( Fig.10 ).

[0087] (1) Establishment of mouse mammary orthotopic tumor model

[0088] The tumor model used in this application is a triple-negative breast cancer in situ tumor model established by in situ injection of (MDA-MB-468-FFLuc) into the breast. Similar to the in vitro tumor killing experiment, the two CAR-T cells used in the in vivo experiment were CD19.CAR.28ζ targeting the tumor antigen CD19 expressed by the B cell line and CAR.TROP2 cells targeting the tumor antigen TROP2 expressed by the breast cancer cell line.

[0089] ①Preparing tumor cells

[0090] Tumor cell lines need to be tested for mycoplasma infection and FFLuc expression before injection. If mycoplasma infection is positive, it may affect T cell growth and function, and it needs to be used after anti-infection or replaced with an uninfected cell line. The expression level of FFLuc determines the sensitivity of monitoring live tumor signals. Tumor cell lines can only be used after confirming that they normally express FFLuc using luciferase activity experiments. At the same time, it should be confirmed that the tumor cells are in good condition before injection.

[0091] ②Intervention by inoculation of MDA-MB-468 cell line and CAR.TROP2 cells

[0092] The tumor model was established using NSG immunodeficient mice. The experimental animals were divided into two groups, a CD19.CAR.28ζ.i.mcherry control group and a CAR.TROP2 cell treatment group. There were 5 mice in each group. First, 5×10 5 MDA-MB-468-FFLuc cells were implanted into the body by orthotopic injection into the mammary gland. After 7 days, 5×10 6 The corresponding T cells intervene.

[0093] (2) Small Animal Imaging System (IVIS Kinetic) Photography

[0094] After the injection of the two groups of T cells, the small animal imaging system (IVIS Kinetic) was used to take pictures every week to monitor the changes in the tumor bioluminescence signal in the mice. Please refer to Figure 11-Figure 12 , which fully demonstrated the effectiveness of CAR.TROP2 in vivo.

[0095] 2. Lung metastasis model

[0096] In order to observe the effect of CAR.TROP2 cells on the treatment of advanced systemic metastasis of tumors in vivo, we used NSG immunodeficient mice to establish a triple-negative breast cancer lung metastasis model and conduct in vivo tumor killing studies ( Fig.13 ).

[0097] (1) Establishment of a mouse mammary gland-lung metastasis model

[0098] The tumor model used in this application is a triple-negative breast cancer lung metastasis model established by tail vein injection (in.situ) of (MDA-MB-231-FFLuc). Similar to the in vitro tumor killing experiment, the two CAR-T cells used in the in vivo experiment were CD19.CAR.28ζ targeting the tumor antigen CD19 expressed by the B cell line and CAR.TROP2 cells targeting the tumor antigen TROP2 expressed by the breast cancer cell line.

[0099] ①Preparing tumor cells

[0100] Tumor cell lines need to be tested for mycoplasma infection and FFLuc expression before injection.

[0101] If mycoplasma infection is positive, it may affect the growth and function of T cells, and it needs to be used after anti-infection or replaced with an uninfected cell line. The expression level of FFLuc determines the sensitivity of monitoring live tumor signals. The tumor cell line can only be used after confirming that it normally expresses FFLuc using the luciferase activity experiment. At the same time, it should be confirmed that the tumor cells are in good condition before injection.

[0102] ②Intervention by inoculation of MDA-MB-231 cell line and CAR.TROP2 cells

[0103] The tumor model was established using NSG immunodeficient mice. The experimental animals were divided into two groups, a CD19.CAR.28ζ.i.mcherry control group and a CAR.TROP2 cell treatment group. There were 5 mice in each group. First, 1×10 6 MDA-MB-231-FFLuc cells were implanted in vivo by orthotopic injection into the mammary gland. After 7 days, each group was given 10×10 6 The corresponding T cells intervene.

[0104] (2) Small Animal Imaging System (IVIS Kinetic) Photography

[0105] After the injection of the two groups of T cells, the small animal imaging system (IVIS Kinetic) was used to take pictures every week to monitor the changes in the tumor bioluminescence signal in the mice. Please refer to Fig.14 , which fully demonstrated the effectiveness of CAR.TROP2 in vivo and greatly improved the survival rate of mice.

[0106] In addition, the present invention also provides a viral vector, which is obtained by using the CAR-T cell model design method targeting TROP2 described in the above embodiment.

[0107] The present invention also provides a cell medicine composition, which comprises the virus vector.

[0108] The present invention also provides an application in the preparation of a drug, that is, the application of the viral vector or the drug composition described in the above embodiment in the preparation of a drug for treating breast cancer.

[0109] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present disclosure. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification.

[0110] Those skilled in the art will readily appreciate other embodiments of the present disclosure after considering the specification and practicing the invention disclosed herein. This application is intended to cover any modification, use or adaptation of the present disclosure, which follows the general principles of the present disclosure and includes common knowledge or customary techniques in the art that are not disclosed in the present disclosure. The specification and examples are intended to be exemplary only, and the true scope and spirit of the present disclosure are indicated by the appended claims.

Claims

1. A method for designing a CAR-T cell model targeting human TROP2, characterized in that: The following steps are involved: S100, obtain the human TROP2 antibody sequence; S200, construction of viral vector carrying target gene; Wherein, S100 includes steps S101-S103: S101, using the sequence of the drug targeting human TROP2 to obtain the protein sequences of the light chain and heavy chain; S102, comparing the protein sequences of the light chain and the heavy chain with sequences of other drug proteins other than the targeted drug, removing identical sequence portions, and obtaining variable protein sequences; S103, converting the variable protein sequence into a base sequence to obtain the base sequences of the light chain variable region and the heavy chain variable region, respectively, adding a signal peptide and a linker region to synthesize two base sequences, and obtaining a human TROP2 antibody sequence fragment; S200 includes steps S201-S202: S201, using gene cloning technology and SFG retroviral vector as the backbone, synthesized a plasmid carrying the human TROP2 antibody sequence fragment; S202, expressing target genes in artificial T cells by transfection.

2. The method for designing a CAR-T cell model targeting human TROP2 according to claim 1, characterized in that: Other drug proteins besides the targeted drug include HER2.

3. The method for designing a CAR-T cell model targeting human TROP2 according to claim 1, characterized in that: In S103, after adding the signal peptide and the linker region, the corresponding base sequences are synthesized with the light chain variable region and the heavy chain variable region in front as partitions.

4. The method for designing a CAR-T cell model targeting human TROP2 according to claim 1, characterized in that: In S103, the variable protein sequence is converted into a base sequence using SFG as a carrier to obtain the base sequences of the light chain variable region and the heavy chain variable region, respectively.

5. The method for designing a CAR-T cell model targeting human TROP2 according to claim 1, characterized in that: The nucleic acid sequence of the human TROP2 antibody is shown in SEQ ID NO.

1.

6. The method for designing a CAR-T cell model targeting human TROP2 according to claim 1, characterized in that: The nucleic acid sequence of the viral vector carrying the target gene is shown in SEQ ID NO.

2.

7. A viral vector, characterized in that A viral vector obtained by the method for designing a CAR-T cell model targeting TROP2 according to any one of claims 1 to 6.

8. A cell pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the viral vector according to claim 7.

9. Use of the viral vector according to claim 7 or the pharmaceutical composition according to claim 8 in the preparation of a drug for treating breast cancer.

Images