Multiple RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method

Abstract

The invention belongs to the technical field of plant virus detection, and provides a multiplex RT-PCR detection method for areca-nut related viruses. The primer group for multiple RT-PCR detection of areca-related viruses (areca yellow virus APV1, areca ringspot virus ANRSV and areca shuttle spot virus ANSSV) comprises a first primer group for detecting the APV1, a second primer group for detecting the ANRSV and a third primer group for detecting the ANSSV. The invention also provides a detection kit, which comprises a PCR reaction solution, and the PCR reaction solution comprises the primer group. The invention also provides application of the kit in simultaneous detection of areca-related viruses APV1, ANRSV and ANSSV. The primer group and the kit disclosed by the invention can specifically detect three areca-nut related viruses in a PCR system, can accurately identify any combination infection of the three viruses, and have the characteristics of high efficiency, economy, simplicity and convenience.

Description

Technical Field

[0001] The present disclosure relates to the technical field of plant virus detection, and in particular to a multiplex RT-PCR detection method for betel nut-associated viruses. Background Art

[0002] Betel nut ranks first among the four major southern medicinal herbs in China. Its planting area in Hainan is close to 3 million mu, and it has become the most important tropical economic crop in Hainan Province. At present, the area of ​​betel nut in Hainan Province affected by yellow leaf disease (YLD) may have reached more than 1 million mu, and it is still spreading rapidly, causing the death of a large number of betel nut trees. Studies have found that betel nut yellow leaf disease is related to Areca palm velarivirus 1 (APV1), Areca palm necrotic spindle-spot virus (ANSSV), and Areca palm necrotic ringspot virus (ANRSV). Among them, APV1 virus belongs to the genus Velarivirus, and the occurrence of this virus disease is highly correlated with betel nut yellow leaf disease. ANSSV has typical genome and mitochondrial characteristics of Potyviridae viruses and belongs to the genus Arepavirus. The virus can cause Areca palm spindle-spot disease (ANSSD) in areca palm. The disease is characterized by strip-shaped chlorosis of the top leaves of the plant and severe spindle-shaped necrotic spots on the middle and bottom leaves. Infection with ANRSV can cause Areca palm necrotic ringspot disease (ANRSD) in areca palm. This disease is highly prevalent in the main planting areas of areca palm. After areca palm is infected, the symptoms of infected trees are mostly necrotic ringspots on the middle and lower leaves, but most of the top new leaves do not show this symptom; some infected trees have necrotic ringspots at the bottom of the new leaves. The overall vitality of the infected plants is poor, the leaves are sparse, the bottom leaves droop, and the stems are thinner than healthy plants. After infection with the disease, the growth and development ability of the plants is reduced, which seriously affects the quality and quantity of flowers and fruits, causing serious economic losses. The above three viruses often infect together, directly affecting the yield and quality of betel nut, causing serious economic losses. Therefore, detecting whether these three viruses exist in betel nut can lay the foundation for the cultivation of betel nut virus-free seedlings and the field detection of betel nut viruses.

[0003] At present, common methods for detecting plant viruses include electron microscopy, serological identification and PCR technology. Electron microscopy detection has the advantages of being intuitive and rapid, but the detection accuracy is not enough. It can only assist in judging the virus genus based on the virus morphology, and cannot be accurate to the species. Serological identification has the characteristics of simple operation, rapidity, high sensitivity and strong specificity. The disadvantages are that the preparation time of antiserum is relatively long; it is easily interfered by autoantibodies, non-specific antibodies, etc., and false positives are prone to occur; when detecting viruses with complex infections, the sensitivity decreases, and identification is more difficult. PCR technology has strong specificity, high sensitivity and accuracy. Among them, RT-PCR (reverse transcription PCR) has higher sensitivity and accuracy than traditional serological methods, but the single-plex RT-PCR technology can only detect one virus at a time. When it is necessary to test multiple viruses in the sample, a lot of repetitive work is required, and a large amount of detection reagents will be consumed.

[0004] Based on this, it is necessary to provide a method that can quickly detect multiple pathogens at the same time to facilitate the detection of multiple virus infections in betel nut. Summary of the invention

[0005] The present disclosure provides a multiplex RT-PCR detection method for betel nut-associated virus to at least solve the above technical problems existing in the prior art.

[0006] According to a first aspect of the present disclosure, a primer set for multiplex RT-PCR detection of betel nut-associated viruses is provided, wherein the betel nut-associated viruses include APV1, ANRSV and ANSSV; the primer set includes: The first primer set for detecting APV1: APV1-F, whose nucleic acid sequence is shown in SEQ ID NO: 1: ATCGCTAATTATTATGGATAGACTT; APV1-R, whose nucleic acid sequence is shown in SEQ ID NO: 2: TATTCAGAAGCATAAGATTGTGACA; The second primer set for detecting ANRSV: ANRSV-F, whose nucleic acid sequence is shown in SEQ ID NO:3: CAAGTGAAAGCCTGGG; ANRSV-R, whose nucleic acid sequence is shown in SEQ ID NO:4: CCATGTTCATACTCACTAACATC; The third primer set for detecting ANSSV: ANSSV-F, whose nucleic acid sequence is shown in SEQ ID NO:5: TGGCCTTTTCGCAAACAAGT; ANSSV-R, whose nucleic acid sequence is shown in SEQ ID NO:6: AGCTCGCAAAATTCTATCACCT.

[0007] According to a second aspect of the present disclosure, a kit for multiplex RT-PCR detection of betel nut-associated virus is provided, the kit comprising a PCR reaction solution, and the PCR reaction solution comprises the above-mentioned primer set.

[0008] In one embodiment, the PCR reaction solution further includes Premix Taq, cDNA and water.

[0009] In one embodiment, the PCR reaction solution is: Premix Taq 15 μL, APV1-F and APV1-R 0.5 μL each, ANRSV-F and ANRSV-R 0.4 μL each, ANSSV-F and ANSSV-R 1 μL each, cDNA 3 μL, and water is added to the total system of 25 μL.

[0010] In one embodiment, the kit further comprises an RT (reverse transcription) reaction solution, wherein the RT reaction solution comprises a random primer [oligo(dT) Primer], total RNA from betel nut leaves, dNTP Mixture, 5× Prime Script TM Buffer, RNase Inhibitor, Prime Script TM RTase and water.

[0011] In one embodiment, the RT reaction solution is: 5 μL of random primers, 4 μL of total RNA from betel nut leaves, 2 μL of 10 mmol / L dNTP Mixture, 5× Prime Script TM Buffer 8μL, 40U / μL RNase Inhibitor 1μL, Prime Script TM RTase 1μL, RNase Free water 4μL.

[0012] In one embodiment, the kit further comprises a positive control and a negative control.

[0013] Specifically, the positive control is a mixed plasmid of plasmids containing target fragments of APV1, ANRSV and ANSSV.

[0014] Specifically, the negative control is the DNA of healthy betel nut leaves.

[0015] According to the third aspect of the present disclosure, there is provided the use of the above-mentioned kit in the simultaneous detection of betel nut-associated viruses APV1, ANRSV and ANSSV.

[0016] In one possible implementation, the method of application is as follows: S1: Extract total RNA from betel nut leaves; S2: using the total RNA described in step S1 as a template, reverse transcription is performed to obtain cDNA; S3: using the cDNA described in step S2 as a template, performing multiple PCR amplification using a PCR reaction solution to obtain an amplified product; S4: The amplified product is subjected to agarose gel electrophoresis detection. If more than one band appears, it is determined that the betel nut leaf contains at least one of APV1, ANRSV and ANSSV.

[0017] In one embodiment, step S2 performs the reverse transcription using an RT reaction solution.

[0018] In one embodiment, in step S2, random primers, total RNA from betel nut leaves, and dNTP Mixture in the RT reaction solution are first mixed, denatured at 65° C. for 5 min, and then placed in an ice bath for 5 min; 5× Prime Script TM Buffer, RNase Inhibitor, Prime Script TM RTase and water were reacted at 42°C for 60 min and 95°C for 5 min to complete the reverse transcription.

[0019] In one embodiment, the conditions for the multiplex PCR amplification in step S3 are: 94°C, 5 min; denaturation at 94°C for 30 s, annealing and extension at 53.4-57.3°C for 1 min, for a total of 35-40 cycles; 72°C, 10 min.

[0020] In one possible implementation, in step S4, if the one or more bands are the same size as the band of the positive control, it is determined that the betel nut leaf contains at least one of APV1, ANRSV and ANSSV.

[0021] According to an implementable embodiment of the present disclosure, at least the following beneficial effects are achieved: Multiplex RT-PCR technology is a PCR reaction that uses one or more pairs of primers to simultaneously amplify multiple nucleic acid fragments in the same reaction system. It is more efficient, economical and simpler than single-plex PCR. It not only has the advantages of single-plex RT-PCR technology, but also has the advantage of multiplex RT-PCR reaction that it can quickly detect multiple pathogens at the same time, which can meet the requirements of simultaneous detection of multiple pathogens in production.

[0022] The primer pairs in the primer set proposed in the present disclosure have high specificity and sensitivity, and can be used to detect the corresponding virus alone, or can be combined to detect multiple viruses. Therefore, the kit made using the primer set can be used to detect one or more betel nut-related viruses. The present disclosure can use the above primer set to perform multiple RT-PCR tests on diseased betel nut leaves, and can detect multiple pathogenic viruses at the same time, which is more efficient, economical and simple than ordinary PCR, and can meet the production requirements for detecting multiple pathogens at the same time.

[0023] It should be understood that the content described in this section is not intended to identify the key or important features of the embodiments of the present disclosure, nor is it intended to limit the scope of the present disclosure. Other features of the present disclosure will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The above and other objects, features and advantages of the exemplary embodiments of the present disclosure will become readily understood by reading the detailed description below with reference to the accompanying drawings. In the accompanying drawings, several embodiments of the present disclosure are shown in an exemplary and non-limiting manner, in which: In the drawings, the same or corresponding reference numerals represent the same or corresponding parts.

[0025] Figure 1 The electrophoresis results of using three sets of primers to detect the viral pathogens of diseased betel nuts in Example 2 of the present disclosure are shown; wherein, M-DL2000; N-negative control; Figure 2 The amplification results at different annealing temperatures in Example 3 of the present disclosure are shown; wherein, M-DL2000; N-negative control; 1-53.4°C; 2-54.3°C; 3-55.2°C; 4-56.3°C; 5-57.3°C; 6-58.2°C; 7-58.9°C; 8-59.5°C; Figure 3 The amplification result diagram at different cycle numbers during PCR amplification in Example 3 of the present disclosure is shown; wherein, M-DL2000; N-negative control; 1-cycle number is 20; 2-cycle number is 25; 3-cycle number is 30; 4-cycle number is 35; 5-cycle number is 40; Figure 4 The result graphs of amplification of cDNA at different dilutions in Example 3 of the present disclosure are shown; wherein, M-DL2000; N-negative control; A-single RT-PCR detection of APV1; B-single RT-PCR detection of ANRSV; C-single RT-PCR detection of ANSSV; D-multiple RT-PCR detection of APV1, ANRSV, and ANSSV; Figure 5The figure shows the detection results of betel nut-associated virus in 24 betel nut leaf samples from four cities and counties using multiple RT-PCR in Example 4 of the present disclosure; wherein, M-DL2000; 1~24 represent 24 betel nut leaf samples in each group; N-negative control; A-Wanning; B-Qionghai; C-Ding'an; D-Baoting. DETAILED DESCRIPTION

[0026] In order to make the purpose, features, and advantages of the present disclosure more obvious and easy to understand, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the drawings in the embodiments of the present disclosure. Obviously, the described embodiments are only part of the embodiments of the present disclosure, not all of the embodiments. Based on the embodiments in the present disclosure, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present disclosure.

[0027] The present disclosure provides a multiplex RT-PCR primer set for detecting major betel nut viruses, wherein the major betel nut viruses include APV1, ANRSV and ANSSV; the primer set includes: The first primer set for detecting APV1: APV1-F, whose nucleic acid sequence is shown in SEQ ID NO: 1: ATCGCTAATTATTATGGATAGACTT; APV1-R, whose nucleic acid sequence is shown in SEQ ID NO: 2: TATTCAGAAGCATAAGATTGTGACA; The second primer set for detecting ANRSV: ANRSV-F, whose nucleic acid sequence is shown in SEQ ID NO:3: CAAGTGAAAGCCTGGG; ANRSV-R, whose nucleic acid sequence is shown in SEQ ID NO:4: CCATGTTCATACTCACTAACATC; The third primer set for detecting ANSSV: ANSSV-F, whose nucleic acid sequence is shown in SEQ ID NO:5: TGGCCTTTTCGCAAACAAGT; ANSSV-R, whose nucleic acid sequence is shown in SEQ ID NO:6: AGCTCGCAAAATTCTATCACCT.

[0028] Using the above primer set to conduct multiple RT-PCR tests on diseased betel nut leaves can simultaneously and quickly detect multiple pathogenic viruses that infect betel nut.

[0029] The primer set has high specificity and sensitivity, and can be used to detect the corresponding virus alone, or in combination to detect multiple viruses. Therefore, the primer set can be used to prepare a detection kit containing one or more primer pairs, which is used to detect betel nut-related viruses corresponding to one or more primer pairs.

[0030] As a preferred embodiment of the present disclosure, the above kit includes RT reaction solution and PCR reaction solution. The RT reaction solution and reaction conditions are: 5 μL of random primer [oligo(dT) Primer], 4 μL of total RNA from betel nut leaves, 2 μL of 10 mmol / L dNTPMixture, denaturation at 65°C for 5 min, rapid ice bath for 5 min; then add 5× Prime Script TM Buffer 8μL, 40U / μL RNase Inhibitor 1μL, Prime Script TM RTase (Ta Ka Ra Takara-Prime Script TM RTreagent Kit) 1μL, RNase Free H2O 4μL, react at 42℃ for 60min, and then at 95℃ for 5min.

[0031] The PCR reaction solution includes the above primer set, and the total system of the reaction solution is 25 μL, specifically: Premix Taq (TaKa Ra Taq Version 2.0 plus dye) 15 μL, APV1-F and APV1-R 0.5 μL each, ANRSV-F and ANRSV-R 0.4 μL each, ANSSV-F and ANSSV-R 1 μL each, cDNA 3 μL, ddH2O is added to make up the total system to 25 μL. The PCR reaction program is: 94°C, 5 min; 94°C denaturation for 30 s, 53.4°C annealing and extension for 1 min, a total of 35 cycles; 72°C, 10 min.

[0032] The present invention discloses a multiplex RT-PCR primer set designed and obtained based on the multiplex PCR principle. The primer set can be used to perform multiplex RT-PCR detection on diseased betel nut leaves, and can detect multiple pathogenic viruses at the same time. It is more efficient, economical and simple than ordinary PCR, and can meet the production requirements for detecting multiple pathogens at the same time.

[0033] The present disclosure will be further described below in conjunction with specific embodiments.

[0034] Example 1 In this embodiment, specific detection primers for RT-PCR are designed.

[0035] The virus sequences were downloaded from the NCBI database. The accession number of APV1 is MW316024.1; the accession number of ANRSV is MZ209276.1; and the accession number of ANSSV is MH330686.1. Primer5.0 software was used to design primers. The primer sequences and amplification lengths are shown in Table 1.

[0036] Table 1 Primer sequences for multiplex RT-PCR of betel nut-associated viruses

[0037] Example 2 This example was validated by single-plex RT-PCR.

[0038] 1. Information of samples to be tested.

[0039] A total of 12 samples of betel nut leaves with viral disease symptoms collected in Ding'an, Hainan were selected, namely DA-1, DA-2, DA-3, DA-4, DA-5, DA-6, DA-7, DA-8, DA-9, DA-10, DA-11 and DA-12. Metagenomic sequencing results showed that these samples were infected with multiple viruses, so specific primers were designed for RT-PCR verification analysis.

[0040] 2. Reverse transcription (RT).

[0041] Add 1 μL of random primer (oligo(dT)Primer) and 5 μL of RNA (select RNA samples of DA2, DA-4 and DA-5) to a 0.2 mL RNase Free centrifuge tube, denature at 70°C for 10 min, and quickly place on ice for 5 min; then add 4 μL of 5×M-MLVBuffer, 1 μL of 10 mM dNTP, 0.5 μL of RNase Inhibitor (Ta Ka Ra), 1 μL of RTase-MLV (Ta Ka Ra), and 3.5 μL of RNase Free H2O, react at 42°C for 60 min, and then react at 70°C for 15 min.

[0042] 3. PCR amplification.

[0043] The PCR reaction system was 25 μL: 12.5 μL Premix Taq (Ta Ka Ra Taq Version 2.0 plusdye), 0.75 μL each of the upstream and downstream primers (10 μmol / L) corresponding to the single virus designed in Example 1, 3 μL cDNA, and 8 μL ddH2O. The reaction program was: 94°C, 5 min; denaturation at 94°C for 30 s, annealing and extension at 53.4°C for 1 min, for a total of 35 cycles; 72°C, 10 min.

[0044] Take 6 μL of the PCR amplification product and perform electrophoresis on 2% agarose gel and observe it on a gel imager. The results are as follows: Figure 1 shown. Figure 1 The results showed that all three primer pairs could amplify target fragments of corresponding sizes in the tested samples without any non-specific background bands.

[0045] 4. Verification of virus sequence of samples to be tested.

[0046] The target fragment amplified by RT-PCR was recovered by tapping and connected to the PMD18-T cloning vector (Ta Ka Ra). After transformation into E. coli, the positive clones were selected by colony PCR for sequencing analysis (Qingke Biotechnology). The sequencing results showed that the target fragment amplified by single-plex PCR was a related virus sequence. It was confirmed that these three pairs of primers can be used for RT-PCR detection of betel nut-related viruses. The test results are shown in Table 2.

[0047] Table 2 Statistics of single-plex RT-PCR test results

[0048] Note: “-” represents negative; “+” represents positive.

[0049] Example 3 This example optimizes the multiplex RT-PCR detection system.

[0050] 1. Information of the sample to be tested.

[0051] The five samples DA-2, DA-5, DA-6, DA-7 and DA-12 identified by single RT-PCR and confirmed as virus species by sequencing analysis in Example 2 were selected as samples for multiplex RT-PCR detection.

[0052] 2. Optimization of reverse transcription system.

[0053] Synthesis of cDNA for multiplex PCR: Add 5 μL random primers, 4 μL total RNA from betel nut leaves, and 2 μL dNTP Mixture (10 mmol / L each) to a 0.2 mL centrifuge tube, denature at 65°C for 5 min, and quickly place on ice for 5 min; then add 8 μL 5× Prime Script TM Buffer, 1 μL RNase Inhibitor (40 U / μL), 1 μL Prime Script TM RTase, 4 μL RNase Free H2O, reaction at 42°C for 60 min, and reaction at 95°C for 5 min.

[0054] 3. Optimization of PCR system.

[0055] The primer concentration was adjusted according to the brightness of the virus bands. After optimization, the volumes of the primer sets were: 0.5 μL for APV1, 0.4 μL for ANRSV, and 1 μL for ANSSV.

[0056] To determine the annealing temperature and amplification cycle in the multiplex RT-PCR amplification program, a series of gradient experiments were designed. The annealing temperature ranged from 53.4°C to 59.5°C with a total of 8 gradients. The results are shown in Figure 2 shown. Figure 2 The results showed that the amplification products with annealing temperature of 53.4~57.3℃ all obtained 3 bands after electrophoresis, and the brightness of the target bands of the same virus was significantly different between different temperature gradients. The number of amplification cycles was divided into 5 gradients, namely 20, 25, 30, 35 and 40. The amplification results are shown in Figure 3 shown. Figure 3 The results showed that after electrophoresis, the amplification products with cycle numbers of 35 and 40 both obtained 3 bands, so the cycle number between 35 and 40 was more appropriate.

[0057] 4. Sensitivity detection.

[0058] A 10-fold serial dilution (10 0 ~10 -7 ) assay sensitivity. Both singleplex RT-PCR and multiplex RT-PCR can be performed from cDNA diluted to 10 -3 APV1 was detected in samples of 10% and ANRSV and ANSSV were detected from cDNA diluted to 10 -2 detected in samples (e.g. Figure 4 as shown).

[0059] The final reaction system of multiplex PCR was 25 μL: 15 μL of Premix Taq (Ta Ka Ra Taq Version 2.0 plus dye), 0.5 μL each of APV1-F and APV1-R, 0.4 μL each of ANRSV-F and ANRSV-R, 1 μL each of ANSSV-F and ANSSV-R, 3 μL of cDNA, and ddH2O was added to make up the total system to 25 μL. The reaction program was: 94°C, 5 min; 94°C denaturation for 30 s, 53.4°C annealing and extension for 1 min, a total of 35 cycles; 72°C, 10 min. 6 μL of the amplified product was detected by electrophoresis on 2% agarose gel, and the results are shown in Table 3.

[0060] Table 3 Statistics of multiplex RT-PCR test results

[0061] Note: “-” represents negative; “+” represents positive.

[0062] From the results in Tables 2 and 3, it can be seen that the detection results of DA-2, DA-5, DA-6, DA-7 and DA-12 are consistent, that is, the single RT-PCR detection results are consistent with the multiplex RT-PCR detection results, indicating that the multiplex RT-PCR detection method is reliable and can be used for the detection of areca nut virus.

[0063] Example 4 This embodiment provides an application example of multiplex RT-PCR detection of betel nut-associated viruses.

[0064] 1. Total RNA extraction from plant samples.

[0065] A total of 96 betel nut leaf samples with viral disease symptoms were selected from Wanning (A), Qionghai (B), Ding'an (C), and Baoting (D) in Hainan Province and divided into four groups, corresponding to the above four cities and counties: A 1-24, B 1-24, C 1-24, and D 1-24. Total RNA was extracted from betel nut leaves according to the instructions of Tripure (full gene) reagent, and the precipitate was dissolved in 30 μL of RNase-free water and stored at -80°C for later use.

[0066] 2. Reverse transcription.

[0067] Add 5 μL of random primers, 4 μL of total RNA from betel nut leaves, and 2 μL of dNTP Mixture (10 mmol / L each) to a 0.2 mL centrifuge tube, denature at 65°C for 5 min, and quickly place on ice for 5 min; then add 8 μL of 5× Prime Script TM Buffer, 1 μL RNase Inhibitor (40 U / μL), 1 μL Prime Script TM RTase, 4 μL RNase Free H2O, reaction at 42°C for 60 min, and reaction at 95°C for 5 min.

[0068] 3. Multiplex PCR.

[0069] The reaction system was 25 μL: 15 μL of Premix Taq (Ta Ka Ra Taq Version 2.0 plus dye), 0.5 μL each of APV1-F and APV1-R, 0.4 μL each of ANRSV-F and ANRSV-R, 1 μL each of ANSSV-F and ANSSV-R, 3 μL of cDNA, and ddH2O was added to make up the total system to 25 μL. The reaction program was: 94°C, 5 min; denaturation at 94°C for 30 s, annealing and extension at 53.4°C for 1 min, for a total of 35 cycles; 72°C, 10 min.

[0070] 4. Positive control and negative control.

[0071] The positive control was a mixed plasmid containing the target fragments of APV1, ANRSV and ANSSV, and the negative control was DNA from healthy betel nut leaves. The RT-PCR method for the positive and negative controls was consistent with the above method.

[0072] 5. Agarose gel electrophoresis detection.

[0073] Take 6 μL of the amplified product and perform electrophoresis on 2% agarose gel. The loading marker is 2000 bp and the result is observed on a gel imager. Figure 5 shown. Figure 5 The results showed that there was no target band in the negative control, and one or more bands could be amplified in some samples to be tested, indicating that these samples to be tested included one or several viruses among APV1, ANRSV and ANSSV.

[0074] In summary, the primer set disclosed in the present invention can be used to perform multiple RT-PCR tests on diseased betel nuts, and multiple pathogenic viruses can be detected simultaneously. It is more efficient, economical and simpler than ordinary PCR, and can meet the production requirements for detecting multiple pathogens simultaneously.

[0075] It should be understood that the various forms of processes shown above can be used to reorder, add or delete steps. For example, the steps recorded in this disclosure can be executed in parallel, sequentially or in different orders, as long as the desired results of the technical solution of this disclosure can be achieved, and this document is not limited here.

[0076] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the features. In the description of the present disclosure, the meaning of "plurality" is two or more, unless otherwise clearly and specifically defined.

[0077] The above is only a specific embodiment of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any person skilled in the art who is familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed in the present disclosure, which should be included in the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be based on the protection scope of the claims.

Claims

1. A primer set for multiplex RT-PCR detection of betel nut-associated virus, characterized in that: The betel nut-associated viruses include APV1, ANRSV and ANSSV; the primer set includes: The first primer set for detecting APV1: APV1-F, whose nucleic acid sequence is shown in SEQ ID NO: 1: ATCGCTAATTATTATGGATAGACTT; APV1-R, whose nucleic acid sequence is shown in SEQ ID NO: 2: TATTCAGAAGCATAAGATTGTGACA; The second primer set for detecting ANRSV: ANRSV-F, whose nucleic acid sequence is shown in SEQ ID NO:3: CAAGTGAAAGCCTGGG; ANRSV-R, whose nucleic acid sequence is shown in SEQ ID NO:4: CCATGTTCATACTCACTAACATC; The third primer set for detecting ANSSV: ANSSV-F, whose nucleic acid sequence is shown in SEQ ID NO:5: TGGCCTTTTCGCAAACAAGT; ANSSV-R, whose nucleic acid sequence is shown in SEQ ID NO:6: AGCTCGCAAAATTCTATCACCT.

2. A kit for multiplex RT-PCR detection of betel nut-associated viruses, characterized in that: The kit comprises a PCR reaction solution, and the PCR reaction solution comprises the primer set according to claim 1.

3. The kit according to claim 2, characterized in that The PCR reaction solution also includes Premix Taq, cDNA and water.

4. The kit according to claim 2, characterized in that: The kit also includes an RT reaction solution, which includes random primers, total RNA from betel nut leaves, dNTP Mixture, 5× Prime Script TM Buffer, RNaseInhibitor, Prime Script TM RTase and water.

5. The kit according to claim 2, characterized in that: The kit also includes a positive control and a negative control; the positive control is a mixed plasmid of plasmids including target fragments of APV1, ANRSV and ANSSV; and the negative control is DNA of healthy betel nut leaves.

6. Use of the kit according to any one of claims 2 to 5 in the simultaneous detection of betel nut-associated viruses APV1, ANRSV and ANSSV.

7. The use according to claim 6, characterized in that: The method of the application is as follows: S1: Extract total RNA from betel nut leaves; S2: using the total RNA in step S1 as a template, reverse transcription is performed to obtain cDNA; S3: using the cDNA described in step S2 as a template, performing multiple PCR amplification using a PCR reaction solution to obtain an amplified product; S4: The amplified product is subjected to agarose gel electrophoresis detection. If more than one band appears, it is determined that the betel nut leaf contains at least one of APV1, ANRSV and ANSSV.

8. The use according to claim 7, characterized in that: Step S2: performing reverse transcription using an RT reaction solution; firstly, mixing the random primers, the total RNA of the betel nut leaves, and the dNTP Mixture in the RT reaction solution, denaturing at 65° C. for 5 min, and then placing in an ice bath for 5 min; then adding 5× Prime Script TM Buffer, RNase Inhibitor, PrimeScript TM RTase and water were reacted at 42°C for 60 min and 95°C for 5 min to complete the reverse transcription.

9. The use according to claim 7, characterized in that: The conditions for the multiplex PCR amplification in step S3 are: 94° C., 5 min; denaturation at 94° C. for 30 s, annealing and extension at 53.4-57.3° C. for 1 min, for a total of 35-40 cycles; 72° C., 10 min.

10. The use according to claim 7, characterized in that: In step S4, if the one or more bands are the same size as the band of the positive control, it is determined that the betel nut leaf contains at least one of APV1, ANRSV and ANSSV.

Images