Morchella sextelata strain pleurospermum hookeri No.8 and application thereof

Abstract

The invention provides a morchella sextelata strain pleurospermum hookeri No.8 and application thereof, and relates to the technical field of strain breeding, the morchella sextelata strain pleurospermum hookeri No.8 is obtained by space-carrying induced genetic variation, then subculture is carried out to screen out stably inherited characters, and the morchella sextelata strain pleurospermum hookeri No.8 is screened through a fruiting screening test. The pleurospermum hookeri No.8 strain has the characteristics of high hypha germination speed, low temperature resistance, white mold resistance (Diplospora longipora), early primordium generation, large quantity, strong cluster growth type of young mushrooms, good shape of commercial mushrooms, difficulty in breakage and the like, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of strain breeding, and in particular to a Morchella liumei strain Meizai No. 8 and applications thereof. Background Art

[0002] Morchella sextelata is an important type of medicinal and edible fungi, which has attracted extensive attention from researchers around the world due to its good commodity shape, short cultivation cycle, delicious taste and high economic value. Screening high-quality, high-yield and stable-yield strains has always been pursued by technicians in this field, and it has great application value.

[0003] Creating genetic variation and improving genetic characteristics through breeding in order to cultivate new varieties of Morchella with stable genetic traits, high quality and high yield has always been a focus of technical personnel in this field and has great application value.

[0004] Space breeding, also known as space breeding, is to let crop seeds / strains take a returnable spacecraft to space for a "business trip", using cosmic rays, microgravity, high vacuum and other special environmental effects to make a very small number of these seeds / strains produce genetic mutations, and then return to land. After multiple generations of screening and cultivation by scientists, new varieties with stable characteristics are finally formed. From 2021 to date, the applicant has carried cultivated edible fungi strains such as Morchella, Red Bamboo Sun, Flammulina, Pleurotus geesteranus and White Ginseng into space through the Shenzhou XII, XIV and XVI manned spacecraft, and selected and bred new varieties with strong resistance to high temperature, low temperature, humidity, drought and pests to serve my country's economic construction. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Morchella lilii Meizai No. 8 and an application thereof. The Morchella lilii Meizai No. 8 has the characteristics of fast mycelium germination, resistance to low temperature, resistance to white mold (Diploöspora longispora), early occurrence of primordia, large number, strong clustering type of young mushrooms, good shape of commercial mushrooms, and not easy to break.

[0006] The embodiment of the present invention is achieved as follows: A strain of Morchella sextelata, Meizai 8, with the deposit number CGMCC No. 41345, was deposited in the General Microbiology Center of China Culture Collection Administration on June 25, 2024. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. It is classified and named: Morchella sextelata.

[0007] An application of the above-mentioned Liumei Morchella strain Meizai No. 8 in Morchella cultivation and production.

[0008] The beneficial effects of the embodiments of the present invention are: The present invention provides a strain of six-sister Morchella strain Meizai No. 8 and its application. The six-sister Morchella strain Meizai No. 8 is subjected to space flight to induce genetic variation, and then the stable hereditary traits are screened out through subculture, and the strain is obtained through mushroom screening test. The six-sister Morchella strain Meizai No. 8 has the characteristics of fast mycelium germination, resistance to low temperature, resistance to white mold (Diploöspora longispora), early occurrence of primordium, large number, strong clustering type of young mushrooms, good shape of commercial mushrooms, and not easy to break, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0010] Figure 1 A schematic diagram of the morphology of the Liumei Morchella Meizai No. 8 provided in Example 1 of the present invention; Figure 2 Schematic diagram of the planting scene of the Liumei Morchella strain Meizai No. 8 provided in the application example of the present invention. DETAILED DESCRIPTION

[0011] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0012] The following specifically describes a strain of Morchella lilii strain Meizai No. 8 and its application according to an embodiment of the present invention.

[0013] The embodiment of the present invention provides a strain of Morchella sextelata, which has a collection number of CGMCC No. 41345 and was deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee on June 25, 2024. The collection address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named: Morchella sextelata.

[0014] The cultivation method of the Six Sister Morel strain Meizai No. 8 is as follows: S1. Collect spore prints of fresh Morchella oleracea and dry them for later use.

[0015] S2. The pure cultured single-spore strain of Morchella lilii was obtained by single-spore isolation.

[0016] S3. The pure cultured monospore strain is carried into space for cultivation to obtain the space-borne strain.

[0017] S4. Activate and systematically screen the returned space-borne strains to obtain single-hyphae strains.

[0018] S5. Subculture the mycelium of a single strain, select the number containing the two mating types of Mat1-1 and Mat1-2, the fastest mycelium germination rate, neat edges, dense sclerotia and less pigment, complete the preliminary domestication work, and preserve the domesticated strains.

[0019] S6. The domesticated strains were subjected to multiple point and multiple fruiting screening tests, and a strain of Morchella liumei was obtained, which has the characteristics of fast mycelial germination, resistance to low temperature, resistance to white mold (Diploöspora longispora), early occurrence of primordia, large number, strong clustering of young mushrooms, good shape of commercial mushrooms, and not easy to break, etc., achieving the purpose of domestication and breeding of excellent strains. The strain was named "Meizai No. 8".

[0020] The strain of Six Sister Morel, Meizai No. 8, has the following morphological characteristics: its mycelium is thick, grows rapidly, has neat ends, and has bifurcations less than 45°; it can grow to cover a 9-cm diameter culture dish in about 3 days at 18°C, and be covered with light yellow granular sclerotia in about 10 days. The cap of a mature fruiting body is conical to oblong, brown to dark brown, with a pointed top, 8 to 15 cm long, and 5 to 8 cm wide; the density of ribs is medium, the longitudinal ribs of the cap are obvious, the cap has 20 to 25 longitudinal veins, and 9 to 14 transverse veins; the flesh is about 3 mm thick; the stipe is smooth and white, with an inconspicuous depression at the junction of the cap and the stipe, 4 to 5 cm long, and 3 to 4 cm wide. The fruiting bodies grow in clusters or scattered. Figure 1 shown.

[0021] The Liumei Morchella Meizai No. 8 strain was amplified and sequenced using the universal primers ITS4 / ITS5 for fungi to obtain the nucleotide sequence of the molecular fragment as shown in SEQ ID NO: 1, which is as follows: .

[0022] The nucleotide sequence SEQ ID NO:1 was compared with GenBank (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome#), and the result was 100% homologous to the six-sister Morchella in the database, gene accession number (MG589676). Therefore, the six-sister Morchella strain Meizai No. 8 was identified as the six-sister Morchella.

[0023] Furthermore, through genetic testing, it was found that compared with the common six-sister morels in the market, the six-sister morel strain Meizai No. 8 includes a first specific DNA fragment of about 453 bp, a second specific DNA fragment of about 491 bp, and a third specific DNA fragment of about 337 bp. Among them, the nucleotide sequence of the first specific DNA fragment is as shown in SEQ ID NO: 2, which is as follows: CACTGAAATGGTATGTATCTCTAGCAATATACTCAGGGTGTTAATTCTTGGTAGGTCCAGAGAGTTCGGTTCCTCAATTAGTTTTGTTGTATATTGACTGGGCCTGGTCTCCTGAGTACTGATAGGTAAGACCAGCAATATTGACGGGTCACACATTCAACGACGTCTACGTGATCGATTGTGCTGGCCACTCCGAGGAAATGGGTTCCCACTTTGAACGCTAACT CCAAAGGTGCCCACCAACACAAATAGGCTGCCAACCCCGCCTAACACCGCTTCACACTCCATCCCTACCCATCATCCCTTCCCATCACTCTTACTCATGGCTTGCTTCTTCCCACCACCCAGCCACCACATTCCTCGGCTCTGGTTCTTACCCCCCCCCAAGGCCAGGGGATACATCCTAGGGAGTGACGCAGACACGTACGGAACCGAATGTACGACGGAAAAAC.

[0024] The nucleotide sequence of the second specific DNA fragment is as shown in SEQ ID NO: 3, and is as follows: ACCGAGTGTTTATTGTGACGTAGAAGCCTCCTCCGCCCCTCTCTCGGCATTCCCAATTGTCAACACCTCTAGCCTAAGCCCCCGCGTGACCTCCTACCGTCAGGAACAGGTAAAACGCAACGCTGCGCATGGGGATGGGGTGCGCTGAATCTGAATATCCACCGGTATATATGCCCACCTGTATCACCCGCAATCTTCGCGGGACCAGGTGGAATGACGTCGGGGCAGAGCACCGGTGACAGATTCCGGCAATCATGTATTTCCTAATCAACCACTAGCTTTCACGGCTATTTCCTCTTTGCCCAAAGTCCTAAGTAGTCCAAGCCCGGTATTCAAGCGTAGGCTACGGTATTGAGAGAAGCCCTAACTATAATTCTAAGTTCGCTAAGACTAGACACGTGAAACAGACTTGGCCTAGTGCTGCGACATCCGGGACGAGTTGAAGACAGTGTTAAACCTTCTTTTTATGTGTCCCGGCCACAACCTCTATC。

[0025] The nucleotide sequence of the third specific DNA fragment is as shown in SEQ ID NO: 4, specifically as follows: CGGACCACCTTATCGGACCTGAATCCTATCCCTGTGTCCCACCTATCTTTGAACCCTATACCTCGCCTTGAGTATCGATGTTTATATCGAGTACGATCAGCTATCATGTATATACTCCTACCAACCAAAGACCTCTCCCTCACTACCTGCCCCTCGCCTTTGAAGGGCACGGGGTATAGAAGAAATGAAACAAACGACTGGGACCCAATACTCTTTCATATACTCTCTTGTGAGAGGACCCCAAGGACGCCATCTATGGCTCGATATAGCTCCTTCCCCTCCTGCTGATTCTCCTATCTTTTTCGAACCCCCACCTCCAAACGCACCCCGAACGGCC。

[0026] The first specific DNA fragment, the second specific DNA fragment and the third specific DNA fragment are obtained by PCR amplification of the Morchella liumei strain Meizai No. 8 with specific primers. The specific method is to use conventional fungal whole genome (Whole Genome Sequencing) extraction, amplification and group sequencing methods to perform whole genome sequencing and assembly; and further refer to Wei Chuanzheng et al. (2023) to perform shallow genome sequencing (Shallow Whole Genome Sequencing) on ​​the uncarried six-sister morel strain and the six-sister morel strain Meizai No. 8; then splice according to conventional genome data, and select the special target fragment contained in the six-sister morel strain Meizai No. 8; finally, primer design is performed through http: / / www.primer3plus.com / to obtain 3 pairs of specific primers, and the 3 pairs of specific primers include Primer_MZ8_1L and Primer_MZ8_1R, Primer_MZ8_2L and Primer_MZ8_2R, and Primer_MZ8_3L and Primer_MZ8_3R, and their nucleotide sequences are shown in SEQ ID NO:5~SEQ ID NO.10 respectively, as follows: Primer_MZ8_1L:5'-GCGGTTGCGTACGTGTCTA-3'; Primer_MZ8_1R:5'-GCGGTTGCGTACGTGTCTA-3'; Primer_MZ8_2L:5'-GATAGAGGTTGTGGCCGGG-3'; Primer_MZ8_2R:5'- CCGCCCAATAAACATGCCG-3'; Primer_MZ8_3L:5'-GAGGTAGGTGTGACGGTCG-3'; Primer_MZ8_3R:5'-TGAATGGGCAAAAAGGCGC-3'.

[0027] During PCR amplification, Primer_MZ8_1L / Primer_MZ8_1R, Primer_MZ8_2L / Primer_MZ8_2R, and Primer_MZ8_3L / Primer_MZ8_3R primer sets were added to the amplification system respectively, and after the reaction, detection was performed using 2% agarose gel electrophoresis.

[0028] The amplification system is: PCR Buffer 1×, MgCl 21.50 mM, dNTPs Mix 0.25 mM, specific primers 1.00 mM each, rTaqPolymerase 1.5 U, template DNA 50 ng; The reaction conditions are: Pre-denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 60 s, 51°C for 40 s, and 72°C for 30 s; final extension at 72°C for 10 min.

[0029] The sequencing of the PCR amplification reaction products was sent to Beijing Biotech Biotechnology Co., Ltd., Shanghai Shenggong Bioengineering Technology Service Co., Ltd. and Yingjun Biotechnology Co., Ltd. for sequencing. The sequencer used for sequencing was ABI3730DNA sequencer, and the sequencing primers were the same as the PCR amplification primers. Only the Meizai No. 8 strain can obtain the first specific DNA fragment, the second specific DNA fragment and the third specific DNA fragment. The uninfected strains or the common six-sister morels in the market cannot amplify the first specific DNA fragment, the second specific DNA fragment and the third specific DNA fragment.

[0030] The embodiment of the present invention also provides an application of the above-mentioned six-sister morel strain Meizai No. 8 in the cultivation and production of morels.

[0031] The cultivation conditions of the Six Sister Morel strain Meizai No. 8 are: The soil temperature during cultivation is 5~15℃, and the soil temperature during the mycelium culture period is controlled at 8~20℃; the soil temperature during primordium differentiation and young mushroom growth period is controlled at 8~13℃, the relative humidity of the air is 80%~95%, and the light intensity is 400~800Lux.

[0032] After repeated tests, a suitable nutrient package for the strain of Morchella liumei, Meizai No. 8, was obtained. The nutrient package includes the following in terms of weight percentage: Common wheat 28%~43%, corn cobs 55%~70%, and slaked lime 1%~2%.

[0033] Its water content is 60%~65% and pH is 6.5~7.5. This nutrient pack can effectively promote the growth of strains and improve the yield and quality of strains.

[0034] The features and performance of the present invention are further described in detail below in conjunction with the embodiments. Example

[0035] This embodiment provides a strain of Morchella liumei, Meizai 8, the cultivation process of which is as follows: S1. Wild Morchella fruiting bodies were collected from Laojun Mountain, Lijiang, Yunnan in August 2007, with the accession number HKAS62872, and dried for later use.

[0036] S2. In January 2019, the spores obtained from the fruiting body were separated into single spores, and 100 different types of single spore strains of Morchella lilii were obtained, numbered G1-G100. At the Kunming Institute of Botany, Chinese Academy of Sciences, through conventional breeding methods for edible fungi, hybrid strains with no antagonism, no fanning, vigorous mycelial growth, slow aging, and more sclerotia were obtained as the intended spaceflight carrier strain (numbered G14-97). It was identified as Morchella liliii by conventional ITS molecular biology of edible fungi ( Morchella sextelata ).

[0037] S3. The strain was carried into space on the Shenzhou XIV manned spacecraft on June 5, 2022, and returned to the ground in the return capsule of the Shenzhou XIV manned spacecraft on December 4, 2022. After being fair-checked, it was brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for related research.

[0038] S4. The space-borne strain G14-97 was activated and systematically screened to obtain 500 single-hyphae strains, numbered 97G01-97G500.

[0039] S5. The 500 strains obtained were subjected to mating type gene detection, and it was determined that they contained two mating types, Mat1-1 and Mat1-2 (refer to Du X.H et al., 2017). Subsequently, the mycelium growth rate, growth potential, consistency, stability, antagonism and salt tolerance of these 500 strains were studied with reference to "GB / T 21125-2007 Technical Specifications for the Selection of Edible Fungi Varieties". The numbers containing Mat1-1 and Mat1-2 mating types, the fastest mycelium germination rate, neat edges, dense sclerotia and less pigment were selected, and multi-point and multiple strain fruiting screening tests were carried out with reference to the national invention patent (authorization announcement number: CN107409763B) previously authorized by the applicant. A strain of Morchella liumei was obtained, which has the characteristics of fast mycelium germination, resistance to low temperature, and resistance to white mold (Long-spored Monospore). Diploöspora longispora The strain was named "Meizai No. 8". The strain was preserved in the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using the 10% glycerol + distilled water preservation method.

[0040] Application Examples This application example uses the Liumei Morchella strain Meizai No. 8 provided in Example 1 for cultivation comparison with the strain G14-97 that has not been carried on space flight, to examine the test strain's fast mycelium germination, resistance to low temperature, resistance to white mold, the number of primordia generated, the number of young mushrooms formed, the number of commercial mushrooms and the yield per unit area.

[0041] The cultivation formula used in this embodiment is: 40% common wheat, 58% corn cobs, 2% slaked lime, with a water content of 55-60% and a pH of 7.

[0042] The formula of the nutrient bag used in this embodiment is: 30% common wheat, 68% corn cobs, 2% slaked lime, with a water content of 55-60% and a pH of 7.

[0043] When comparing cultivation, the cultivation conditions of the two strains must be kept consistent, and they should be cultivated according to the following cultivation methods: 1) Cultivation raw materials: The main materials are corn cobs and wheat, and the auxiliary materials are lime, gypsum, etc.

[0044] 2) Cultivation season: October to December when soil temperature is 5-15℃.

[0045] 3) Cultivation method: field covering with soil and film.

[0046] 4) Management methods: The soil temperature during the mycelium culture period should be controlled between 8 and 20°C; the soil temperature during primordium differentiation and young mushroom growth period should be controlled between 8 and 13°C, the relative humidity should be 80% to 95%, and the light intensity should be 400 to 800 Lux.

[0047] 5) Harvesting standard: When the cap length is greater than 6cm, it can be harvested (e.g. Figure 2 as shown).

[0048] The cultivation comparison results are shown in Table 1.

[0049] Table 1. Comparison results of Liumei Morchella cultivation variety Low temperature resistance (-20℃) Resistance to white mold (Monospora longispora) Time for nutrient bag to be full (ground temperature 12℃) Number of primordia (pcs / cm2) Number of young mushrooms formed (pieces / square meter) Yield (kg / mu) Meizai No.8 anti- anti- 7 8 250 1300 G14-97 Not resistant Not resistant 10 4 110 400 As can be seen from Table 1, compared with the G14-97 strain that was not cultivated by space flight, the mycelium of the Meizai No. 8 strain germinated quickly and was resistant to low temperature and white mold; the number of primordia reached 8 / square centimeter, an increase of about 100%; the number of young mushrooms formed was 250 / square meter, an increase of about 127% compared with G14-97. The yield reached 1,300kg / mu, more than three times that of G14-97.

[0050] In summary, the present invention provides a strain of Morchella lilii, Meizai No. 8, and its application. The Morchella lilii, Meizai No. 8, is subjected to space flight-induced genetic variation, and then the stable inherited traits are screened out through subculture, and the strain is obtained through mushroom screening test. The Morchella lilii, Meizai No. 8, has the characteristics of fast mycelium germination, resistance to low temperature, resistance to white mold (Diploöspora longispora), early occurrence of primordium, large number, strong clustering type of young mushrooms, good shape of commercial mushrooms, and not easy to break, and has broad application prospects.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A strain of Morchella liumei, Meizai 8, characterized in that: The deposit number is CGMCC No. 41345. It was deposited at the General Microbiology Center of China Culture Collection Administration on June 25, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The Morchella liumei strain Meizai No. 8 according to claim 1, characterized in that: The Liumei Morchella strain Meizai No. 8 includes a first specific DNA fragment of approximately 453 bp in size, a second specific DNA fragment of approximately 491 bp in size, and a third specific DNA fragment of approximately 337 bp in size. The nucleotide sequence of the first specific DNA fragment is such as SEQ ID NO: 2, the nucleotide sequence of the second specific DNA fragment is such as SEQ ID NO: 3, and the nucleotide sequence of the third specific DNA fragment is such as SEQ ID NO:

4.

3. The Morchella liumei strain Meizai No. 8 according to claim 2, characterized in that: The specific DNA fragment is obtained by PCR amplification of the Morchella lilii strain Meizai No. 8 using three pairs of specific primers; the three pairs of specific primers include Primer_MZ8_1L and Primer_MZ8_1R, Primer_MZ8_2L and Primer_MZ8_2R, and Primer_MZ8_3L and Primer_MZ8_3R, and their nucleotide sequences are shown in SEQ ID NO:5~SEQ ID NO:10, respectively.

4. The six-sister Morchella strain Meizai No. 8 according to claim 3, characterized in that The amplification system for PCR amplification using the specific primers is: PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, 1.00 mM of each specific primer, rTaq Polymerase 1.5 U, template DNA 50 ng; The reaction conditions are: Pre-denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 60 s, 51°C for 40 s, and 72°C for 30 s; final extension at 72°C for 10 min.

5. An application of the six-sister Morchella strain Meizai No. 8 as described in any one of claims 1 to 3 in the cultivation and production of Morchella.

6. The use according to claim 5, characterized in that: The cultivation conditions of the six-sister morel strain Meizai No. 8 are as follows: the soil temperature during cultivation is 5-15°C, the soil temperature during the mycelium culture period is controlled at 8-20°C; the soil temperature during primordium differentiation and young mushroom growth period is controlled at 8-13°C, the relative humidity of the air is 80%-95%, and the light intensity is 400-800Lux.

7. The use according to claim 6, characterized in that: The cultivation period of the six-sister morel strain Meizai No. 8 is 90 to 130 days.

8. The use according to claim 7, characterized in that: According to the percentage by weight, the nutrition package of the Six-sister Morchella strain Meizai No. 8 includes: Common wheat 28%~43%, corn cobs 55%~70%, and slaked lime 1%~2%.

9. The use according to claim 8, characterized in that: The water content of the nutrient pack is 55% to 60%, and the pH is 6.5 to 7.5.

Images