A Dendrocalamus farinosus transcription factor DfMYB265 gene and its application

By cloning and expressing the Liangshan Cizhu transcription factor DfMYB265 gene, the problem of low cellulose content of bamboo is solved, and the significant improvement of cellulose content of bamboo is achieved and the growth promotion of cellulose content of bamboo is provided, providing a theoretical basis for the genetic improvement of bamboo plants.

CN119193609BActive Publication Date: 2025-07-29SOUTHWEAT UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411431316.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-14
Publication Date
2025-07-29
Estimated Expiration
2044-10-14

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively improve the content of thalian bamboo cellulose and improve the quality of bamboo plants through genetic engineering, which limits the development of bamboo pulp paper enterprises, and it is difficult to tissue culture and genetic transformation of bamboo plants.

Method used

The Liangshan Cizhu transcription factor DfMYB265 gene was cloned and the expression vector was recombined with pCAMBIA1303-N vector. The bamboo seed embryos were genetically transformed by gene guns, and the mosaic bamboo plants overexpressing the DfMYB265 gene were screened to regulate the expression of cellulose synthesis-related genes CESA4, CESA7, and CESA9.

Benefits of technology

It significantly increases the cellulose content of mahogany bamboo, promotes the growth of mahogany bamboo, increases the number of branches and the amount of bamboo shoots, provides a theoretical basis for improving the genetic transformation variety of Liangshan Cizhu, and provides a way for the creation of new germplasms of bamboo plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193609B_ABST
    Figure CN119193609B_ABST
Patent Text Reader

Abstract

The present invention discloses a Dendrocalamus farinosus transcription factor DfMYB265 gene and its application. Its nucleotide sequence is shown as SEQ ID NO.1, and the encoded amino acid sequence is shown as SEQ ID NO.2. In the present invention, the DfMYB265 gene is recombined with the pCAMBIA1303-N vector to form an expression vector, and then the embryos of Phyllostachys edulis seeds are genetically transformed by gene gun. Through transgenic positive identification and screening, Phyllostachys edulis plants overexpressing the DfMYB265 gene are obtained. Compared with wild-type Phyllostachys edulis, the Phyllostachys edulis plants overexpressing the DfMYB265 gene grow rapidly, with an increase in the number of branches and the number of bamboo shoots, an increase in plant height, and a significant increase in the cellulose content in the culm. The expression of cellulose synthase CESA4, CESA7, and CESA9 related to cellulose synthesis is significantly up-regulated. The present invention provides a theoretical basis for revealing the regulatory mechanism of DfMYB265 on cellulose in the process of secondary cell wall formation, provides ideas and a theoretical basis for improving the genetic transformation varieties of Dendrocalamus farinosus, and provides an effective way for the creation of new germplasms of bamboo plants and the increase of cellulose content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering. More specifically, the present invention relates to a Dendrocalamus farinosus transcription factor DfMYB265 gene and its application. Background Art

[0002] Dendrocalamus farinosus grows fast, has high yield, long fibers and thin walls, and is an important economic bamboo species that can be used for bamboo pulp papermaking. The higher the cellulose content in bamboo, the higher the pulping rate and the quality of the paper. As a natural renewable carbon source, cellulose can be used as a raw material for the biological fermentation and biochemical industries. Increasing the cellulose content helps the conversion and utilization of biomass and realizes sustainable development. By optimizing the cellulose content, the cellulose in bamboo can be better converted into biofuels or other energy products, promoting the healthy development of human society. Thereby reducing the dependence on fossil fuels, reducing carbon emissions, and achieving a more environmentally friendly energy and material supply.

[0003] Because bamboo has the characteristics of uncertain flowering period and dying after flowering, the improvement by traditional cross-breeding is restricted. In addition to improving the quality and yield of cellulose in bamboo plants through conventional genetic improvement methods such as collecting germplasm resources and introduction and domestication, currently, more improvements are made at the molecular level through genetic engineering means, such as regulating some key enzyme genes in the cellulose synthesis pathway of bamboo, thereby improving the fiber quality, and finally new bamboo varieties suitable for papermaking can be cultivated. Since the seeds of bamboo are few, and some bamboo species do not produce seeds, it is difficult to induce callus with the embryo as the explant. However, the regeneration ability of the bamboo node stem segment to induce callus is low, making the tissue culture and genetic transformation of bamboo plants difficult. Therefore, the analysis of the functions of bamboo-related genes is mostly carried out in heterologous model plants Arabidopsis thaliana and rice, which greatly limits the creation of new bamboo germplasms. The breeding of excellent bamboo species restricts the development of many bamboo pulp papermaking enterprises in China. Currently, cellulose has become the basis for modern industrial and agricultural scientific production, and is also a key area in the research of forest molecular and biotechnology.

[0004] As one of the bamboo species with the richest resources in China, Phyllostachys edulis affects its efficient development and utilization due to its not very high cellulose content. Therefore, studying how to regulate the cellulose-related genes of Phyllostachys edulis by genetic engineering means to improve its cellulose quality and yield and increase the cellulose content in plants is of great significance for the development and utilization of this resource plant, Phyllostachys edulis. Summary of the Invention

[0005] An object of the present invention is to solve at least the above problems and / or defects, and provide at least the advantages described hereinafter.

[0006] To achieve these objects and other advantages of the present invention, a Dendrocalamus farinosus transcription factor DfMYB265 gene is provided, and its nucleotide sequence is shown in SEQ ID NO.1.

[0007] Preferably, the encoded amino acid sequence is shown in SEQ ID NO.2.

[0008] An expression vector comprising the Dendrocalamus farinosus transcription factor DfMYB265 gene as described above.

[0009] Preferably, the expression vector is pCAMBIA1303-N-DfMYB265.

[0010] An application of the Dendrocalamus farinosus transcription factor DfMYB265 gene as described above in regulating the cellulose content of plants.

[0011] An application of the expression vector as described above in regulating the cellulose content of plants.

[0012] An application of the Dendrocalamus farinosus transcription factor DfMYB265 gene as described above in promoting plant growth.

[0013] An application of the expression vector as described above in promoting plant growth.

[0014] Preferably, the application of the Dendrocalamus farinosus transcription factor DfMYB265 gene in regulating the cellulose content of plants includes:

[0015] Step 1: Construct a vector of the Dendrocalamus farinosus transcription factor DfMYB265 gene;

[0016] Step 2: Transform the constructed vector into plants or plant cells;

[0017] Step 3: Cultivate and screen to obtain plants with high cellulose content.

[0018] Preferably, the application of the Dendrocalamus farinosus transcription factor DfMYB265 gene in promoting plant growth includes: increasing the plant height of Phyllostachys edulis, increasing the number of branches and the shoot yield of Phyllostachys edulis.

[0019] The present invention has at least the following beneficial effects: The present invention cloned a Dendrocalamus farinosus transcription factor DfMYB265 gene encoding 318 amino acid residues. Through the construction of a phylogenetic tree analysis of the MYB family genes in model plants such as Dendrocalamus farinosus and Arabidopsis thaliana, Oryza sativa, Zea mays, and Populus trichocarpa, it is shown that the sequence of DfMYB265 has high conservation;

[0020] In the present invention, the DfMYB265 gene is recombined with the pCAMBIA1303-N vector to form a binary expression vector, and then the embryos of Phyllostachys edulis seeds are genetically transformed by gene gun. Through transgenic positive identification and screening, Phyllostachys edulis plants overexpressing the DfMYB265 gene are obtained; compared with wild-type Phyllostachys edulis, the Phyllostachys edulis plants overexpressing the DfMYB265 gene grow rapidly, with an increase in the number of branches and bamboo shoots, an increase in plant height, and a significant increase in the cellulose content in the culm; the expressions of cellulose synthase CESA4, CESA7, and CESA9 related to cellulose synthesis in the Phyllostachys edulis plants overexpressing the DfMYB265 gene are significantly up-regulated;

[0021] In the present invention, genes interacting with DfMYB265 are analyzed by yeast one-hybrid and LUC analysis. Based on this, a regulatory network of the DfMYB265 gene in the process of secondary wall formation is constructed, providing a theoretical basis for revealing the regulatory mechanism of DfMYB265 on cellulose in the process of secondary cell wall formation, providing ideas and a theoretical basis for improving the genetically transformed varieties of Neosinocalamus affinis, and providing an effective way for the creation of new germplasms of bamboo plants and the increase of cellulose content.

[0022] Other advantages, objectives, and features of the present invention will be partially reflected by the following description, and partially will also be understood by those skilled in the art through the research and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the total RNA electrophoresis pattern of Neosinocalamus affinis in Example 1 of the present invention;

[0024] Figure 2 It is the electrophoresis pattern of the amplification of the CDS sequence of the DfMYB265 gene in Example 1 of the present invention;

[0025] Figure 3 It is the multiple sequence alignment result of the amino acids encoded by the DfMYB265 gene and homologous genes of other species in Example 1 of the present invention;

[0026] Figure 4 It is the analysis diagram of the tissue expression level of DfMYB265 in Example 1 of the present invention;

[0027] Figure 5 It is the electrophoresis pattern for the identification of positive bacteria in the construction of the expression vector in Example 2 of the present invention;

[0028] Figure 6 It is the cellulose standard curve in Example 3 of the present invention;

[0029] Figure 7 It is the electrophoresis pattern for the identification of positive plants of DfMYB265 transgenic Phyllostachys edulis in Example 3 of the present invention;

[0030] Figure 8This is for testing the GFP signal in the roots of DfMYB265-overexpressing moso bamboo using the GFP wavelength light source in Example 3 of the present invention;

[0031] Figure 9 This is an analysis chart of the expression levels of DfMYB265-overexpressing moso bamboo in Example 3 of the present invention. Among them, WT is wild moso bamboo, and L1, L2, and L3 are DfMYB265-overexpressing moso bamboo;

[0032] Figure 10 This is a photo of one-year-old wild moso bamboo and DfMYB265-overexpressing moso bamboo in Example 3 of the present invention;

[0033] Figure 11 This is the number of bamboo shoots (a) and the average plant height (b) of DfMYB265-overexpressing moso bamboo in one year in Example 3 of the present invention;

[0034] Figure 12 This is a comparison chart of the cellulose content of DfMYB265-overexpressing moso bamboo in Example 3 of the present invention. Among them, WT is wild moso bamboo, and OE-1, OE-2, and OE-3 are DfMYB265-overexpressing moso bamboo;

[0035] Figure 13 This is the relative expression level of genes related to cellulose synthesis in DfMYB265-overexpressing moso bamboo in Example 3 of the present invention;

[0036] Figure 14 This is to verify the interaction between DfMYB265 and the DfCESA9 promoter by yeast one-hybrid (a) and luciferase activity (b) assays in Example 4 of the present invention. Detailed implementation manners

[0037] The following further elaborates on the present invention in conjunction with the attached drawings so that those skilled in the art can implement it with reference to the text of the specification.

[0038] It should be understood that terms such as "having", "comprising", and "including" used herein do not exclude the presence or addition of one or more other elements or their combinations.

[0039] In the following examples, the experimental materials and main instruments used are as follows:

[0040] 1. Experimental materials: Two-year-old Dendrocalamus farinosus is provided by the bamboo resource nursery of the School of Life Science and Engineering, Southwest University of Science and Technology; Nicotiana benthamiana grown in this laboratory for 4 - 5 weeks.

[0041] 2. Main reagents and strains:

[0042] (1) Enzyme preparations: LA Taq DNA polymerase, pMD19-T vector (TaKaRa), T4-DNA ligase, rTaq DNA polymerase; the vectors used are all owned by the laboratory (empty pCAMBIA-1303N, PGADT7, pHisII, pGreenII-LUC).

[0043] (2) Kits: DNA gel extraction kit, plasmid miniprep kit, RNAiso Plus reagent (TaKaRa), First Strand cDNA Synthesis Kit (TIANGEN), Taq Pro Universal SYBR qPCR Master Mix (Vazyme), isopropyl-β-D-thiogalactoside (IPTG), 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal), 5-bromo-4-chloro-3-indol-β-D-glucuronide (X-Glu) powder, 6×Loading buffer, DL 2000 DNA Marker, Trizol reagent, etc. are provided by Beijing Tiangen Biochemical Technology Co., Ltd.

[0044] (3) Bacterial strains: Competent DH5α Escherichia coli and competent Agrobacterium tumefaciens GV3103 / EHA105 are both prepared in this laboratory, and the yeast strain used is Y1H.

[0045] (4) Yeast extract, agarose and tryptone are provided by Gene Company, and AceQ Universal SYBR qPCR Master Mix is provided by Nanjing Novoprotein Scientific Co., Ltd.

[0046] (5) Conventional reagents such as absolute ethanol, sulfuric acid, β-mercaptoethanol, hydrochloric acid, calcium chloride, acetone, mercaptoacetic acid, etc. are all ultra-pure and analytical grade.

[0047] 3. Main Instrumentation and Equipment: 2.5 μL, 10 μL, 20 μL, 100 μL, 1000 μL pipettes (Eppendorf), centrifuge (Eppendorf), DHP-9052 constant temperature incubator of Shanghai Qixin Co., Ltd., FerroTec constant temperature metal bath, PCR automatic amplifier (Bio-Rad), LPC-V-15B double-sided ultra-clean workbench (Shandong Xinhua), BSD-400 constant temperature shaking incubator (Boxun), MOST-L85 high-pressure steam sterilizer (Shandong Xinhua), ten-thousandth electronic balance (Sartorius), HH-1 digital display constant temperature water bath (Zhiboruiyi), T6 ultraviolet-visible spectrophotometer (Purkinje General), BXYC-DX2200 stack type intelligent precision shaker (Boxun), Bio-Rad GelDoc gel imaging system, DYCP-31 / DN horizontal agarose electrophoresis tank and DDY-8C electrophoresis apparatus (Beijing Liuyi), Thermo forma ultra-low temperature freezer, CFX96tm Real-TimeSystem gradient real-time quantitative gene analyzer, NSZ-405 stereomicroscope (Yongxin).

[0048] 4. Preparation of Other Main Reagents:

[0049] (1) CTAB DNA extraction solution (1000 mL): 1M Tris-Hydrochloride (Tris-HCl) (pH 8.0, 100 mmol / L) 100 mL, CTAB (Cetyltrimethylammonium Bromide) 20 g, NaCl (1.4 mol / L) 81.816 g, Ethylenediaminetetraacetic Acid Disodium Salt (pH 8.0, 0.5 mmol / L) 40 mL, β-mercaptoethanol (40 mmol / L) 2 mL.

[0050] (2) Phosphate buffer (pH = 7.2): Take 187 mL of 0.2 mol / L NaH2PO4 and 13 mL of 0.2 mol / L Na2HPO4, mix them evenly, make up the volume to 400 mL with distilled water, and filter and sterilize.

[0051] (3) 1M NaOH: Take 4 g of solid NaOH, dissolve it in distilled water, and make up the volume to 100 mL.

[0052] (4) 60% (v / v) H2SO4: Add 60 mL of concentrated sulfuric acid to 40 mL of distilled water.

[0053] (5) 2% Anthrone: Take 0.2 g of anthrone powder, dissolve it with concentrated sulfuric acid, and finally make up the volume to 100 mL (Note: Place it in the -4°C refrigerator for 2 h before use).

[0054] (6) The preparation of other reagents such as LB liquid and solid culture medium, 50× Tris-acetate (TAE) buffer (1000 mL), IPTG (isopropylthiogalactoside) (200 mg / mL), ampicillin (Amp), various antibiotics, and 15% glycerol was strictly in accordance with the experimental operation procedures.

[0055] Example 1

[0056] Acquisition and Analysis of the Coding Sequence of DfMYB265 from Psoralea corylifolia

[0057] 1. Extraction of total RNA from Psoralea corylifolia

[0058] Select roots, stems, and leaves of two-year-old radix syriacifolia trees with good growth, cut them with scissors, place them in sterilized EP tubes, and then quickly freeze them in liquid nitrogen. Use TIANGEN's Trizol reagent and follow the kit instructions to extract RNA. The specific steps are as follows:

[0059] (1) Grind the plant sample bottle thoroughly in liquid nitrogen, transfer it to a 1.5 mL RNA-free centrifuge tube, add 1 mL Trizol, mix gently, incubate at room temperature for 10 min, add 200 mL chloroform for 3-5 min, and incubate at 12000 rpm for 10 min (4°C);

[0060] (2) Transfer the supernatant to a new 1.5 mL sterilized EP tube, add an equal volume of isopropanol, and incubate for 20 min at 12,000 rpm for 10 min (4°C). Discard the supernatant.

[0061] (3) Wash twice with 1 mL of 75% alcohol (12,000 rpm, 5 min);

[0062] (4) Aspirate the alcohol, blow dry the precipitate, and dissolve the precipitate with 30-50 mL of RNA-free water.

[0063] (5) Take 2 μL of RNA and perform 1% agarose gel electrophoresis, and select the clear RNA for subsequent experiments;

[0064] Wear a mask and gloves throughout the process to prevent contamination of the sample and RNA degradation. After RNA extraction, place it in an ice box for subsequent experiments.

[0065] Figure 1 This is the electrophoresis diagram of total RNA from Psoralea corylifolia. It can be seen that the RNA has three bands (i.e., 28S, 18S, and 5.8S of RNA), which is of good quality and can be used for reverse transcription as a template for DfMYB265 cloning.

[0066] 2. Synthesis of Psoralea corylifolia cDNA

[0067] (1) Measure the concentration of the extracted RNA, and then reverse transcribe it into cDNA using the reverse transcription kit from TIANGEN

[0068] (2) Prepare the DNA removal mixture according to Table 1, mix thoroughly, centrifuge briefly, incubate at 42 °C for 3 min, and then place on ice.

[0069] (3) Prepare the reverse transcription mixture according to Table 2, mix well with the DNA removal mixture, and centrifuge.

[0070] (4) Finally, use a PCR instrument to incubate at 42 °C for 15 min and 95 °C for 3 min to obtain cDNA, which is stored at -20 °C for later use.

[0071] Table 1

[0072] Composition Dosage 5×gDNA Buffer 2 μL RNA from leaves of Bambusa emarginata 50 ng - 2 μg <![CDATA[RNase-Free ddH2O]]> Make up to 8 μL

[0073] Table 2

[0074] Composition Dosage 10×King RT Buffer 2 μL FastKing RT Enzyme Mix 1 μL FQ-RT Primer Mix 2 μg <![CDATA[RNase-Free ddH2O]]> Make up to 10 μL

[0075] 3. Clone the MYB265 gene of Bambusa emarginata

[0076] (1) Primer design

[0077] Design PCR primers DfMYB265-F and DfMYB265-R using Primer5 (Table 3).

[0078] Table 3

[0079] Primer Name Primer Sequence (5’-3’) DfMYB265-F ATGGAGGGACATGTGGACAA DfMYB265-R AAATAAGCTTCTAATTGATA

[0080] (2) PCR reaction to amplify the CDS sequence of the DfMYB265 gene

[0081] Perform PCR amplification using Bambusa emarginata cDNA as a template. The PCR reaction system and reaction program are shown in Tables 4 and 5.

[0082] Table 4

[0083] Reagent Volume TaKaRa LA Taq (5 U / μL) 0.5 μL 2×GC Buffer 25 μL dNTP Mixture (2.5 mM each) 5 μg DfMYB265-F 1.5 μL DfMYB265-R 1.5 μL cDNA 4 μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0084] Table 5

[0085]

[0086]

[0087] (3) Recovery of the amplified PCR product

[0088] After the PCR reaction, electrophoresis detection was then carried out. All reaction solutions were subjected to 1% agarose gel electrophoresis at a voltage of 80 V for about 30 min. The results were as Figure 2 shown. A gel strip of the size of the target band was carefully cut out in a UV illuminator using a scalpel, and a DNA fragment gel recovery kit from TIANGEN was used for gel recovery. After recovery, 1 μL was taken with a UV-visible spectrophotometer for the determination and identification of DNA concentration and purity;

[0089] (4) Construction of the pMD19-T-DfMYB265 vector. The ligation system is shown in Table 6. The ligation and transformation process was as follows: After mixing the ligation system, it was placed in a PCR instrument at 22 °C for 30 min for rapid ligation; the above ligation product was added to the pre-divided DH5α Escherichia coli competent cells taken out from the ultra-low temperature refrigerator, gently mixed, and placed on ice for 30 min; heat shock at 42 °C for 3 min, and then placed on ice for 5 min; 600 μL of liquid LB medium was added in a laminar flow hood, and it was incubated in a constant temperature shaker at 37 °C at 180 rpm for 1 h; centrifuged at 4000 rpm for 5 min to collect the bacteria. In the laminar flow hood, the excess medium was poured off, the bacteria were mixed, and then spread on LB(Amp) solid medium and incubated upside down in a constant temperature incubator at 37 °C for 18 h;

[0090] Table 6

[0091] Composition Volume 10×T4 ligase Buffer 1 μL T4 ligase 1 μL PCR product of DfMYB265 gene (40 ng / μL) 6 μL pMD19-T vector (10 ng / μL) 2 μL

[0092] (5) Colony PCR verification and plasmid extraction

[0093] Twelve colonies were separately picked from the LB(Amp) solid medium in (4) and cultured in 800 μL of LB(Amp) liquid medium in a shaker at 37 °C until the medium became visibly turbid to the naked eye. Then, the reaction system was prepared according to Table 7, and amplification was carried out according to the procedure in Table 8. Finally, the PCR products were subjected to electrophoresis detection. According to the electrophoresis results, the bacterial liquid samples of the target band were sent to BGI for sequencing. After correct sequencing, the samples were cultured on a large scale, and plasmids were extracted (stored at -20 °C), and at the same time, the bacterial liquid was stored with glycerol;

[0094] Table 7

[0095]

[0096]

[0097] Table 8

[0098]

[0099] The sequencing results are shown in SEQ ID NO.1. The CDS sequence is 957 bp in length, and the encoded amino acid sequence is shown in SEQ ID NO.2;

[0100] (6) Multiple sequence alignment of the amino acids encoded by the DfMYB265 gene and homologous genes of other species. The amino acid sequence (SEQ ID NO.2) of DfMYB265 (DfaA02G006840) screened from Dendrocalamus farinosus was used to search for MYB amino acid sequences in rice and Phyllostachys edulis through the NCBI online website (BLAST: Basic Local Alignment Search Tool (nih.gov)), and multiple sequence alignment analysis was performed using MEGA 7.0;

[0101] The results of the multiple sequence alignment are as Figure 3 shown. The transcription factor DfMYB265 gene (DfaA02G006840) of Dendrocalamus farinosus has low homology with homologous genes of rice and Phyllostachys edulis, and its homology with rice is only 64%, indicating that the DfMYB265 gene sequence of Dendrocalamus farinosus has high specificity;

[0102] (7) Analysis of the tissue expression pattern of DfMYB265

[0103] First, select Dendrocalamus farinosus with good growth, sample each tissue part (stem, lateral branch, mature leaf, young leaf, shoot below 10 cm), place it in liquid nitrogen, extract RNA and reverse transcribe it into cDNA;

[0104] Then, according to the conserved domain of DfMYB265 and the homologous gene sequence, quantitative primers were designed, and the Dendrocalamus farinosus Tublin sequence was used as an internal reference gene. The primers are shown in Table 9;

[0105] Using the cDNA of each part of Dendrocalamus farinosus as a template, qRT-PCR detection was performed through the quantitative reagent of Novoprotein Co., Ltd. The reaction system is shown in Table 10, and the reaction program is shown in Table 11. Use 2 -ΔΔCT to calculate the expression levels of the DfMYB265 gene in the stem, lateral branch, mature leaf, young leaf, and shoot below 10 cm of Dendrocalamus farinosus, so as to facilitate the analysis of the tissue expression pattern of DfMYB265.

[0106] Table 9

[0107]

[0108] Table 10

[0109]

[0110] Table 11

[0111]

[0112] The results of tissue expression analysis of DfMYB265 are as follows Figure 4 As shown, it can be seen that DfMYB265 is expressed in various parts of Liangshan bamboo, among which the expression level is the highest in the stem.

[0113] Example 2

[0114] Construction and identification of pCAMBIA1303-N-DfMYB265 expression vector

[0115] SnapGene software was used to analyze the restriction enzyme sites of the DfMYB265 gene. Primers were designed using Primer5 based on the restriction enzyme sites of pCAMBIA1303-N. The primer sequences are shown in Table 12.

[0116] PCR amplification was performed using the pMD19-T-DfMYB265 plasmid obtained in Example 1 as a template. The reaction system is shown in Table 13, and the reaction procedure is shown in Table 5, wherein the Tm value is 60°C. After fragment purification, the purified product and the pCAMBIA1303-N empty vector were double-digested using TaKaRa's KpnI and XbaI endonucleases at 37°C for 2 h. The reaction system is shown in Table 14.

[0117] The ligation was performed overnight at 16°C according to a 3:1 PCR product to vector mass ratio (see Table 6), followed by E. coli genetic transformation and colony PCR verification. The positive bacterial plasmid was extracted and double enzyme digestion verification was performed. The reaction system is shown in Table 14. 1% agarose gel electrophoresis was used to verify whether DfMYB265 was successfully fused with the pCAMBIA1303-N vector. The positive strain was stored in glycerol and further transformed with Agrobacterium. After that, colonies were picked for colony PCR verification. The obtained expression vector was named pCAMBIA1303 -N-DfMYB265; Among them, the specific method of Agrobacterium transformation is as follows: take EHA105 Agrobacterium competent cell, add 10 μL of plasmid, and gently mix; place on ice for 10 minutes, quick-freeze in liquid nitrogen for 2 minutes, and water bath at 37°C for 5 minutes, then add 700 μL of LB (containing Rif) liquid culture medium in a clean workbench; culture in a shaker at 28°C for 3-5 hours, then centrifuge at 4000 r / min for 6 minutes, discard the supernatant, and resuspend the bacteria; spread on LB solid culture medium (containing Rif and required antibiotics) and culture in a 28°C incubator for 2-3 days.

[0118] Table 12

[0119]

[0120] Table 13

[0121]

[0122] Table 14

[0123]

[0124] The MYB265 gene fragment and the pCAMBIA1303-N vector were digested with restriction enzymes and recovered. The two recovered fragments were ligated overnight with T4 ligase. After ligation, they were transformed into competent DH5α Escherichia coli cells. The grown colonies were verified by PCR positive cloning. The electrophoresis pattern showed that 9 colonies could amplify the fragment, and the fragment size was about 1000 bp( Figure 5 ).

[0125] Example 3

[0126] Application of the DfMYB265 gene of Bambusa emarginata in regulating the cellulose content and growth and development of Phyllostachys edulis

[0127] 1. Particle bombardment transformation of Phyllostachys edulis seed embryos

[0128] The Phyllostachys edulis seeds were placed on the foam for germinating seeds. When the embryos just germinated, they could be used as recipients for particle bombardment transformation;

[0129] The Phyllostachys edulis seeds with just germinated embryos were placed in a hypertonic medium and cultured in the dark for 4 h. The inside and outside of the particle gun were wiped with 75% alcohol in a laminar flow hood. The specific operation steps refer to the method of Gong Daoyong (Gong Daoyong, Hu Shanglian, Cao Ying, etc. Cloning, bioinformatics analysis and induced expression of two bZIP genes from Neosinocalamus affinis[J].Bulletin of Botanical Research,2018,38(2):268-277);

[0130] After particle bombardment, the Phyllostachys edulis seeds were continuously cultured in the dark on the hypertonic medium at 25°C for 16 h. Subsequently, the Phyllostachys edulis seeds were cultured under dark conditions at 25°C for 3 days, and then cultured under light until three leaves grew out and transplanted into the soil to obtain seedlings.

[0131] 2. Identification of transgenic plants

[0132] (1) The DNA of wild-type and transgenic Phyllostachys edulis was extracted by the CTAB method and tested by PCR using HYG-F and HYG-R primers. The HYG-F and HYG-R primers are shown in Table 15;

[0133] Table 15

[0134]

[0135] (2) Extract the RNA from the leaves of wild-type and transgenic moso bamboo, reverse transcribe it into cDNA, use Tublin as the internal reference gene for moso bamboo, and detect the relative expression level of DfMYB265 in overexpressed moso bamboo;

[0136] (3) Use the LUYOR-3415RG dual-wavelength fluorescent protein excitation light source to irradiate and examine the GFP protein in positive plants;

[0137] (4) Determination of the cellulose content of transgenic moso bamboo. Method: Take 0.5 g of the moso bamboo stem, grind it into fine powder in liquid nitrogen, add 60 mL of 60% sulfuric acid, and digest for 30 min; transfer the digested cellulose solution to a 100 mL volumetric flask, and make up the volume to the mark with 60% sulfuric acid, shake well and filter with a Buchner funnel; take 5 mL of the above solution and put it into a 100 mL volumetric flask, dilute it to the mark with distilled water in a cold water bath, and shake well; take 2 mL of the solution from the previous step and put it into a stoppered test tube, add 0.5 mL of 2% anthrone, and add 5 mL of concentrated sulfuric acid along the tube wall, stopper the tube, shake well, let it stand for 12 min, and measure the OD 625 value;

[0138] Determination of the standard curve with cellulose standard samples. Method: Take 6 small test tubes, add 0, 0.4, 0.8, 1.2, 1.6, 2.0 mL of cellulose standard solution respectively, add 2, 1.6, 1.2, 0.8, 0.4, 0 mL of distilled water respectively, shake well, and each tube contains 0, 40, 80, 120, 160, 200 μg of cellulose in turn; add 0.5 mL of 2% anthrone to each tube, then add 5 mL of concentrated sulfuric acid along the tube wall, stopper the tube, shake well, and let it stand for 1 min; measure the OD 625 value, with the absorbance as the y-axis and the cellulose content as the x-axis, draw the cellulose standard curve as Figure 6 shown.

[0139] Transform the pCAMBIA1303-N-DfMYB265 expression vector into the embryo of moso bamboo seeds by particle bombardment. After growing for a period of time, perform PCR cloning verification on positive plants with the HYG tag on pCAMBIA1303-N. The results show that a specific band consistent with the pCAMBIA1303-N-DfMYB265 recombinant plasmid was amplified from the transgenic moso bamboo plants ( Figure 7 ), confirming that the DfMYB265 gene has been successfully integrated into the moso bamboo genome.

[0140] By cutting the roots of DfMYB265 transgenic moso bamboo with positive DNA level, irradiating with the LUYOR-3415RG dual-wavelength fluorescent protein excitation light source, and testing the GFP-tagged protein carried in the plasmid pCAMBIA1303-N-DfMYB265, the results showed that after irradiating with the GFP wavelength light source, green fluorescence appeared on the roots of moso bamboo overexpressing DfMYB265, further confirming that DfMYB265 was successfully transferred into moso bamboo( Figure 8 ).

[0141] By detecting the relative expression level of the DfMYB265 gene in transgenic plants at the RNA level, extracting the RNA of wild-type and DfMYB265 overexpressing moso bamboo positive plant leaves, and using qRT-PCR to detect the relative expression level of the DfMYB265 gene in DfMYB265 overexpressing moso bamboo, the results showed that the expression level of the DfMYB265 gene in DfMYB265 overexpressing moso bamboo was up to 6.2 times that of the control, significantly higher than that of the wild-type( Figure 9 ).

[0142] Compared with wild moso bamboo, the DfMYB265 transgenic moso bamboo after one year of growth was more vigorous and had more branches, while wild moso bamboo had no branches( Figure 10 ). The shoot emergence quantity and the average plant height of all bamboos of the DfMYB265 transgenic moso bamboo and wild moso bamboo growing for one year were counted. The results showed that the plant height of the DfMYB265 transgenic moso bamboo was significantly higher than that of the wild moso bamboo, and the shoot emergence quantity was also more than that of the wild moso bamboo( Figure 11 ).

[0143] The cellulose content of the successfully transgenic one-year-old DfMYB265 transgenic moso bamboo was analyzed, and the difference significance analysis was carried out using Graphpad Prism software. The measurement results showed that the cellulose content in the DfMYB26� transgenic moso bamboo was significantly higher than that of the wild-type( Figure 12 ).

[0144] 3. Real-time fluorescence quantitative analysis

[0145] (1) Extract the RNA of wild-type and DfMYB265 overexpressing (over-expression, OE) moso bamboo positive plant leaves. Using the wild-type plants as a control, the relative expression level of the DfMYB265 gene in DfMYB265 overexpressing moso bamboo was detected by qRT-PCR. After identifying the positive overexpressing moso bamboo, the expression levels of genes related to cellulose biosynthesis were analyzed. Tublin was used as an internal reference gene, and the primers are shown in Table 16;

[0146] Table 16

[0147]

[0148] (2) qRT-PCR Amplification System and Procedure

[0149] Using Phyllostachys edulis cDNA as a template for PCR amplification, the reaction system and procedure are shown in Tables 17 and 18;

[0150] Table 17

[0151] Reagent Volume TaKaRa LA Taq (5 U / μL) 0.5 μL 2×GC Buffer 25 μL dNTP Mixture (2.5 mM each) 5 μg Primer F 1.5 μL Primer R 1.5 μL cDNA 4 μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0152] Table 18

[0153]

[0154]

[0155] To explore the regulation of DfMYB265 on the secondary wall of Phyllostachys edulis, this example started from the key genes related to cellulose synthesis, and detected the changes in the expression levels of genes related to cellulose and lignin synthesis by qRT-PCR. The results showed that the overexpression of DfMYB265 led to the up-regulation of the expression of CESA4, CESA7, and CESA9 related to cellulose synthesis in Phyllostachys edulis ( Figure 13 ).

[0156] Example 4

[0157] Verification of DfMYB265 Interaction Proteins

[0158] 1. Verification of the Interaction Relationship between DfMYB265 and DfCESA9 by Yeast One-Hybrid

[0159] (1) Construction of Recombinant Plasmid

[0160] According to the restriction enzyme sites on PGADT7 and DfMYB265, as well as the restriction enzyme sites on the pHisII vector and the lignocellulose-related promoter pDfCESA9 (DfaC06G009180), the corresponding primers DfMYB265-F (EcoRⅠ), DfMYB265-R (BamHⅠ) and the primers for the cellulose-related promoter are shown in Table 19. The connection system and procedure of PGADT7-DfMYB265 are as described in the method of Example 2; The pHisII vector was double-digested with EcoRⅠ and SacⅠ restriction endonucleases, and then through the connection method of homologous recombination, the system is shown in Table 20, placed in a PCR instrument at 37 °C for 30 min, and through Escherichia coli genetic transformation, colony PCR, plasmid extraction, and double-digestion verification, finally the fusion expression vector of pHisII and the cellulose-related promoter was obtained;

[0161] Table 19

[0162]

[0163] Table 20

[0164]

[0165]

[0166] Note: X(50 - 200 ng) : Y(10 - 200 ng) = 1:2

[0167] (2) Transformation of recombinant plasmid into yeast two-hybrid

[0168] 1) Reagent preparation:

[0169] a. 50% PEG 4000 : Take 50 g of PEG 4000 Dissolve it in distilled water, make up the volume to 100 mL, and sterilize at 121 °C for 18 min;

[0170] b. 1 M LiAc: Take 3.3 g of LiAc powder, dissolve it in distilled water, make up the volume to 50 mL, adjust the pH to 7.5 with 1 M HCL, and sterilize at 121 °C for 18 min;

[0171] c. 10×TE: 10 mL of 1 mol / L Tris-Hcl + 2 mL of 0.5 mol / L EDTA, make up the volume to 100 mL with distilled water, adjust the pH to 7.5, and sterilize at 121 °C for 18 min;

[0172] d. 1.1×TE / LiAc: 7.8 mL of H2O + 1.1 mL of 10×TE + 1.1 mL of LiAc;

[0173] e. 1.1×TE / LiAc / PEG 4000 : 8 mL of 50% PEG 4000 + 1 mL of 10×TE + 1 mL of 1 M LiAc

[0174] f. YDPA liquid medium: See Table 21;

[0175] Table 21

[0176]

[0177] g. 10×Dex: Dissolve 20 g of glucose in distilled water, make up the volume to 100 mL, and filter-sterilize with a 0.25 μm filter head;

[0178] h. 10×YNB: Dissolve 5 g of ammonium sulfate and 1.7 g of YNB in distilled water, make up the volume to 100 mL;

[0179] i. 10×AA: 150 mg of L-Iso, 250 mg of L-Phe, 750 mg of L-Val, 1000 mg of L-Thr, 100 mg of L-Arg, 150 mg of L-Tyr, 150 mg of L-Lys, 100 mg of L-Met, dissolved in distilled water, made up to 500 mL, sterilized at 121 °C for 18 min;

[0180] j. 100×His: 0.2 g of His dissolved in distilled water, made up to 100 mL, sterilized at 121 °C for 18 min;

[0181] k. 100×Trp: 0.2 g of Trp dissolved in distilled water, made up to 100 mL, sterilized at 121 °C for 18 min;

[0182] l. 100×Leu: 1 g of Leu dissolved in distilled water, made up to 100 mL, sterilized at 121 °C for 18 min;

[0183] m. 100×Ade: 2 g of Ade dissolved in distilled water, made up to 100 mL, sterilized at 121 °C for 18 min;

[0184] n. SD / -Trp solid medium: 10 mL of 10×YNB, 10 mL of 10×Dex, 10 mL of 10×AA, 1 mL of 100×His, 1 mL of 100×Leu, 1 mL of 100×Ade added to 67 ml of sterilized distilled water (containing 1.5 g of agar powder);

[0185] o. SD / -Trp / -Leu / -Leu solid medium: 10 mL of 10×YNB, 10 mL of 10×Dex, 10 mL of 10×AA, 1 mL of 100×Ade, added to 69 ml of sterilized distilled water (containing 1.5 g of agar powder).

[0186] 2) Preparation of Y1H yeast competent cells:

[0187] Streak the Y1H strain on YDPA solid medium, incubate at 30 °C for 3 days, pick a single colony into 3 mL of YDPA medium, incubate at 30 °C on a shaker for 8 h, pipette 5 μL into 50 mL of YDPA medium, incubate at 30 °C for 16 - 20 h until OD 600 = 0.15 - 0.3;

[0188] Centrifuge at 700×g for 5 min at room temperature to collect the cells, resuspend the yeast in 100 mL of YDPA, incubate at 30 °C for 3 - 5 h until OD 600 = 0.4 - 0.5, centrifuge at 700×g for 5 min at room temperature to collect the cells, resuspend in 50 mL of sterile water;

[0189] Collect the bacterial cells by centrifugation at 700×g for 5 min at room temperature, and resuspend the yeast in 3 mL of 1.1×TE / LiAc solution;

[0190] Aliquot the resuspended solution into three 1.5 mL centrifuge tubes, centrifuge at high speed for 15 s, pour off the supernatant, and add 600 μL of 1.1×TE / LiAc solution to resuspend the yeast.

[0191] 3) Y1H yeast transformation:

[0192] Pre-add an equal proportion of 3 μL of the constructed PGADT7 plasmid, 3 μL of the constructed pHisII plasmid, 3 μL of denatured Carrier DNA (salmon sperm), and 300 μL of 1.1×TE / LiAcPEG 4000 , and mix well;

[0193] Add 50 μL of the resuspended yeast to the tube, mix gently, incubate in a 30°C water bath for 30 min, mix every 10 min, and add 200 μL of DMSO to the tube and mix well;

[0194] Activate in a 42°C water bath for 15 min, invert the tube to mix up and down every 5 min, centrifuge at 700×g for 5 min, discard the supernatant, resuspend with 1 mL of YPDA liquid medium, and recover at 30°C on a shaker for 1 h;

[0195] Centrifuge at high speed for 15 s, discard the supernatant, resuspend with 100 μL of NaCl (0.9%), take 10 μL of the resuspended solution, dilute it 100 times, and plate it (SD / -Trp, SD / -Trp / -Leu / -His solid medium).

[0196] 4) Yeast spotting:

[0197] Pick the positive single colonies growing on the SD / -Trp / -Leu / -His solid medium, inoculate them into 15 mL of YDPA liquid medium, and culture overnight at 30°C and 200 rpm for 16 - 18 h;

[0198] Take 2 mL of the overnight culture, centrifuge at 12000g for 1 min, remove the supernatant, and resuspend the bacterial cells with sterilized H2O to OD 600 = 0.5;

[0199] Spot 100 μL of 30 mM 3AT and 200 μL of X-α-gal (24 mg of X-α-gal dissolved in 6 mL of DMF) on the SD / -Trp / -Leu / -Leu solid medium until the liquid is completely absorbed;

[0200] The OD 600The bacterial solutions with a value of 0.5 were diluted 10 times and 100 times respectively, and then 2 μL of the three different concentrations of bacterial solutions were taken and titrated on the SD / -Trp / -Leu / -His solid medium (added with 3AT and X-α-gal), and cultured at 30 °C for 4 - 7 days.

[0201] 2. Verification of the interaction between DfMYB265 and DfCESA9 by bimolecular luciferase reporter assay (LUC)

[0202] (1) Construction of recombinant plasmids

[0203] According to the restriction enzyme sites on the pCAMBIA1303-N, DfMYB265, pGreenII-LUC vectors and the cellulose-related promoter pDfCESA9, the corresponding primers were designed as shown in Table 22. PCR amplification, vector construction and restriction enzyme verification were carried out respectively. The promoters of pCAMBIA1303-N-DfMYB265 and DfCESA9 were cloned and recovered. The pGreenII-LUC vector was double digested with EcoRⅠ and SacⅠ restriction endonucleases, and then ligated by homologous recombination. It was placed in a PCR instrument at 37 °C for 30 min, and then through genetic transformation of Escherichia coli, colony PCR, plasmid extraction and double digestion verification, finally the fusion expression vector of pGreenII-LUC and the DfCESA9 promoter was obtained.

[0204] Table 22

[0205]

[0206] (2) Agrobacterium transformation

[0207] Positive GV3103-p19 Agrobacterium strains of pCAMBIA1303-N-DfMYB265 and LUC-ProDfCESA9 were obtained.

[0208] (3) Tobacco injection

[0209] The two Agrobacterium strains were mixed in equal proportion, shaken well and then left to stand for 2 - 3 h, and then used for tobacco injection.

[0210] (4) Detection of luciferase activity

[0211] The tobacco leaves in the injection area were cut and placed in an EP tube, and then put into liquid nitrogen. The leaves were ground with a liquid nitrogen grinder.

[0212] Using the enzyme activity detection kit Dual-Luciferase Reporter Assay System (Promega, catalog number: E1910), add 100 μL of lysis buffer Passive Lysis Buffer (provided by Dual-Luciferase Reporter Assay System) to the ground sample, mix well for 30 s, and centrifuge at 12,000 rpm at room temperature for 5 min;

[0213] Take 50 μL of cell lysate into the microplate, add 100 μL of substrate Luciferase Assay Reagent II, and detect the fluorescence signal value emitted by the substrate catalyzed by LUC with a microplate reader 10 s later;

[0214] Add 100 μL of substrate STOP&Glo Substrate, and detect the fluorescence signal value emitted by the substrate with a microplate reader 10 s later, and calculate the ratio of LUC to REN.

[0215] Use yeast one-hybrid and LUC assays to analyze whether there is an interaction between DfMYB265 and the promoter of Bambusa emarginata CESA9. On the SD / -Trp / -Leu / -Ade solid medium coated with X-α-gal and 3AT, the combination result of DfMYB265 / ProDfCESA9 turns blue ( Figure 14 a). Moreover, transform the empty vector pCAMBIA 1303-N, pCAMBIA1303-N-DfMYB265, and the LUC-ProDfCESA9 fusion vector into Agrobacterium tumefaciens GV3103-P19. After mixing the bacterial solutions, inject tobacco, and detect the luciferase enzyme activity through the LUC kit after 2 days of dark culture. DfMYB265 can bind to the promoter of DfCESA9 ( Figure 14 b).

[0216] Although the embodiments of the present invention have been disclosed as above, it is not limited to only the applications listed in the specification and embodiments. It can be fully applied to various fields suitable for the present invention. For those skilled in the art, additional modifications can be easily made. Therefore, without departing from the general concept defined by the claims and the equivalent scope, the present invention is not limited to specific details and the examples shown and described here.

Claims

1. A Dendrocalamus farinosus transcription factor DfMYB265 gene, characterized in that, The nucleotide sequence is as shown in SEQ ID NO.

1.

2. The Dendrocalamus farinosus transcription factor DfMYB265 gene according to claim 1, characterized in that The encoded amino acid sequence is as shown in SEQ ID NO.

2.

3. An expression vector, characterized in that, It contains the Dendrocalamus farinosus transcription factor DfMYB265 gene described in claim 1.

4. The expression vector according to claim 3, wherein The expression vector is pCAMBIA1303-N-DfMYB265.

5. The application of the Dendrocalamus farinosus transcription factor DfMYB265 gene described in claim 1 in regulating the cellulose content of Phyllostachys edulis.

6. The application of the expression vector described in claim 4 in regulating the cellulose content of Phyllostachys edulis.

7. The application of the Dendrocalamus farinosus transcription factor DfMYB265 gene described in claim 1 in promoting the growth of Phyllostachys edulis.

8. The application of the expression vector described in claim 4 in promoting the growth of Phyllostachys edulis.

9. Use of the Dendrocalamus farinosus transcription factor DfMYB265 gene as described in claim 5 in regulating the cellulose content of Phyllostachys edulis, characterized in that, It includes: Step 1, constructing a vector of the Dendrocalamus farinosus transcription factor DfMYB265 gene; Step 2, transforming the constructed vector into Phyllostachys edulis or Phyllostachys edulis cells; Step 3, cultivating and screening to obtain Phyllostachys edulis with a high cellulose content.

10. Use of the Dendrocalamus farinosus transcription factor DfMYB265 gene as described in claim 7 in promoting the growth of Phyllostachys edulis, characterized in that, It includes: Increasing the plant height of Phyllostachys edulis, and increasing the number of branches and the shoot yield of Phyllostachys edulis.

Citation Information

Patent Citations

  • Arabidopsis MYB family transcription factor AtMYB52 gene and application thereof

    CN107523573A

  • Pear transcription factor PbrMYB169 and application thereof

    CN109609514A