Application of GmERECTAs gene in soybean plant height regulation

Abstract

The invention discloses regulation and control of a GmERECTAs gene (GmERs for short) on a soybean plant height and application of the GmERECTAs gene (GmERs for short). The invention belongs to the technical field of biology. An sgRNA sequence of a GmERs gene is recombined to a knockout vector pGES401 through a Golden Gate cloring technology. According to the method, four homologous genes of GmERs are knocked out by using a CRISPR / Cas9 technology, the four genes comprise GmERa, GmERb, GmERc and GmERd, and offspring screening is performed through herbicide resistance endowed by a Bar marker gene; after a positive result is obtained through screening, the GmERs gene knockout condition is determined through sequencing, and the plant height of a gene knockout soybean plant is remarkably reduced compared with that of a contrast. The invention has important significance for developing and breeding new soybean germplasm resources.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a GmERs gene and its encoded protein, and an application of knocking out the GmERs gene through CRISPR-Cas9 technology in regulating soybean strain growth. Background Art

[0002] Intercropping and close planting are effective means to increase crop yield per unit planting area. However, intercropping and close planting patterns will create a shade environment. As a typical sun-loving crop, the shade environment will lead to a decrease in soybean yield. At present, there is a lack of soybean varieties that are tolerant to shade and close planting in China, and it is urgent to cultivate soybean varieties that are tolerant to close planting. ERECTA (ER) is a member of the receptor-like kinase family. Studies have found that ER is involved in regulating the development of plant apical meristems, leaves, flowers, pedicels and other organs. Bioinformatics analysis found that there are four ERECTA genes in soybeans. Whether GmERs in soybeans affect the growth and development of soybeans has not been reported. Therefore, it is of great significance to use gene editing technology to knock out GmERs in soybeans. Summary of the invention

[0003] Based on the current lack of densely planted and semi-dwarf soybean varieties, the present invention provides a soybean plant height regulating gene and a method for reducing soybean plant height. The method for reducing soybean plant height provided by the present invention includes knocking out the protein coding gene in the soybean genome to reduce plant height, providing technical support for the creation and cultivation of semi-dwarf soybean varieties that are densely planted and resistant.

[0004] One of the purposes of the present invention is to provide a soybean plant height regulating gene GmERs, whose nucleotide sequence is at least one of the following groups: 1) the full length of the GmERa gene sequence is shown in SEQ ID NO.1; 2) the full length of the GmERb gene sequence is shown in SEQ ID NO.2; 3) the full length of the GmERc gene sequence is shown in SEQ ID NO.3; 4) the full length of the GmERd gene sequence is shown in SEQ ID NO.4; 5) a DNA molecule that can affect the phenotype of soybean plant height formed by one to several base substitutions and / or one to several base insertions and / or deletions and large fragments of nucleotide sequence insertion / deletion / shift / inversion on the basis of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4.

[0005] Another aspect disclosed by the present invention provides a protein encoded by a soybean plant height regulating gene GmERs, whose amino acid sequence is at least one of the following: 1) a protein composed of an amino acid sequence encoded by SEQ ID NO.1; as shown in SEQ ID NO.5; 2) a protein composed of an amino acid sequence encoded by SEQ ID NO.2; as shown in SEQ ID NO.6; 3) a protein composed of an amino acid sequence encoded by SEQ ID NO.3; as shown in SEQ ID NO.7; 4) a protein composed of an amino acid sequence encoded by SEQ ID NO.4; as shown in SEQ ID NO.8; 5) a protein composed of SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 through substitution, deletion, and / or addition of one or more amino acid residues and having a phenotype that affects soybean plant height.

[0006] The third aspect disclosed by the present invention provides a nucleic acid molecule expression cassette, a recombinant expression vector, a gene-edited cell line or a recombinant microorganism containing the soybean plant height regulating gene GmERs.

[0007] The fourth aspect disclosed by the present invention provides a primer pair for identifying mutations in the soybean regulatory gene GmERs, and the sequences thereof are as follows: 1) a primer pair for identifying mutations in the gene GmERa, whose sequence is Cas9-test-ERa-F: 5'-CATTCATATTTTTTTCACTTTGGTCTT-3', Cas9-test-ERa-R: 5'-CACACTCGAGACTCCTGCGATATAG-3'; a primer pair for sequencing mutations in GmERa, whose sequence is: a-F2: 5'-GCCATGCTTAGTAATCTTTCTTCA-3'; 2) a primer pair for identifying mutations in the gene GmERb, whose sequence is Cas9-test-ERb-F: 5'-ATGACAAGGTTTTTTGTTTTGTT-3', Cas9-test-ERb-R: 5'-CTTCTATTACCAAGAGCATAAAATG-3'; a primer pair for sequencing mutations in GmERb, whose sequence is: b-F2: 5'-CCATGC TTAGGAATCTTTCTTCAA-3'; 3) The primer pair for identifying the mutation of the gene GmERc, whose sequence is Cas9-test-ERc-F: 5'-CCAATTCCTCCTATCTTGGGCA-3', Cas9-test-ERc-R: 5'-CAAAAGTGAATGACCCTCCCTC-3'; The primer pair for sequencing the mutation of GmERc, whose sequence is: cF: 5'-CCCCCATTCACATCACCACATCCTGATTTCT-3'; 4) The primer pair for identifying the mutation of the gene GmERd, whose sequence is Cas9-test-ERd-F: 5'-CAAGGCTGCTCTAATTAAACCACGAG-3', Cas9-test-ERd-R: 5'-AAGATCACTGTCATACAGAATTGT-3'; The primer pair for sequencing the mutation of GmERd, whose sequence is: d-F2: 5'-TTGCATTGTGACGATCTTCCTTAG-3';

[0008] In a fifth aspect disclosed by the present invention, the soybean gene GmERs and the primers are used in the improvement of soybean plant height traits and the selection of superior varieties / lines. For example, the expression of the soybean gene GmERs is silenced / downregulated to reduce the soybean plant height.

[0009] The plant that can be transformed by the present invention can be a dicotyledonous plant, a plant of the order Fabaceae, a plant of the genus Glycine max, or soybean. DETAILED DESCRIPTION

[0010] Example 1. Construction of GmERs multi-gene knockout vector

[0011] 1. Design the primer sequences of the four gene knockout targets of GmERa, GmERb, GmERc and GmERd through the CRISPR-P website. The sgRNA target sequences and primer sequences are: Target1: TCAAATTTCCCAAGATAGGAGGG; Target2: AAGATGTTCCAAGTCACCAATGG;401-GmERs-T1-F: TGGTCTCgTGCATCAAATTTCCCAAGATAGGAgttttagagctagaaatagc;401-GmERs-T2-R: TGGTCTCgAAACAAGATGTTCCAAGTCACCAAtgcaccagccgggaatcgaa

[0012] 2. PCR amplification of sgRNA-sgRNA Scaffold-tRNA-sgRNA fragments. After the reaction is completed, the PCR product is purified using a gel recovery kit.

[0013] 3. Golden Gate was used for vector construction.

[0014] 4. Transformation into E. coli DH5α.

[0015] 5. Colony PCR identification.

[0016] Example 2: Creation of GmERs multi-gene knockout soybean material

[0017] 1. Agrobacterium transformation: After the plasmid is sequenced correctly, the plasmid is transformed into Agrobacterium EHA105.

[0018] 2. Transformation of soybean cotyledon nodes: The bacterial solution stored in a -80°C refrigerator was expanded and cultured. The absorbance of the bacterial solution was measured to be OD650 = 0.8-1 and can be used for subsequent operations; the culture was cultured at 3500 rpm. After 10 minutes, collect the bacterial liquid and resuspend it with the infection medium, OD650 is about 0.6; pick healthy soybean seeds, evenly divide the sub-leaves, remove the true leaves, and wound the cotyledon nodes; place the prepared explants in the infection liquid; after the infection is completed, culture them in the cooperative culture medium for 5 days; use the flushing medium to rinse first, then absorb the liquid, insert the explant with the wound facing upward into the bud induction medium, and culture it in an incubator for 4 weeks, and change the culture medium every two weeks; transfer the bud induction material to the bud elongation medium, culture it for 8 weeks, and root induction can be carried out when the buds grow to at least 3 cm; when 2-3 roots are induced, domestication can be carried out; after the new compound leaves of the domesticated seedlings are fully unfolded, apply glyphosate solution to the leaves to detect whether they have herbicide resistance, extract leaf gDNA from the resistant leaves and detect the knockout status, and the primers used for the detection are as claimed in claim 8.

[0019] 3. Identification of mutation sites: Extract leaf gDNA and perform PCR amplification. The PCR reaction stock solution is sent to a sequencing company for sequencing after electrophoresis detection to determine the mutation site.

[0020] Example 3: Phenotypic identification of GmERs multi-gene knockout soybean materials

[0021] The knockout transgenic lines and the control variety William 82 were planted under the same environmental conditions for phenotypic identification. The results showed that the plant height of the GmERs gene knockout lines was significantly reduced compared with the wild-type control, indicating that the soybean GmERs gene regulates soybean plant height. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Hypocotyl phenotypes, hypocotyl length statistics and knockout status of V1 stage control and GmER triple and quadruple deletion mutant materials.

[0023] Figure 2 Comparison of plant height between control and GmER triple and quadruple deletion mutant materials.

Claims

1. A soybean plant height regulating gene GmERs, whose nucleotide sequence is at least one of the following groups: 1) the full length of the GmERa gene sequence is shown in SEQ ID NO.1; 2) the full length of the GmERb gene sequence is shown in SEQ ID NO.2; 3) the full length of the GmERc gene sequence is shown in SEQ ID NO.3; 4) the full length of the GmERd gene sequence is shown in SEQ ID NO.4; 5) a DNA molecule that can affect the phenotype of soybean plant height formed by one to several base substitutions and / or one to several base insertions and / or deletions and large fragments of nucleotide sequence insertion / deletion / shift / inversion on the basis of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.

4.

2. A protein encoded by a soybean plant height regulating gene GmERs, whose amino acid sequence is at least one of the following groups: 1) a protein composed of the amino acid sequence encoded by SEQ ID NO.1; as shown in SEQ ID NO.5; 2) a protein composed of the amino acid sequence encoded by SEQ ID NO.2; as shown in SEQ ID NO.6; 3) a protein composed of the amino acid sequence encoded by SEQ ID NO.3; as shown in SEQ ID NO.7; 4) a protein composed of the amino acid sequence encoded by SEQ ID NO.4; as shown in SEQ ID NO.8; 5) a protein composed of SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 through substitution, deletion and / or addition of one or more amino acid residues and having a phenotype that affects soybean plant height.

3. The knockout of the GmERs gene in the soybean genome is at least one of the following mutations: 1) in SEQ ID NO.1, the thymine at position 3922 is knocked out, or the four bases of guanine, thymine, guanine and adenine at positions 3924-3927 are knocked out; 2) in SEQ ID NO 2, the guanine at position 3895 is knocked out; 3) in SEQ ID NO 3, the thymine at position 4471 is knocked out, or the guanine at position 4470 is knocked out; 4) in SEQ ID NO 4, the thymine at position 4272 is knocked out.

4. A nucleic acid molecule expression cassette, a recombinant expression vector, a gene-edited cell line or a recombinant microorganism containing the soybean plant height regulating gene GmERs according to claim 1.

5. Use of the gene GmERs described in claim 1 in regulating the growth of soybean plants.

6. Use of the gene GmERs according to claim 1 in improving soybean plant height traits and breeding superior varieties / lines.

7. The use according to claim 5 and claim 6, characterized in that Silencing / down-regulating the expression of the soybean gene GmERs to reduce soybean plant height.

8. A primer pair for identifying a deletion mutation in the soybean plant height regulating gene GmERs, wherein the sequence is any one of the following pairs: 1) a primer pair for identifying a mutation in the gene GmERa, wherein the sequence is Cas9-test-ERa-F: 5'-CATTCATATTTTTTTCACTTTGGTCTT-3', Cas9-test-ERa-R: 5'-CACACTCGAGACTCCTGCGATATAG-3'; a primer pair for sequencing a mutation in the gene GmERa, wherein the sequence is: a-F2 : 5'-GCCATGCTTAGTAATCTTTCTTCA-3'; 2) a primer pair for identifying the mutation of the gene GmERb, whose sequence is Cas9-test-ERb-F: 5'-ATGACAAGGTTTTTTGTTTTGTT-3', Cas9-test-ERb-R: 5'-CTTCTATTACCAAGAGCATAAAATG-3'; a primer pair for sequencing the mutation of GmERb, whose sequence is: b-F2: 5'-CCATGCTT AGGAATCTTTCTTCAA-3'; 3) The primer pair for identifying the mutation of the gene GmERc, whose sequence is Cas9-test-ERc-F: 5'-CCAATTCCTCCTATCTTGGGCA-3', Cas9-test-ERc-R: 5'-CAAAAGTGAATGACCCTCCCTC-3'; the primer pair for sequencing the GmERc mutation, whose sequence is: cF: 5'-CCCCCATTCACATCACCACATCCTGATTTCT-3'; 4) The primer pair for identifying the mutation of the gene GmERd, whose sequence is Cas9-test-ERd-F: 5'-CAAGGCTGCTCTAATTAAACCACGAG-3', Cas9-test-ERd-R: 5'-AAGATCACTGTCATACAGAATTGT-3'; the primer pair for sequencing the GmERd mutation, whose sequence is: d-F2: 5'-TTGCATTGTGACGATCTTCCTTAG-3'.

Images