A SNP molecular marker related to milk production in dairy cows and its application

Abstract

The present invention discloses a SNP molecular marker related to milk production of dairy cows and its application. The SNP molecular marker is T or C at the position of chr14:g1472679 of the cattle genome, and exhibits a high milk production trait when the SNP site is T. The SNP site can be used to identify or assist in identifying the milk production trait of dairy cows, and is used in dairy cow population optimization, dairy cow breeding, etc., to increase the frequency of dominant milk production alleles in dairy cow populations, reduce pasture feeding costs, and improve breeding benefits.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker related to milk production of dairy cows and an application thereof. Background Art

[0002] Dairy farming has always been an important agricultural sector that supplies human demand for dairy products. In this industry, milk production of dairy cows has always been one of the core economic traits of dairy cows, which has a direct and critical impact on the profitability of farms. Therefore, improving milk production of dairy cows has always been one of the main research directions in the field of dairy breeding. Improving milk production in dairy cows is a complex and challenging task because it is affected by many factors, including genetic factors, feeding management, disease, environment, and parity. Faced with the challenges of genetic diversity, precision improvement, and increased production efficiency, traditional breeding methods appear limited, and more efficient genetic tools and methods are needed.

[0003] Traditional dairy cow breeding methods are mainly based on pedigree and trait selection. Although these methods have achieved certain success, they still have some limitations. For example, because the reproductive cycle of dairy cows is relatively long, these methods take a considerable amount of time to achieve significant improvements. In addition, the milk production of dairy cows is a complex trait controlled by multiple genes. Although there is still a lot of room for improvement in dairy cow milk production, traditional methods have little research on the genetic mechanism of improving dairy cow milk production and lack effective breeding method guidance.

[0004] Molecular biology technology provides new ideas for dairy cow breeding. It can intervene in high-quality dairy cow breeding through genetic means to improve breeding efficiency. At present, there are relatively few genes and molecular markers related to dairy cow milk production. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to milk production of dairy cows and its application in view of the technical problems such as difficulty in identifying high milk production dairy cows and low accuracy in the prior art.

[0006] The technical solution of the present invention is described in detail as follows:

[0007] In a first aspect, the present invention provides a SNP molecular marker associated with milk production in dairy cows, wherein the SNP molecular marker is T or C at position chr14:g1472679 in the cow genome.

[0008] Optionally or preferably, the SNP molecular marker is the 116th nucleotide of SEQ ID NO: 1 in the sequence listing, which is T or C.

[0009] In a second aspect, the present invention provides the use of a product for detecting the above-mentioned SNP molecular marker in identifying or assisting in identifying the milk production trait of dairy cows.

[0010] In a third aspect, the present invention provides a method for identifying the milk production trait of a dairy cow, which is to detect the genotype of the above-mentioned SNP molecular marker in the dairy cow to be tested, and identify or assist in identifying the milk production trait of the dairy cow based on the genotype of the SNP molecular marker of the dairy cow to be tested; the SNP genotypes of the milk production trait from high to low are TT, TC, and CC, respectively.

[0011] In a fourth aspect, the present invention provides an application of a product for detecting the above-mentioned SNP molecular markers in dairy cow population optimization, dairy cow breeding, or the preparation of dairy cow breeding products.

[0012] In a fifth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, wherein the product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0013] In a sixth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular markers, wherein the product is a detection kit, and the detection kit comprises a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a SNP site related to the milk production of dairy cows. Analysis shows that its dominant allele is T, which can be used to identify dairy cow individuals with high milk production. Favorable genotype individuals can also be selected for breeding to increase the frequency of the dominant milk production allele in the dairy cow population, reduce the feeding cost of the pasture, and improve the breeding efficiency, thus providing a new method for the genetic improvement of the milk production trait of dairy cows. DETAILED DESCRIPTION

[0016] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0017] Example 1

[0018] 1. SNP site screening

[0019] (1) Blood or hair follicle samples were collected from 1,949 Holstein cows in six large-scale farms

[0020] Chinese Holstein dairy cow samples were collected from six ranches across the country. The locations of the ranches and the number of samples collected from each ranch are shown in Table 1.

[0021] Table 1. Location of farms where samples were collected and number of samples collected

[0022]

[0023] (2) The genotypes of the collected samples were determined using the Illumina BovineSNP50 chip. The genotype determination was performed by Neogen, and the genotypes of a total of 47,843 SNP marker loci were obtained.

[0024] (3) The genomic breeding value of milk production for each individual is estimated based on the genotype. The genomic estimated breeding value is provided by the United States Dairy Cattle Genetics and Breeding Committee (CDCB).

[0025] (4) Based on genotype data, GEMMA software was used to conduct genome-wide association analysis on the genomic breeding value of milk production. The analysis model used a mixed linear model, with pasture and cattle age as covariates. The FDR method was used for multiple test correction. The association analysis results showed that the most significant SNP site (chr14:g1472679 T>C) (the coordinate position of the SNP site was based on the cattle reference genome ARS-UCD1.3) was significant. P The value is 4.14E-19.

[0026] The SNP site is at position 116 in the following nucleotide sequence, and the genotype of the site is T or C.

[0027] SEQ ID NO:1

[0028] TCCACTCATAGCTGACCTGCTGGCCTGACCCCTCAGGGTCCATGGCCCTGTGCTATGCCACCAGTGATTAGCAGAGCAGTTAGGTTTTTGCAGGGCTGAGCCATGAAGAAGCTGC T GTGTCGTGTTCCTGGCTTTTCCT.

[0029] 2. Identification of dominant alleles

[0030] Among the 1949 Holstein cows collected, the genomic estimated breeding values ​​of milk production of different genotypes of SNP locus chr14:g1472679 T>C were compared, and the results are shown in Table 2. For chr14:g1472679 T>C, the genomic estimated breeding values ​​of milk production were T / T: 551.70, T / C: 529.12, and C / C: 466.18. Because the larger the genomic estimated breeding value of milk production, the higher the milk production, the dominant allele of the chr14:g1472679 T>C locus is T.

[0031] Table 2. Genomic estimated breeding values ​​of milk production in dairy cows with different genotypes of chr14:g1472679 T>C

[0032]

[0033] 3. Sequence amplification

[0034] (1) Blood collection from the cattle tail vein

[0035] Chinese Holstein cows were selected as experimental materials, and blood was collected from the tail vein of the cows.

[0036] (2) Genomic DNA extraction

[0037] Take 500μL of whole blood, add 500μL of STE lysis buffer, add 50μL of 10% SDS, 5μL of proteinase K (20mg / ml) in sequence, and lyse at 56℃ for about 3h until the lysate is clear. Add the same volume of saturated phenol (250μL), chloroform / isoamyl alcohol (24:1) (250μL), shake gently for 20min, and centrifuge at 12000rpm for 10min. Take the supernatant and repeat the above steps until there is no protein layer between the aqueous phase and the organic phase. Take the supernatant, add the same volume of chloroform / isoamyl alcohol, shake gently for 20min, and centrifuge at 12000rpm for 10min. Take the supernatant, add 1 / 10 volume of 3MNaAc (pH5.2) and 2 times the volume of cold anhydrous ethanol, shake well, let stand at 20℃ for 20min, and centrifuge at 12500rpm for 20min. Precipitate the nucleic acid at the bottom of the tube. Discard the supernatant and wash the precipitate with 70% ethanol. Collect the precipitate and dry it in air until all the ethanol evaporates. Add 20 μL TE (containing RNase A) to dissolve the DNA, let it stand at 37°C for about 30 minutes, and then store it at 4°C. Detect the DNA sample by 1% agarose gel electrophoresis, and detect the concentration and purity by UV spectrophotometer.

[0038] (3) Primer design

[0039] According to the gene sequence of SEQ ID NO: 1, a pair of specific primers were designed.

[0040] The forward primer is: 5'-TCCACTCATAGCTGACCTGC-3' (SEQ ID NO: 2),

[0041] The reverse primer was: 5'-AGGAAAAGCCAGGAACACGA-3' (SEQ ID NO: 3).

[0042] (4) Polymerase chain reaction

[0043] PCR amplification was performed using the above primers. The reaction system was as follows: 10×Buffer 1μL, 2.5mM dNTP 0.8μL, 2.5mM MgCl2, 0.6μL, Primer F (10μM) 0.1μL, Primer R (10μM) 0.5μL, Taq enzyme (5U / μL) 0.1μL, Template 0.5μL, LC Green saturated fluorescent dye 0.7μL, and H2O added to make up to 10μL. The amplification reaction was completed on the Applied Biosystem PCR system. The reaction conditions were as follows: 95℃ 5min; 95℃ 30s, 59℃ 30s, 72℃ 1min; 35 cycles; 72℃ 5min. The genotype of the PCR product was determined by Sanger sequencing.

[0044] 4. Verify test results

[0045] In order to verify the relationship between the chr14:g1472679 T>C locus and the milk production of Holstein cows, the Sanger sequencing method was used to identify the genotype of the chr14:g1472679 T>C locus in two Holstein cattle groups in a ranch in Shandong, my country, with a total of 456 Holstein cows. The milk production of individuals with different genotypes was compared, and the results are shown in Table 3.

[0046] Table 3 Relationship between the genotype of chr14:g1472679 T>C locus and average daily milk production in the validation population

[0047]

[0048] The test results showed that there were three genotypes in the Holstein cow population tested; among all the tested groups, the average daily milk production of T / T genotype cows was 46.18 kg, the average daily milk production of T / C genotype cows was 42.07 kg, and the average daily milk production of C / C genotype cows was 40.05 kg. After one-way analysis of variance, it was found that there were significant differences in milk production between different genotypes, and the significant P value was 6.22E-24 (Table 4).

[0049] Table 4. One-way ANOVA results of milk production of individuals with different genotypes at the chr14:g1472679 T>C locus in the validation population

[0050]

[0051] The present invention identifies a SNP site associated with the milk production of dairy cows, and detects the genotype of individual dairy cows at this site through molecular biology related techniques. The above molecular biology related techniques are used to detect the genotype of the chr14:g1472679 T>C site and select favorable individuals for breeding, which can improve the milk production trait of the dairy cow group, improve breeding efficiency, reduce breeding costs, increase breeding income, and lay the foundation for breeding new high-quality dairy cow breeds with high milk production.

[0052] The invention concept is described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the core idea of ​​the invention. It should be pointed out that any obvious modification, equivalent substitution or other improvement made by a person of ordinary skill in the art without departing from the invention concept should be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker related to milk production in dairy cows, characterized in that: The nucleotide sequence is shown in SEQ ID NO: 1, wherein the polymorphism of nucleotide 116 is T or C.

2. Use of the product for detecting the SNP molecular markers described in claim 1 in identifying or assisting in identifying the milk production trait of dairy cows.

3. Use of the product for detecting the SNP molecular marker according to claim 1, characterized in that: Used for dairy cow population optimization, dairy cow breeding or preparation of dairy cow breeding products.

4. A product for detecting the SNP molecular marker according to claim 1, characterized in that: The product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

5. A product for detecting the SNP molecular marker according to claim 1, characterized in that: The product is a detection kit, which includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

6. A method for identifying the milk production trait of a dairy cow, characterized in that: Detecting the genotype of the SNP molecular marker of claim 1 in the tested dairy cow, and identifying or assisting in identifying the milk production trait of the dairy cow based on the genotype of the SNP molecular marker of the tested dairy cow; The SNP genotypes of milk production trait from high to low are TT, TC, and CC.

Images