Application of corn gene ZmMADS8 in control of corn protein quality

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses an application of a corn gene ZmMADS8 in control of protein quality, a protein encoded by the ZmMADS8 is shown in SEQ ID NO.2, and the gene is located in the ninth chromosome of corn and used for controlling the content of zein and / or lysine. The gene is knocked out by using a CRISPR / Cas9 technology, gene expression is inhibited, and the content of prolamin and / or lysine in corn can be increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of corn gene ZmMADS8 in controlling corn protein quality. The gene of the present invention is located on the 9th chromosome of corn and controls the zein and / or lysine content traits. Background Art

[0002] Corn is domesticated from wild teosinte and has become the most widely grown crop in the world. Corn kernels store starch, protein and fatty acids, and are the main source of calories for human food and livestock feed, as well as raw materials for biofuel and industrial production. Mature corn kernels are composed of three parts: embryo, endosperm and seed coat. The endosperm is a nutrient storage tissue, accounting for 85% of the kernel weight. Starch and protein are the most abundant nutrients in the endosperm. Starch accounts for 7% of the kernel weight.

[0003] 0%, is the main contributor to grain yield, and the accumulation of starch in endosperm cells is achieved through a series of biological processes, including the transport of carbohydrates from photosynthetic cells to endosperm cells through the basal endosperm transfer layer (BETL), and the biosynthesis of starch in endosperm cells. Protein accounts for 10% of the grain mass, of which zein is the most abundant storage protein, accounting for more than 60% of endosperm protein. Zein is divided into four major categories: 19- and 22-kDa α-alcohol-soluble protein, 15-kDa β-alcohol-soluble protein, 50-, 27- and 16-kDa γ-alcohol-soluble protein, and 18- and 10-kDa δ-alcohol-soluble protein. However, zein is extremely lacking in essential amino acids for the human body, and the protein quality is poor. Therefore, in order to cultivate high-quality protein and high-yield varieties, it is necessary not only to increase the accumulation of starch and protein in endosperm cells, but also to balance the content of zein and non-zein. Summary of the invention

[0004] The purpose of the present invention is to provide an application of corn gene ZmMADS8 in controlling corn protein quality. The protein encoded by the gene is shown in SEQ ID NO.2.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] Application of corn gene ZmMADS8 in controlling corn protein quality, the protein encoded by the gene is shown in SEQ ID NO.2 (GenBank: AQL08650.1).

[0007] The above-mentioned applications are as follows:

[0008] Application of reducing the expression of maize gene ZmMADS8 in improving maize protein quality;

[0009] Application of knocking out, inhibiting or silencing the expression of maize gene ZmMADS8 in improving protein quality;

[0010] In the above-mentioned applications, preferably, the knockout adopts the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into a functional protein, thereby achieving the effect of improving the protein quality.

[0011] Preferably, the target site of the gRNA in the CRISPR / Cas9 system is GATCGAGAACAAGATCAGC; GTCGCGCTCATCATATTCTC.

[0012] In the above-mentioned application, preferably, the edited corn mutant with improved yield contains the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0013] The application of increasing the expression of maize gene ZmMADS8 in reducing protein quality;

[0014] The application described above is to introduce substances that increase the expression of the corn ZmMADS8 gene into corn;

[0015] In the above application, preferably, the substance is a nucleic acid molecule containing the ZmMADS8 gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0016] The ZmMADS8 gene is shown as SEQ ID NO.1.

[0017] In the above application, the control of protein quality is achieved by controlling the content of prolamin and / or lysine. Compared with the prior art, the present invention has the following advantages:

[0018] The present invention cloned and confirmed the gene ZmMADS8 that controls the alcohol-soluble protein and / or lysine content in corn, confirmed the relationship between the alcohol-soluble protein and / or lysine content and the expression level of ZmMADS8, and the corn can be increased by reducing its expression level. The difference in the number of ears between transgenic materials and wild-type materials is due to the editing of the gene coding region, which causes the protein level encoded by the gene to decrease. In terms of the mechanism of action, it is believed that the gene participates in the signal response of sugar in the plant body, increases the response of sugar signals, and then regulates the expression of downstream genes, and finally regulates the differentiation activity of corn inflorescence meristems, affecting the yield traits such as alcohol-soluble protein and / or lysine content of corn. Therefore, the present invention provides a new gene resource for protein quality improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a schematic diagram of maize ZmMADS8 gene knockout materials;

[0020] Among them: A is a schematic diagram of the editing of the maize ZmMADS8 gene, in which mads8-1 lacks 98bp and mads8-1 lacks 14bp. The insertion and deletion of these bases lead to the premature termination of protein translation.

[0021] B is a schematic diagram of the protein structure of maize ZmMADS8 gene knockout materials, from top to bottom: the wild-type family (WT) isolated from transgenic heterozygous plants and the ZmMADS8 gene-edited families mads8-1 and mads8-2;

[0022] C is a schematic diagram of the alcohol-soluble proteins in the maize ZmMADS8 gene knockout materials, from top to bottom, they are the wild-type family (WT), two ZmMADS8 gene-edited families mads8-1 and mads8-2;

[0023] DE is a schematic diagram of the alcohol-soluble protein content of the maize ZmMADS8 gene knockout material, and the bar graphs from left to right are the wild-type family (WT), two ZmMADS8 gene-edited families mads8-1 and mads8-2;

[0024] F is a schematic diagram of lysine in the maize ZmMADS8 gene knockout material, and the bar graphs from left to right are the wild-type family (WT) and the ZmMADS8 gene-edited family mads8-1.

[0025] Figure 2 Schematic diagram of the expression pattern of the maize ZmMADS8 gene;

[0026] Among them: A: ZmMADS8 is highly expressed in corn seeds; BC: In situ hybridization results show that ZmMADS8 is specifically expressed in endosperm. DETAILED DESCRIPTION

[0027] The following embodiments further define the present invention. According to the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels or published materials.

[0028] Example 1: ZmMADS8 cloning

[0029] Total DNA was extracted from the leaves of the inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesis stream line trait gene identification in maize. The Plant Cell, 2020, 32: 1397–1413). Primers 8CDS-F and 8CDS-R were designed based on the genome reference sequence of maize B73 (National Crop Germplasm Center). The ZmMADS8 gene was PCR amplified and resequenced in the KN5585 material, and the complete CDS nucleotide sequence of the ZmMADS8 gene was obtained (SEQ ID NO.1). The protein encoded by this gene is shown in SEQ ID NO.2.

[0030] The total DNA of plant leaves was extracted using the CTAB method, and the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s for 34 cycles, and finally extension at 72°C for 5 min.

[0031] Table 1. Primers used in the present invention and their sequences

[0032]

[0033]

[0034] Example 2: Genetic transformation of ZmMADS8 in maize

[0035] The genetic transformation of ZmMADS8 gene knockout was carried out by using ZmGG2 in the transgenic receptor material KN5585 as the applied gene, and the sequence is shown in SEQ ID NO.1. Using CRISPR-P website ( http: / / cbi.hzau.edu.cn / crispr / ) was used to design the gene target, and finally the Guide RNA (Target: GATCGAGAACAAGATCAGC; GTCGCGCTCATCATATTCTC) was obtained. Based on the Guide RNA, the ZmU6-Target-sgRNA fragment (shown in SEQ ID NO.3 and SEQ ID NO.4) was synthesized by gene synthesis and constructed into the pEASY-T1 commercial vector.

[0036] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, primer ID 2), the CPB-ZmUbi-hspCas9 vector was linearized by HindIII single enzyme digestion, gel electrophoresis was recovered and detected, and the Guide RNA was connected to the target vector CPB-ZmUbi-hspCas9 (CN113004383A) by homologous recombination. Finally, the obtained clone was sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, primer ID is 3) to confirm that the target fragment was connected to the vector.

[0037] The correctly cloned plasmid was transformed into the maize inbred line KN5585 by Agrobacterium-mediated transformation (the genetic transformation was completed by the Life Science Technology Center of China Seed Group Co., Ltd.). Using specific ZmMADS8 gene detection primers (primer sequences are shown in Table 1, primer ID4), two maize transformation events with KN5585 as the background were screened and obtained ( Figure 1 A), mads8-1 and mads8-2, among which mads8-1 lacks 98bp (mads8-1 contains the sequence shown in SEQ ID NO.5), and mads8-2 lacks 2bp (mads8-2 contains the sequence shown in SEQ ID NO.6). The deletion of these bases leads to the premature termination of protein translation ( Figure 1 Furthermore, in 2023, the phenotypic values ​​of zein and lysine content in ZmMADS8 knockout families were investigated in Gansu ( Figure 1 The results showed that compared with WT, the non-alcohol-soluble protein content of mads8-1 and mads8-2 maize decreased by 10.5% and 11.7%, respectively, after the loss of ZmMADS8 gene function. Figure 1 D and E), lysine increased by 19.9% ​​( Figure 1 Based on the above results, it is proved that reducing the expression of ZmMADS8 gene can improve the protein quality of corn kernels.

[0038] Example 3: Expression analysis of ZmMADS8

[0039] Based on the maize B73 expression database, the expression pattern of ZmMADS8 gene was analyzed and the expression level of ZmMADS8 gene in maize kernels was very high (FPKM) ( Figure 2 At the same time, we used RNA in situ hybridization to verify the specific expression pattern of ZmMADS8 in maize kernels ( Figure 2 Zhong BC, primer sequences are shown in Table 1, primer ID5), this gene is mainly highly expressed in corn endosperm; therefore, ZmMADS8 affects the protein quality of corn.

Claims

1. Corn Genes ZmMADS8 In the application of controlling protein quality, the protein encoded by the gene is shown as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The application process is to reduce the corn gene ZmMADS8 The expression of zein improves the quality of corn protein.

3. The use according to claim 1, characterized in that: The application process is to knock out, inhibit or silence corn genes ZmMADS8 The expression of zein improves the quality of corn protein.

4. The use according to claim 3, characterized in that: The knockout uses the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into a functional protein.

5. The use according to claim 4, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are GATCGAGAACAAGATCAGC and GTCGCGCTCATCATATTCTC.

6. The use according to claim 1, characterized in that: The application process is to improve the corn gene ZmMADS8 The expression level of α-glucan reduces the quality of corn protein.

7. The use according to claim 6, characterized in that: The application process includes increasing the corn ZmMADS8 Gene expression levels of substances introduced into corn.

8. The use according to claim 7, characterized in that: The substance is ZmMADS8 A nucleic acid molecule of a gene, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.

9. The use according to claim 1, characterized in that: The ZmMADS8 The gene is shown as SEQ ID NO.

1.

10. The use according to claim 1, characterized in that: The control of protein quality is achieved by controlling the content of prolamin and / or lysine.

Images