Tobacco NtTIRd gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a tobacco NtTIRd gene and application thereof. Tests show that the resistance of the NtTIRd gene function-deleted mutant strain to quinclorac phytotoxicity is increased, so that the loss of tobacco production caused by phytotoxicity is eliminated or reduced; therefore, the invention reveals that the NtTIRd gene can be applied to regulation and control of the resistance of the plant to quinclorac phytotoxicity for the first time, and a new thought is provided for obtaining dominant plants for tobacco breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to tobacco NtTIRd gene and application thereof. Background Art

[0002] Tobacco (scientific name: Nicotiana tabacum L.) is an annual herbaceous plant of the genus Nicotiana in the Solanaceae family. It is an important economic crop, and its leaf yield determines its economic benefits.

[0003] Quinclorac is a herbicide widely used to remove barnyard grass. The large-scale use of quinclorac causes phytotoxicity to tobacco growth. The phytotoxicity to tobacco generally occurs from the clustering stage to the vigorous growth stage. Quinclorac stress leads to a decrease in tobacco leaf yield and quality, affecting the industrial availability and safety of tobacco leaves. The current solutions mainly include developing new herbicides that do not cause damage to tobacco or improving tobacco's resistance to quinclorac.

[0004] Improving tobacco's resistance to quinclorac through genetic engineering is an effective method. Therefore, exploring tobacco resistance genes is of great significance in the field of providing tobacco breeding that is resistant to quinclorac. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide tobacco NtTIRd gene and application thereof.

[0006] The present invention provides the use of tobacco TIRd as a target in plant breeding and / or in preparing products that assist plant breeding;

[0007] The tobacco TIRd comprises at least one of the amino acid sequences shown in a) to c) below:

[0008] a), the amino acid sequence shown in SEQ ID NO: 2; or

[0009] b) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (a), and having the same function as the amino acid sequence described in (a); or

[0010] c) an amino acid sequence having at least 90% sequence identity with the amino acid sequence described in (a) or (b).

[0011] Furthermore, the plant breeding includes regulating the resistance of the plant to quinclorac; the regulation includes increasing or decreasing.

[0012] Furthermore, the plant includes plants of the family Cruciferae, Asteraceae, Chenopodiaceae, Rutaceae, Moraceae, Leguminosae and / or Solanaceae; and the Solanaceae plant includes tobacco.

[0013] The present invention provides a product for plant breeding or assisted breeding, which includes at least one of the following A) to C:

[0014] A), amplification primers, detection primers and / or targeting primers using the nucleic acid encoding the tobacco TIRd as a template;

[0015] B), an interference fragment targeting the tobacco TIRd;

[0016] C), gRNA targeting the tobacco TIRd;

[0017] D), an expression cassette containing the interference fragment as described in B), or the gRNA as described in C);

[0018] E), a recombinant vector containing the interference fragment as described in B), or the gRNA as described in C), or the interference fragment as described in D);

[0019] F), transforming or transfecting the host cell with the recombinant vector as described in E);

[0020] G), culturing the mixture obtained by the host cells described in F).

[0021] Furthermore, in the product described in the present invention, the target nucleotide sequence of the gRNA is shown in SEQ ID NO:5.

[0022] In the present invention, the nucleic acid encoding tobacco TIRd includes at least one of the nucleic acids shown in the following i) to v):

[0023] i), having the nucleotide sequence shown in SEQ ID NO: 2; or

[0024] ii), a nucleic acid molecule complementary to at least one of the nucleic acid molecules as shown in i); or

[0025] iii), a nucleic acid molecule that encodes the same protein as the nucleic acid molecule of i) or ii), but is different from the nucleic acid molecule of i) or ii) due to the degeneracy of the genetic code; or

[0026] iv), a nucleic acid molecule obtained by replacing, deleting or adding one or more bases to the nucleic acid molecule shown in i), ii) or iii), and having the same or similar functions as the nucleic acid molecule shown in i), ii) or iii); or

[0027] v), a nucleic acid molecule having at least 80% sequence identity with the nucleotide sequence described in i), ii), iii) or iv).

[0028] In the present invention, the nucleic acid may be optimized or unoptimized, and the present invention is not limited thereto. The optimization includes but is not limited to: codon usage preference, elimination of secondary structures that are not conducive to expression (such as hairpin structures), changes in GC content, CpG dinucleotide content, secondary structure of mRNA, cryptic splicing sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repetitive sequences (direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning.

[0029] The present invention also provides an expression cassette, which can also be called an expression unit, and the expression unit refers to a DNA sequence starting from a promoter and ending at a terminator. A regulatory segment may also be included on both sides or between the promoter and the terminator, and the regulatory segment may include a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a nucleic acid restriction site, and a homologous recombination site operably connected to the nucleic acid sequence, such as an enhancer of the promoter, a poly (A) signal, etc.

[0030] The recombinant vectors described in the present invention have different functions and experimental purposes that can be accomplished depending on the type of vector. In a specific embodiment of the present invention, a cloning vector is used to amplify and analyze the NtTIRd gene sequence, and a CRISPR / Cas9 vector is used to achieve the loss of NtTIRd gene function. In the present invention, the CRISPR / Cas9 vector containing the gRNA inserts a base A between 62bp and 63bp of the NtTIRd gene, causing a frameshift mutation, which is a loss of gene function.

[0031] The present invention provides a kit, which comprises the product of the present invention and auxiliary materials.

[0032] Furthermore, the auxiliary material is used to assist the product in exerting its effects or maintaining the activity of the product or to preserve the product, which is not limited in the present invention; in the present invention, the auxiliary material includes: at least one of a DNA extraction reagent, a culture medium, a DNA reverse transcription reagent, an antibiotic and / or a buffer.

[0033] The present invention provides application of the product or the kit in plant breeding or assisted plant breeding.

[0034] The present invention provides a method for plant breeding or assisted plant breeding, which comprises using the product of the present invention or the kit of the present invention to carry out plant breeding.

[0035] The present invention has found through experiments that: the NtTIRd gene functional deletion mutant has increased resistance to dichloroquine phytotoxicity, thereby eliminating or reducing the losses caused by the phytotoxicity to tobacco leaf production; therefore, the present invention reveals for the first time that the NtTIRd gene can be used to regulate the plant's resistance to dichloroquine phytotoxicity, providing a new idea for obtaining superior plants in tobacco breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the electrophoresis diagram of the amplified product of NtTIRd gene CDS;

[0037] Figure 2 This is the PCR detection image of CRISPR / Cas9 recombinant plasmid colony;

[0038] Figure 3 is a map of target site mutation types;

[0039] Figure 4 Leaf width analysis of mutants. DETAILED DESCRIPTION

[0040] The present invention provides tobacco NtTIRd gene and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0041]

[0042] Amino acid sequence of NtTIRd protein: (SEQ ID NO: 2);

[0043] Biomaterials:

[0044] Tobacco variety: K326, a common cultivated tobacco variety, the seeds used were stored by Hunan China Tobacco Industry Co., Ltd. Tobacco growth room culture conditions: temperature (27±1)℃, relative humidity (60±5)%, light / dark 16 h / 8 h.

[0045] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0046] Example 1 Obtaining the tobacco auxin receptor NtTIRd gene

[0047] (1) PCR amplification primer design

[0048] Based on the existing tobacco genome sequence, primers for PCR amplification of the CDS region were designed for the NtTIRd gene. The sequences are as follows:

[0049] Upstream primer 21036f: 5'-cattcagatttcagaagaaacac-3' (SEQ ID NO: 3);

[0050] Downstream primer 21036r: 5'-atttgtcttcacgatcgc-3' (SEQ ID NO: 4);

[0051] (2) Preparation of PCR amplification template

[0052] Total RNA was extracted from K326 tobacco leaves using the SuperPure Plant polyRNA Kit. ® II Reverse Transcriptase Kit was used to reverse transcribe the extracted total RNA into cDNA, and the cDNA was used as a template for PCR amplification.

[0053] (3) PCR amplification

[0054] Refer to the 2× TransTaq High Fidelity (HiFi) PCR SuperMix instruction manual, use the cDNA prepared in step (2) as a template, use the primers designed in step (1) to perform PCR amplification, add the reaction system according to the instruction manual, and perform the PCR reaction. The PCR reaction conditions are as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 100 s, 30 cycles; extension at 72°C for 5 min.

[0055] The PCR amplification products were detected by 1% agarose gel electrophoresis. Figure 1 As shown, there is a clear and single target band at around 1800 bp.

[0056] The target fragment was recovered from gel and sent for sequencing. The sequencing result is shown in SEQ ID NO: 1.

[0057] Example 2 Construction of gene editing vector

[0058] In order to obtain tobacco plants with quinclorac resistance, CRISPR / Cas9 technology was used to construct a gene editing vector and gene transformation was performed to obtain tobacco plants with NtTIRd gene knockout.

[0059] The following is a brief introduction to the experimental conditions related to the gene editing vector construction experiment in this example:

[0060] (1) Editing target primer design

[0061] For the target site region of the NtTIRd gene (specific sequence of the target site: tgtccttcagatctctccgg, SEQID NO: 5), the editing primer sequences were designed as follows:

[0062] TIRd-f: 5'-gattgatcccagcttgaaaaaaccg-3' (SEQ ID NO: 6);

[0063] TIRd-r: 5'-aaaccggttttttcaagctgggatc-3' (SEQ ID NO:7);

[0064] (2) Primer annealing and vector ligation

[0065] Refer to the instructions of the Annealing Buffer for DNA Oligos (5×) kit to obtain double-stranded DNA of the target site through primer annealing; the annealing reaction system is as follows: Annealing Buffer for DNA Oligos (5×), 4μL; upstream and downstream primers (TIRd-f, TIRd-r), 4μL each (50 μmoL / μL); Nuclease-free water is added to 20μL. The reaction program is: 95℃ for 5 min, and the temperature is reduced by 0.1℃ every 8s to 25℃.

[0066] The above annealing product was connected to the CRISPR / Cas9 vector after BsaⅠ digestion, and the CRISPR / Cas9 expression vector for knocking out the NtTIRd gene was screened. The 20μL connection system was designed as follows: annealing product, 6μL; digestion product (CRISPR / Cas9 vector after BsaⅠ digestion), 3μL; 10×T4 DNA Ligase Buffer, 2μL; T4 DNALigase, 1μL; sterile water was added to 20μL and connected at 37℃ for 3h.

[0067] The above ligation products were transformed into DH5α E. coli competent cells for replication, and then screened and identified by colony PCR. During identification, primer pairs U26-jiance-F (5'-ttaggtttacccgccaata-3', SEQ ID NO: 8) and TIRd-r were used for positive clone detection. The electrophoresis results were as follows Figure 2As shown in the figure, all five clones have specific target bands at around 500 bp, and all are positive clones. The editing plasmids of the positive clones were extracted.

[0068] Example 3 Obtaining NtTIRd gene knockout transgenic strains

[0069] The edited plasmid extracted in Example 2 was transformed into Agrobacterium, and then into tobacco plants to construct transgenic plants with NtTIRd gene knockout. The specific experimental process is as follows.

[0070] (1) Transformation of Agrobacterium

[0071] Thaw the competent cells of Agrobacterium GV3101 on ice, add 6 μL of the editing vector prepared in Example 2, and mix gently; place the mixture in a pre-cooled electroporation cup and place it on ice for 5 minutes. Use absorbent paper to absorb the water droplets on the outer wall of the electroporation cup, put the electroporation cup into the electroporation tank, and transform those by electroporation. The electroporation conditions are: voltage 2.5kV, capacitance 25μF, resistance 200Ω. After the click is completed, quickly add 800μL of YEB liquid culture medium preheated to 28℃, and shake and recover at 28℃ for 3h in a shaker at 220rpm. The bacterial solution is evenly applied to the YEB solid culture medium containing rifampicin (100μg / mL), streptomycin (50μg / mL) and kanamycin (50μg / mL), and cultured at 28℃ until a single colony is formed. Pick a single colony, expand the culture, and perform PCR identification on the bacterial solution. The identification primers are U26-jiance-F and TIRa1-r. The correct strain is identified as the positive engineered bacteria.

[0072] (2) Transformation of tobacco plants

[0073] The positive engineered bacteria prepared above were cultured to OD 600 = 0.6, centrifuge at 4000 rpm for 5 min to collect the cells, and then suspend the cells in 20 mL of MS liquid medium. Take the leaves of K326 sterile seedlings that have grown for about one month and cut them into 0.5~1 cm 2 Square leaf disc. Then place the leaf disc in the bacterial solution and immerse for 10 minutes. Use sterile filter paper to absorb the excess bacterial solution around the leaf disc after immersion, and culture it in the dark on the solid medium of MS+6-BA (2 mg / L)+NAA (0.5 mg / L) for 3 days. MS solid medium formula: 4.4g / L MS inorganic salt, 30g / L sucrose, 2.5g / L plant gel, pH 5.8~5.9.

[0074] The leaf disc was washed with sterile water containing Cef (400 mg / L), and the excess liquid was absorbed with sterile filter paper. The leaf disc was transferred to MS solid screening medium containing 6-BA (2 mg / L), NAA (0.5 mg / L), Cef (200 mg / L) and Kan (50 mg / L) and cultured at 28°C under light.

[0075] When the adventitious buds grew to 0.5 cm, they were transferred to MS solid medium containing Cef (200 mg / L) and Kan (50 mg / L) for rooting.

[0076] After growing for about a month, transplant them into the soil and take a small amount of leaves to extract genomic DNA, and use the PCR method to detect positive transgenic strains. The detection primers are U26-jiance-F and TIRd-r.

[0077] According to the genome sequence, detection primers spanning the NtTIRd gene target site were designed to detect the mutation type of the target site. The specific primers are:

[0078] Df: 5'-gtgaagagatgtctgaagatgagg-3' (SEQ ID NO:9);

[0079] Dr: 5'-gataccaagatttgctgacgag-3' (SEQ ID NO:10);

[0080] The PCR amplification product was sent for sequencing, and the mutation type was determined based on the sequencing results. Figure 3 As shown, in the T0 generation plant D-8-5, a nucleotide base deletion mutation was detected at the target site of the NtTIRd gene, and one base A was inserted (specifically, one base A was inserted between 62bp and 63bp of the nucleotide sequence shown in SEQ ID NO: 1), causing a frameshift mutation in the NtTIRd protein, thereby inactivating the NtTIRd protein. No mutation was detected at the target site of the NtTIRd gene of the wild-type plant.

[0081] Example 4 Quinclorac resistance assay

[0082] In order to clarify the resistance level of NtTIRd gene knockout mutants to quinclorac, the resistance of wild-type K326 and NtTIRd gene mutant plant D-8-5 to quinclorac was determined using leaf width as an indicator.

[0083] A pot experiment was conducted, and dichloroquinoline carboxylic acid was added for treatment to determine the resistance of the mutants in Example 3 to dichloroquinoline carboxylic acid. Specifically, the mutant D-8-5 and the wild type K326 were irrigated with 20 mL of dichloroquinoline carboxylic acid solution per plant at the 5-leaf stage, and the final concentration of dichloroquinoline carboxylic acid was 0.2 mg / kg. The leaf width was measured after 30 days of treatment. The upper 3 leaves were measured. Untreated K326 (irrigated with the same volume of clean water) was used as the control. Data statistics were performed, and the results are as follows: Figure 4 As shown. Under the condition of quinclorac phytotoxicity, compared with the control K326, the width of the upper three leaves of D-8-5 increased by 48.0%, 35.7%, and 32.1%, respectively, and D-8-5 showed obvious resistance ( Figure 4 In the data, K326 was the control and was not treated with dichloroquinoline carboxylic acid; K326Q was treated with dichloroquinoline carboxylic acid; D-8-5 was not treated with dichloroquinoline carboxylic acid; D-8-5Q was treated with dichloroquinoline carboxylic acid; among them, 71.0% and 16.0% represented the decrease in leaf width of the first leaf K326 and D-8-5 before and after dichloroquinoline carboxylic acid treatment, respectively; 79.50% and 40.8% represented the decrease in leaf width of the second leaf K326 and D-8-5 before and after dichloroquinoline carboxylic acid treatment, respectively; 81.6% and 48.8% represented the decrease in leaf width of the third leaf K326 and D-8-5 before and after dichloroquinoline carboxylic acid treatment, respectively).

[0084] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of tobacco TIRd as a target in plant breeding and / or in the preparation of products that assist plant breeding; The tobacco TIRd comprises at least one of the amino acid sequences shown in a) to c) below: a), the amino acid sequence shown in SEQ ID NO: 2; or b) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (a), and having the same function as the amino acid sequence described in (a); or c) an amino acid sequence having at least 90% sequence identity with the amino acid sequence described in (a) or (b).

2. The use according to claim 1, characterized in that: The plant breeding comprises regulating the resistance of the plants to quinclorac.

3. The use according to claim 2, characterized in that: The regulation includes increasing or decreasing.

4. The use according to any one of claims 1 to 3, characterized in that: The plants include plants of the family Cruciferae, Asteraceae, Chenopodiaceae, Rutaceae, Moraceae, Leguminosae and / or Solanaceae; and the plants of the family Solanaceae include tobacco.

5. A plant breeding or plant breeding assisted product, characterized in that: Including at least one of the following A) to C: A), amplification primers, detection primers and / or targeting primers using the nucleic acid encoding the tobacco TIRd as a template; B), an interference fragment targeting the tobacco TIRd; C), gRNA targeting the tobacco TIRd; D), an expression cassette containing the interference fragment as described in B), or the gRNA as described in C); E), a recombinant vector containing the interference fragment as described in B), or the gRNA as described in C), or the interference fragment as described in D); F), transforming or transfecting the host cell with the recombinant vector as described in E); G), culturing the mixture obtained by the host cells described in F).

6. The product according to claim 5, characterized in that The target nucleotide sequence of the gRNA is shown in SEQ ID NO:

5.

7. A kit, characterized in that Including the product and auxiliary materials described in claim 5 or 6.

8. The kit according to claim 7, characterized in that The auxiliary materials include: at least one of a DNA extraction reagent, a culture medium, a DNA reverse transcription reagent, an antibiotic and / or a buffer.

9. Use of the product according to claim 5 or 6 or the kit according to claim 7 or 8 in plant breeding or assisted plant breeding.

10. A method for plant breeding or assisted plant breeding, characterized in that The method comprises using the product according to claim 5 or 6 or the kit according to claim 7 or 8 for plant breeding.

Images