EGFR gene mutation detection system and method based on CRISPR / Cas12a

Abstract

The invention provides an EGFR (epidermal growth factor receptor) gene mutation detection system and an EGFR gene mutation detection method based on CRISPR / Cas12a. The detection system comprises an RPA system and a report system; the RPA system comprises restriction endonuclease or a coding gene of the restriction endonuclease aiming at an EGFR mutation site wild type sequence, an RPA primer or a coding gene of the RPA primer aiming at an EGFR mutation site, and an RPA reagent, the report system comprises crRNA (Complementary Ribonucleic Acid) aiming at EGFR (Epidermal Growth Factor Receptor) mutation sites, Cas protein or coding genes thereof and single-chain report DNA ( Wherein the single-chain report DNA is marked with fluorescent report molecules or CRISPR (clustered regularly interspaced short palindromic repeats) lateral chromatography test strip report molecules. The detection method can be used for detecting fresh tissue and paraffin-embedded tissue samples, the whole process is controlled within 2 hours, only a small incubation instrument is needed, and rapid and convenient gene mutation low-detection-limit detection on the samples is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and specifically relates to an EGFR gene mutation detection system and method based on CRISPR / Cas12a. Background Art

[0002] Epidermal Growth Factor Receptor (EGFR) is a transmembrane glycoprotein with intracellular tyrosine kinase (TK) activity that controls cell proliferation and angiogenesis. EGFR is an oncogene and has been detected in a variety of human malignancies, including non-small cell lung cancer (NSCLC), head and neck cancer, breast cancer, ovarian cancer, and colon cancer. NSCLC accounts for 85% of the current incidence and mortality of lung cancer. Among all EGFR mutations in NSCLC, the deletion of exon 19 and the L858R point mutation of exon 21 of the gene account for 47% and 41%, respectively. These mutations make NSCLC sensitive to tyrosine kinase inhibitors (TKIs) and can be used as guidance sites for the use of TKIs.

[0003] At present, the detection of exon 19 deletion and exon 21 L858R point mutation of EGFR gene in DNA samples mainly includes fluorescence quantitative PCR or second-generation sequencing. However, for the detection of a small number of clear EGFR gene mutation sites, the use of second-generation sequencing methods has problems such as long cycle, high cost and complex equipment. Therefore, when targeting the two sites of EGFR gene exon 19 deletion and exon 21 L858R point mutation, fluorescence quantitative PCR has become a more commonly used method on the market (CN 118240940 A). However, the fluorescence quantitative PCR system still has the following shortcomings when detecting EGFR mutations: 1) For the detection of point mutation sites, it costs a lot of money to modify the primer and probe sequence structure and optimize the Blocker screening during the development process to improve the detection sensitivity and specificity; 2) There are certain requirements for DNA purity, and a suitable paraffin sample extraction kit needs to be selected, and the extraction time is long; 3) A fluorescence PCR instrument is required, which has requirements for laboratory equipment conditions and is not suitable for fast and convenient detection.

[0004] As the "next generation molecular diagnosis", CRISPR / Cas technology has the advantages of being fast, portable, low-cost, highly sensitive, and highly specific. It has been proven to be used for a variety of purposes, such as SNP typing and tumor gene mutation detection. For example, taking the type II Cas12a discovered by Zhang Feng's team as an example, under the guidance of crRNA, the Cas12a protein can specifically identify and cut the target gene, and then activate the trans-cutting activity of Cas12a. Based on this principle, CN116377036A provides a CRISPR / Cas12a-based EGFR gene mutation detection system and method for peripheral blood EGFR gene mutation detection in lung cancer patients, using ssDNA fragments with fluorescent reporter groups as trans-cutting objects of Cas12a protein, and indicating the presence of target genes through the release of fluorescent signals, thereby identifying whether the sample contains the target gene to be tested. However, after the sample is amplified by RPA, the method needs to use a fluorescent detection device for fluorescence excitation and detection when performing fluorescence detection on the amplified product, which has requirements for the detection equipment conditions and is not suitable for fast and convenient detection; or naked eye visualization observation by blue light irradiation, the result judgment is not objective enough, and it is difficult to distinguish at low fluorescence intensity. In addition, the samples processed by this method are artificially synthesized plasmid DNA containing EGFR mutant genes, which has less background interference. However, at the practical application sample level, since ctDNA in plasma samples is highly fragmented and usually exists at low abundance levels, current technology makes it difficult to reliably detect EGFR mutations using DNA samples extracted from blood. Therefore, currently, DNA extraction is mainly performed using preserved paraffin-embedded patient tumor tissue samples for EGFR mutation detection. Therefore, it is necessary to develop a rapid and convenient EGFR mutation detection system and method that can be applied to paraffin-embedded tissues. Summary of the invention

[0005] In order to solve the problems of high sample requirements and the need for laboratory testing equipment in the EGFR gene mutation detection method based on CRISPR / Cas12a in the prior art, the present invention provides an EGFR gene mutation detection system and method based on CRISPR / Cas12a that can be applied to paraffin-embedded tissue samples. The method does not require fluorescence detection equipment, and in a similar time, only CRISPR lateral flow test strips are required to quickly and conveniently report the test results, and the lower limit of mutation frequency detection for paraffin-embedded tissue samples can reach 0.5%~1%.

[0006] The technical solution adopted by the present invention is: an EGFR gene mutation detection system based on CRISPR / Cas12a, including an RPA system and a reporter system; the RPA system includes a restriction endonuclease or its encoding gene for the wild-type sequence of the EGFR mutation site, an RPA primer or its encoding gene for the EGFR mutation site, and an RPA reagent; the reporter system includes crRNA, Cas protein or its encoding gene, and single-stranded reporter DNA for the EGFR mutation site; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule.

[0007] In order to provide a convenient and fast EGFR gene mutation detection system and method based on CRISPR / Cas12a that can be applied to paraffin-embedded tissue samples, the present invention has developed a detection system and method that can use CRISPR lateral flow test strips to report the results of EGFR gene mutation detection. Unlike fluorescence signal detection, CRISPR lateral flow test strips do not require fluorescence detection equipment, and the interpretation of the test line / quality control line is more objective than naked eye observation. Furthermore, in order to meet the concentration requirements of CRISPR lateral flow test strips for reporter molecules and overcome the problem that DNA is degraded and contains more inhibitory substances after nucleic acid is extracted from paraffin-embedded tissue samples, the present invention has made creative improvements in the detection system and detection method to improve detection specificity.

[0008] In the detection system, in order to exclude the background interference of a large number of wild-type sequences in tissue samples on the test results, the present invention adds an appropriate amount of restriction endonucleases for the wild-type sequences of EGFR mutation sites in the RPA system, which are used to specifically identify and cut the wild-type amplified sequences obtained by RPA amplification, and the crRNA sequences with specific recognition ability in the combined CRISPR / Cas12a detection, and the remaining wild-type fragments that are not cleaved by enzymes will not cause non-specific positive detection signals, thereby ensuring the specificity of the test results under the appropriate amount of DNA input. It should be noted that there is no need to add restriction endonuclease buffer in the RPA system. The experimental results show that the addition of restriction endonuclease buffer may have a certain inhibition on amplification, resulting in abnormal experimental results.

[0009] In the detection method, in order to improve the detection specificity under a shorter detection time, the present invention is provided with the complex incubation step of Cas12a / crRNA to improve the trans-cleavage activity of the Cas12a / crRNA complex, rather than purifying the RPA reaction product and then performing the CRISPR / Cas12a trans-cleavage reaction. Generally, it takes 60~90 min to purify the RPA reaction product, and this step cannot meet the requirements of rapid detection. The complex incubation step of Cas12a / crRNA only takes 20~40 min, which can be carried out simultaneously with the RPA reaction (consuming about 30~40 min) accompanied by restriction endonucleases, thereby optimizing the experimental process, saving detection time, and also compared with the fluorescent report method (CN116377036A) without additionally extending the detection time.

[0010] Preferably, the EGFR mutation site includes L858R and / or E19 deletion mutation; the E19 deletion mutation includes at least one of E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751. In a specific embodiment of the present invention, four mutations, L858R, E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751 (wherein, E19-E746_A750[1][2] has two subtypes of mutations in the DNA sequence, but the reactions are identical in the amino acid sequence) can be detected at one time, and E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751 cover 75% to 80% of E19 deletion mutations, while detecting E19-E746_A750 alone can only cover about 50% of E19 deletion mutations. It is understandable that the detection system provided by the present invention can also detect any of the above-mentioned EGFR mutation sites separately.

[0011] Preferably, the detection system includes an RPA system for L858R, a reporter system for L858R, an RPA system for E19 deletion mutation, and a reporter system for E19 deletion mutation.

[0012] Preferably, the RPA system for L858R includes a restriction endonuclease for the L858R wild-type sequence, RPA primers L858R-F / R, and RPA reagents; the reporter system for L858R includes crRNA-L858R, Cas protein, and single-stranded reporter DNA; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule.

[0013] Preferably, the RPA system for E19 deletion mutation includes a restriction endonuclease for the wild-type sequence of E19 deletion mutation, RPA primer E19-F / R, and RPA reagent; the reporter system for E19 deletion mutation includes crRNA-E19, Cas protein, and single-stranded reporter DNA; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule, and the crRNA-E19 is selected from at least one of crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751, and it is further preferred that the crRNA-E19 includes crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751. In a specific embodiment of the present invention, the crRNA-E19 contains crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751, which are used to simultaneously detect four E19 deletion mutations, namely, E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751, thereby covering 75% to 80% of E19 deletion mutations, which has a wider detection range than detecting E19-E746_A750 alone (covering about 50% of E19 deletion mutations).

[0014] Preferably, the restriction endonuclease cleavage site sequence for the L858R wild-type sequence is 5'-TGGCCA-3'; the restriction endonuclease for the L858R wild-type sequence is preferably MscI.

[0015] Preferably, the target sequence amplified by RPA primer L858R-F / R is preferably: . Wherein, the bold part TTTG is represented as the PAM sequence recognized by crRNA-L858R, and the underlined part TGGCCA is represented as the restriction endonuclease cleavage site sequence for the L858R wild-type sequence. When a mutation occurs, the underlined sequence changes, and the restriction endonuclease for the L858R wild-type sequence cannot cut the sequence in which the L858R mutation occurs. Therefore, the wild-type amplified sequence can be digested by the corresponding endonuclease, and the amplified sequence of the L858R mutation is retained and recognized by crRNA-L858R through the PAM sequence, stimulating the trans-cleavage activity of the Cas12a / crRNA complex, and the single-stranded reporter DNA marked with a fluorescent reporter molecule or a CRISPR lateral chromatography test strip reporter molecule is cut, and the released fluorescent reporter molecule or the CRISPR lateral chromatography test strip reporter molecule is identified and reported by fluorescence detection or CRISPR lateral chromatography detection, respectively.

[0016] Preferably, the RPA primers for the L858R mutation include L858R-F and L858R-R, and their sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0017] Preferably, the restriction endonuclease cleavage site sequence for the E19 deletion mutant wild-type sequence is 5'-TTAA-3'; the restriction endonuclease for the E19 deletion mutant wild-type sequence is preferably MseI.

[0018] Preferably, the target sequence amplified by RPA primer E19-F / R is: . Wherein, the bold part GAAA represents the reverse sequence of the PAM structure recognized by crRNA-E19, and the underlined part TTAA represents the restriction endonuclease cleavage site sequence for the E19 deletion mutation wild-type sequence. When a mutation occurs, the italic underlined part sequence TTAA changes, and the restriction endonuclease for the E19 deletion mutation wild-type sequence cannot cut the sequence in which the E19 deletion mutation occurs. Therefore, the wild-type amplified sequence can be digested by the corresponding endonuclease, while the amplified sequence of the E19 deletion mutation is retained and recognized by crRNA-E19 through the PAM sequence, stimulating the trans-cleavage activity of the Cas12a / crRNA complex, and the single-stranded reporter DNA marked with a fluorescent reporter molecule or a CRISPR lateral chromatography test strip reporter molecule is cut, and the released fluorescent reporter molecule or CRISPR lateral chromatography test strip reporter molecule is identified and reported by fluorescence detection or CRISPR lateral chromatography detection, respectively. Wherein, the italic underlined part is another restriction site, and mismatched bases should be introduced by primers to eliminate the restriction site. Therefore, preferably, the restriction endonuclease cleavage site sequence for the E19 deletion mutation wild-type sequence is 5'-TTAA-3'; the RPA primers for the E19 deletion mutation include E19-F and E19-R, and the sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0019] Preferably, the PAM sequence recognized by crRNA for L858R is 5'-TTTG-3'; Preferably, the PAM sequence recognized by crRNA for the E19 deletion mutation is 5'-TTTC-3'; Preferably, the sequence of crRNA-L858R for L858R is shown in SEQ ID NO. 5; Preferably, the sequence of crRNA-E19-E746_A750 for E19-E746_A750[1][2] is shown in SEQ ID NO. 6; Preferably, the sequence of crRNA-E19-L747_P753>S for E19-L747_P753>S is shown in SEQ ID NO.7; Preferably, the sequence of crRNA-E19-L747_T751 targeting E19-L747_T751 is shown in SEQ ID NO. 8.

[0020] Preferably, the single-stranded reporter DNA labeled CRISPR lateral flow test strip reporter molecule has a sequence of 5'-FAM-TTATT-biotin-3'.

[0021] Preferably, the single-stranded reporter DNA is labeled with a fluorescent reporter molecule, that is, a reporter system in which a fluorescent tracer and a fluorescent quencher are respectively labeled at both ends of the ssDNA, and the sequence is preferably 5'-FAM-TTATT-BHQ1-3'.

[0022] Preferably, the sample detected by the detection system is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swabs, oral swabs, nasal swabs or lavage; the tissue sample is selected from fresh tissue and / or paraffin-embedded tissue.

[0023] Preferably, the detection system further comprises a DNA extraction system, and the DNA extraction system comprises a nucleic acid releasing agent.

[0024] Preferably, the detection system further comprises a DNA extraction system for paraffin-embedded tissue samples, and the DNA extraction system for paraffin-embedded tissue samples comprises a dewaxing solution, a cleaning solution, and a nucleic acid release agent. The paraffin-embedded tissue samples to be detected should be sufficient in quantity. Taking paraffin sections as an example, the section thickness should be 10 μM, and the number should be 4 or more. If the section thickness is 5 μM, the number of sections should be further increased.

[0025] Preferably, the detection system includes an RPA system for L858R, a reporter system for L858R, an RPA system for E19 deletion mutation, and a reporter system for E19 deletion mutation; the RPA system for L858R includes a restriction endonuclease MscI with a restriction site sequence of 5'-TGGCCA-3', an RPA primer L858R-F / R with sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, and an RPA reagent; the reporter system for L858R includes crRNA-L858R with a sequence as shown in SEQ ID NO. 5, a Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3'; the RPA system for E19 deletion mutation includes a restriction endonuclease MseI with a restriction site sequence of 5'-TTAA-3', and sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 RPA primer E19-F / R, RPA reagent; The reporter system for E19 deletion mutation includes sequences such as SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 shown in crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, crRNA-E19-L747_T751, Cas12a protein, sequence 5'-FAM-TTATT-biotin-3' single-stranded reporter DNA. It should be noted that in the preferred detection system of the present invention, the restriction endonuclease (MscI / MseI), RPA primer (SEQ ID NO. 1 ~ 2 / SEQ ID NO. 3 ~ 4), crRNA (SEQ ID NO.5 / SEQ ID NO. 6 ~ 8) combination of the three designed and screened for L858R mutation and E19 deletion mutation requires creative labor. First, the present invention needs to design corresponding RPA primers for different mutations on different genes under the consideration of restriction endonuclease cleavage sites. When designing RPA primers, it is necessary to consider that restriction endonucleases effectively cut wild-type sequences while also avoiding the influence of mutation sites on cleavage sites. In addition, the effects of different crRNA sequences designed on trans-cleavage reactions also vary greatly, especially crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, crRNA-E19-L747_T751 three crRNA sequences are mixed to cover 75%~80% of E19 deletion mutations, and 1% or even 0.5% mutation frequency detection can still be achieved under CRISPR lateral chromatography detection reporting mode, resulting in unexpected effects.In summary, obtaining the crRNA with good specificity, sensitivity and compatibility shown in SEQ ID NO. 5 / SEQID NO. 6~8 of the present application and combining it with SEQID NO. 1~2 / SEQ ID NO. 3~4 RPA primers with good amplification efficiency, and then obtaining the detection system with good sensitivity and specificity claimed in the present invention is not something that can be obtained only through logical analysis, reasoning or limited experiments based on the prior art.

[0026] The present invention also provides an EGFR gene mutation detection product, comprising the detection system.

[0027] Preferably, the EGFR gene mutation detection product also includes a CRISPR lateral flow test strip.

[0028] The present invention also provides an in vitro non-diagnostic method for detecting EGFR gene mutations based on CRISPR / Cas12a using the detection product, comprising the following steps: obtaining nucleic acid from a sample; The obtained nucleic acid, the restriction endonuclease targeting the wild-type sequence of the EGFR mutation site, the RPA primers targeting the EGFR mutation site, and the RPA reagent are mixed to form an RPA reaction system, and an RPA reaction accompanied by the restriction endonuclease is performed to obtain an RPA reaction product; wherein, in the RPA reaction system, when the amount of nucleic acid used is 40 ng, the amount of the restriction endonuclease targeting the wild-type sequence of the EGFR mutation site is not less than 10 U; The crRNA targeting the EGFR mutation site was mixed with the Cas protein to form an incubation system targeting the EGFR mutation site, and incubated at 37-40°C for 15-30 min; The obtained RPA reaction product, single-stranded reporter DNA, and incubation system for EGFR mutation sites were mixed to form a trans-cleavage reaction system, and incubated at 37-40°C for 20-30 min to obtain a cleavage product; The sheared products were then subjected to corresponding fluorescence detection or CRISPR lateral flow detection based on the single-stranded reporter DNA.

[0029] Preferably, the sample is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swab, oral swab, nasal swab or lavage; the tissue sample is selected from fresh tissue and / or paraffin-embedded tissue.

[0030] Preferably, when the sample is paraffin-embedded tissue, the method for obtaining nucleic acid from the sample includes: dewaxing the paraffin-embedded tissue sections using a dewaxing solution, washing the dewaxing product using a washing solution, adding a nucleic acid release agent after drying, and obtaining nucleic acid after incubation.

[0031] Preferably, when the sample is fresh tissue, the method for obtaining nucleic acid from the sample comprises: adding a nucleic acid releasing agent to the broken fresh tissue, and obtaining nucleic acid after incubation.

[0032] Preferably, in the RPA reaction system, the concentration of the RPA primers targeting the EGFR mutation site is 300-500 nM.

[0033] Preferably, when detecting the EGFR mutation site L858R, the 50 μL RPA reaction system includes: 20 μL RPA reagent, 2.5 μL 10 μM L858R-F, 2.5 μL 10 μM L858R-R, 2 μL 5 U / μL MscI, 2 μL nucleic acid, 2 μL activator, 19 μL ddH2O. Perform RPA reaction accompanied by restriction endonuclease to obtain L858R-RPA reaction product. Among them, the activator is quickly added and mixed after all other components are added to the PCR tube.

[0034] Preferably, when detecting the E19 deletion mutation at the EGFR mutation site, the 50 μL RPA reaction system includes: 20 μL RPA reagent, 2.5 μL 10 μM E19-F, 2.5 μL 10 μM E19-R, 1 μL 10 U / μL MseI, 2 μL nucleic acid, 2 μL activator, and 20 μL ddH2O. Perform an RPA reaction accompanied by a restriction endonuclease to obtain an E19-RPA reaction product. The activator is added quickly and mixed after all other components are added to the PCR tube.

[0035] Preferably, the conditions of the RPA reaction accompanied by restriction endonuclease are: 37-40° C. for 30-40 min, and then the reaction is terminated according to the requirements of the RPA reagent.

[0036] Preferably, the incubation step is performed simultaneously with the RPA reaction accompanied by restriction endonuclease.

[0037] Preferably, when detecting the EGFR mutation site L858R, the 3 μL incubation system includes: 0.6 μL LbCas12a protein, 0.6 μL 10 μM crRNA-L858R. The Cas12a / crRNA-L858R complex incubation system is obtained by incubation.

[0038] Preferably, when detecting the E19 deletion mutation at the EGFR mutation site, the 4.5 μL incubation system includes: 0.9 μL LbCas12a protein, 0.4 μL 10 μM crRNA-E19-E746_A750, 0.4 μL 10 μM crRNA-E19-L747_P753>S, and 0.4 μL 10 μM crRNA-E19-L747_T751. The Cas12a / crRNA-E19 complex incubation system is obtained by incubation.

[0039] Preferably, when detecting the EGFR mutation site L858R, the 20 μL trans-cleavage reaction system includes: 3 μL Cas12a / crRNA-L858R complex incubation system, 2 μL Cas12areaction buffer, 1 μL LFA ssDNA reporter, and 5 μL L858R-RPA reaction product.

[0040] Preferably, when detecting the E19 deletion mutation at the EGFR mutation site, the 20 μL trans-scission reaction system includes: 4.5 μL Cas12a / crRNA-E19 complex incubation system, 2 μL Cas12areaction buffer, 1 μL LFAssDNA reporter, and 5 μL E19-RPA reaction product. When detecting the E19 deletion mutation, the Cas12a / crRNA-E19 complex incubation system is mixed with three crRNAs: crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751. Therefore, it is necessary to specifically adjust the trans-scission reaction system for the F19 deletion mutation to achieve a better trans-scission effect, so that the CRISPR lateral chromatography detection can achieve the detection of a mutation frequency of 1% or even 0.5%.

[0041] Preferably, when using a single-stranded reporter DNA labeled with a CRISPR lateral flow detection test strip reporter molecule, the sheared product is subjected to CRISPR lateral flow detection using a CRISPR lateral flow detection test strip, and the lower limit of detection of the mutation frequency is 0.5% to 1%. If a positive band appears on the test line on the test strip, it means that the test sample has the corresponding EGFR mutation site, and if no positive band appears on the test line on the test strip, it means that the test sample does not have the corresponding EGFR mutation site.

[0042] After the sample nucleic acid was detected using the detection system and detection method provided by the present invention, a mutation frequency of 1% was detected for both the L858R mutation and the E19 deletion mutation, and there is the potential to further reduce the detection limit to 0.5%, and the entire process is controlled within 2 hours.

[0043] Preferably, when using single-stranded reporter DNA labeled with a fluorescent reporter molecule, the sheared product is fluorescently detected using a fluorescence detection device. The fluorescence detection device can be any fluorescence detection device that can perform fluorescence excitation and detection on the corresponding fluorescence channel, or perform naked eye visualization observation by blue light irradiation.

[0044] Beneficial effects of the present invention: The present invention first studies the restriction endonuclease reaction buffer and the dosage of the endonuclease in the isothermal amplification system, and confirms a recombinase polymerase isothermal amplification reaction accompanied by a restriction endonuclease, which is combined with the targeted crRNA in the CRISPR / Cas12a detection, effectively reducing the detection specificity. In terms of detection performance, the present invention realizes the detection of 1% mutation frequency of the EGFR gene under the input of 20 ng standard sample, and has the potential to further reduce the detection limit to 0.5%. Through further experiments, the present invention verifies that the isothermal amplification step can avoid reducing the influence of inhibitory substances in the rapid extraction product of paraffin samples, and the rapid extraction test results of paraffin samples are consistent with the positive and negative results of commercial sample extraction and commercial sample detection. Finally, the present invention develops a tissue EGFR gene mutation rapid extraction detection system and method based on CRISPR / Cas12a, which can be used for the detection of fresh tissue and paraffin samples, and the whole process is controlled within 2 hours, and only a small incubation instrument is needed to achieve a fast and convenient detection of gene mutations with a lower detection limit for samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The results of the 4150 analysis amplification and enzyme digestion fragments in Example 1 of the present invention.

[0046] Figure 2 This is an optimization test of the complex incubation system in Example 2 of the present invention; A is a design diagram of multiple crRNAs for E19 deletion mutations, and B is the color development of the test strips at different incubation times.

[0047] Figure 3 The results of the 4150 analysis amplification and enzyme digestion fragments in Example 3 of the present invention.

[0048] Figure 4 The figure shows the color development of the test strip in Example 3 of the present invention.

[0049] Figure 5 The figure shows the color development of the test strip in Example 4 of the present invention.

[0050] Figure 6 The color development of the test strip in Example 5 of the present invention is shown. DETAILED DESCRIPTION

[0051] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0052] The embodiments of the present invention provide RPA primers and crRNA for L858R and E19 deletion mutations, respectively, as shown in Tables 1 and 2.

[0053] Table 1. RPA primers L858R-F / R and E19-F / R sequences Primer name Sequence (5'→3') SEQ ID NO. L858R-F CGTACTGGTGAAAACACCGCAGCATGTCAAG SEQ ID NO. 3 L858R-R CACCTCCTTACTTTGCCTCCTTCTGCATGG SEQ ID NO. 4 E19-F <![CDATA[CAGAAGGTGAGAAAG TT C A AATTCCCGTCGCT]]> SEQ ID NO. 1 E19-R TGAGGTTCAGAGCCATGGACCCCCACACAGCA SEQ ID NO. 2 In Table 1, the underlined italic part indicates that the primer introduces a mismatched base at that position, destroying the corresponding restriction endonuclease site.

[0054] Table 2. crRNA-L858R and crRNA-E19 sequences sequence name Sequence (5'→3') SEQ ID NO. crRNA-L858R UAAUUUCUACUAAGUGUAGAUGGCGGGCCAAACUGCUGGGUG SEQ ID NO. 5 crRNA-E19-E746_A750 UAAUUUCUACUAAGUGUAGAUGGAGAUGUUUUGAUAGCGACGGG SEQ ID NO. 6 crRNA-E19-L747_P753>S UAAUUUCUACUAAGUGUAGAUGAUUCCUUGAUAGCGACGGGAAU SEQ ID NO. 7 crRNA-E19-L747_T751 UAAUUUCUACUAAGUGUAGAUGGAGAUUCCUUGAUAGCGACGGG SEQ ID NO. 8 Example 1: Testing of isothermal amplification system of recombinase polymerase accompanied by restriction endonuclease digestion 1. Experimental setup: Take 5% genomic gDNA standard containing EGFR exon 19 p.E746_A750del[1] mutation, add endonuclease MseI (NEB, R0525) and corresponding restriction endonuclease buffer to the recombinase polymerase isothermal amplification reaction system according to Table 3 below, and test the effect of endonuclease buffer on amplification and restriction digestion during isothermal amplification.

[0055] Table 3. RPA reaction system Experiment number Sample Type DNA dosage (ng) Endonuclease and corresponding buffer addition E19-F / R dosage (μL) RPA reagent (μL) 1 EGFR mutation samples 20 / 2.5 20 2 EGFR mutation samples 20 MseI 1 μL 2.5 20 3 EGFR mutation samples 20 Buffer 5μL 2.5 20 4 EGFR mutation samples 20 MseI 1μL+ buffer 5μL 2.5 20 5 <![CDATA[Blank control (ddH2O)]]> / / 2.5 20 After adding water to 48 μL, quickly add 2 μL of activator to each PCR tube and mix well. Incubate the PCR tube at 37°C for 30 min and then incubate at 56°C for 5 min to terminate the amplification reaction.

[0056] 2. Result detection: Take 30 μL of each RPA reaction product and purify it using 1.6X (48 μL) magnetic beads. The concentration of the purified amplified product is detected by Qubit, and the distribution of amplified and enzyme-cut fragments is detected using 4150. The results are shown in Table 4 and Figure 1 , where the EL1 band in the 4150 analysis results represents the electronic marker, and A1-E1 correspond to samples with experimental numbers 1-5, respectively.

[0057] Table 4. Qubit assay results for purified product concentration Experiment number Concentration of purified product (ng / μL) 1 19 2 8.18 3 16 4 12.1 5 6.3 3. Result analysis: Comparing the results of experiments 1 and 2, the samples were significantly digested by enzymes, and the fragments that were not digested by enzymes may contain wild-type sequences in addition to the mutant sequences, indicating that the digestion was complete; comparing the results of experiments 1 and 3, although the difference in product concentration was small, in terms of fragments, the target fragments of sample No. 3 were significantly less, and there were a few diffuse bands. Combined with the results of experiment No. 4, the concentration was significantly higher than that of sample No. 3, and no target mutations or enzyme digestion sequence bands appeared. Therefore, in the isothermal amplification reaction system of recombinase polymerase accompanied by restriction endonuclease digestion, it is not necessary to add endonuclease buffer, and the endonuclease works well. However, adding buffer may inhibit amplification to a certain extent, resulting in abnormal experimental results.

[0058] Example 2: crRNA design, mixing and Cas12a / crRNA complex incubation system optimization test 1. Design of multiple crRNAs for E19 deletion mutation: E19 deletion includes multiple subtypes, and the target sequences of the corresponding subtypes are different after deletion. Therefore, it is impossible to use a single crRNA to cover the detection of all E19 deletion samples. This example analyzes and demonstrates the target sequence structures of the four subtypes that account for the largest proportion of E19 deletion (see Figure 2In A), delE746_A750[1] and delE746_A750[2], which account for the largest proportion, only have a single base difference, while delL747_T751 and delL747_P753>S have relatively large differences. The crRNA design requires a 20 nt constant region and a 20-24 nt specific binding region. The present invention designs the E19 deletion specific binding region to be longer 23 nt to improve the binding stability. Therefore, when delE746_A750[1] and delE746_A750[2] are designed as the same crRNA with delE746_A750[1] as the main crRNA, the crRNA can degenerately recognize and bind to the delE746_A750[2] sequence. On the other hand, the strong crRNA binding stability also provides a basis for reducing the amount of each crRNA and mixing multiple crRNAs during detection. The crRNAs for delL747_T751 and delL747_P753>S were designed with the corresponding target sequences. The E19 deletion crRNA combination designed by the present invention can cover 75-80% of the sample detection of E19 deletion in a single reaction.

[0059] 2. L858R mutant crRNA design: Since the L858R mutant targeting sequence differs only by a single base from the wild type, the present invention designs the crRNA length to be 21 nt to reduce the binding stability and avoid non-specific recognition and binding to the wild-type sequence with smaller sequence differences. At this time, the amount of crRNA is appropriately increased to ensure high sensitivity recognition of the mutant sequence.

[0060] 3.Cas12a / crRNA complex incubation system optimization test: The present invention adopts the test strip method for detection. The reaction signal required for color development of this method is stronger, which ensures the specificity of detection, but at the same time has higher requirements for the recognition and shearing efficiency of the Cas12a / crRNA complex. The present invention adopts the method of incubating the Cas12a / crRNA complex in advance, preparing the corresponding incubation system, and screening the appropriate incubation time to improve the complex recognition and shearing efficiency and enhance the reaction signal. When the Cas12a / crRNA complex is incubated, the Cas12a protein concentration can be 2 μM, and the crRNA dosage is 1-1.5 times that of the Cas12a protein. Combined with different crRNA design lengths and detection site characteristics, the Cas12a / crRNA complex incubation systems of L858R and E19 are finally obtained in Tables 7 and 12.

[0061] 3.1 Experimental setup: Taking the E19 deletion detection system as an example, three incubation time gradients were set, namely 0 min, 15 min and 30 min, to test the positive detection of the weak positive standard sample delE746_A750[1] with a mutation frequency diluted to 2.5% on the test strip. The samples were repeated three times.

[0062] 3.2. Sample preparation: Perform RPA amplification of the sample according to the system No. 2 in Table 3, add 2 μL of activator and mix well, then incubate at 37℃ for 30 min, then incubate at 56℃ for 5 min to terminate the amplification reaction. A single sample amplification is sufficient for subsequent testing.

[0063] 3.3. Group detection of amplification products: Prepare the same 9-tube E19-Cas12a / crRNA complex incubation system according to Table 12, and divide it into 3 groups of experiments with 3 tubes in each group. The 3 groups of experiments were incubated for 0 min (proceed to the next step immediately after the preparation), 15 min and 30 min, and the amplification products of the weak positive standard were subjected to trans-cleavage experiments according to the system in Table 13.

[0064] 3.4. CRISPR lateral flow test strip test: Add 30 μL ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has enough sample liquid to absorb. Insert the sample pad of the test strip into the liquid surface. After leaving it at room temperature for 5 to 10 minutes, the color of the test strip will be as follows: Figure 2 Middle B.

[0065] 3.5, result analysis: By incubating the Cas12a / crRNA complex structure in advance, the trans-cleavage efficiency can be effectively improved. For the RPA amplification product of the weak positive sample, when the complex is incubated for 15 min, the signal generated by the trans-cleavage can only excite a weaker test strip color development signal; when the incubation time is extended to 30 min, the signal generated by the trans-cleavage can stably excite a sufficiently obvious test strip positive band result. Therefore, the present invention can improve the recognition of the target sequence by the Cas12a protein and the trans-cleavage efficiency of the ssDNA reporter by incubating the Cas12a / crRNA complex structure in advance at 37 ° C for 15 to 30 min, and ensure the color development signal of the weak positive sample in the test strip detection.

[0066] Example 3: Restriction endonuclease dosage optimization test 1. Experimental setup: Since L858R is a point mutation detection, it is easy to have a false positive result due to incomplete digestion of the wild-type fragment. Therefore, an excess of 40 ng of wild-type gDNA sample was taken for L858R site amplification. When different amounts of endonucleases were added in the amplification step according to Table 5 below, the product amplification and digestion conditions and the corresponding crRNA-L858R detection results were tested.

[0067] Table 5. RPA reaction system Experiment number Sample Type DNA dosage (ng) MscI endonuclease dosage (U) L858R-F / R dosage (μL) RPA reagent (μL) 1 Wild-type samples 40 / 2.5 20 2 Wild-type samples 40 5 2.5 20 3 Wild-type samples 40 7.5 2.5 20 4 Wild-type samples 40 10 2.5 20 After adding water to 48 μL, quickly add 2 μL of activator to each PCR tube and mix well. Incubate the PCR tube at 37°C for 30 min and then incubate at 56°C for 5 min to terminate the amplification reaction.

[0068] 2. Amplification product detection: Take 30 μL of L858R-RPA reaction product and purify it using 1.6X (48 μL) magnetic beads. The concentration of the purified amplification product is detected by Qubit, and the distribution of amplification and enzyme cleavage fragments is detected by 4150. The results are shown in Table 6 and Figure 3 , where the EL1 band in the 4150 analysis results represents the electronic marker, and A1-D1 correspond to samples with experimental numbers 1-4, respectively.

[0069] Table 6. Qubit assay results for purified product concentration Experiment number Concentration of purified product (ng / μL) 1 34.0 2 25.0 3 17.9 4 8.9 3. CRISPR / Cas12a combined test strips to detect the amplification product additivity test results: a) Prepare the Cas12a / crRNA complex incubation system according to Table 7 and mix by pipetting. The reaction conditions are: 37°C for 30 min.

[0070] Table 7. Cas12a / crRNA-L858R complex incubation system Components Dosage (μL) LbCas12a 0.6 crRNA-L858R (10 μM) 0.6 <![CDATA[ddH2O]]> 1.8 b) Prepare the L858R-Cas12a trans-shearing experiment reaction system according to Table 8 and mix by pipetting. The reaction conditions are: 40°C for 20-30 min.

[0071] Table 8. L858R trans-cleavage reaction system Components Dosage (μL) Cas12a / crRNA-L858R complex incubation system 3 Cas12a reaction buffer 2 LFA ssDNA reporter 1 L858R-RPA reaction products 5 <![CDATA[ddH2O]]> 9 c) CRISPR lateral flow test strips (TOLOBIO, 31203) detection: add 20-30 μL ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has enough sample liquid to absorb. Insert the sample pad of the test strip into the liquid surface as required. After leaving it at room temperature for 5-10 minutes, the color of the test strip will be as follows: Figure 4 .

[0072] 4. Result analysis: Under 1.6X magnetic bead purification, the enzyme cleavage product fragments less than 75 bp were not recovered, so the purified products were mainly wild-type fragments that were not completely cleaved. The results of amplification product purification concentration and fragment analysis showed that the excess sample amplification product increased with the increase of endonuclease dosage, and the remaining wild-type fragments decreased. At 10 U endonuclease dosage, the wild-type band was weak, and the remaining wild-type fragments that were not cleaved did not cause non-specific positive detection signals in combination with the crRNA sequence with specific recognition ability in CRISPR / Cas12a detection. In summary, at a dosage of 10 U endonuclease, combined with the targeted crRNA sequence, the specificity of the detection results can be guaranteed under the appropriate amount of DNA input.

[0073] Example 4: Detection limit test of standard samples 1. Experimental setup: Standard samples (samples 1-6) with mutation frequencies of 5%, 1% and 0.5% for EGFR gene L858R and E746_A750del[1] and the corresponding wild-type sample (sample 7) were collected. The DNA sample concentration was 10 ng / μL. The detection was performed according to the process of the present invention. The lower limit of the mutation frequency detection of the target site was preliminarily evaluated. The sample information is shown in Table 9.

[0074] Table 9. Standard sample information Sample name Mutation site Mutation frequency (%) Sample 1 L858R 5 Sample 2 L858R 1 Sample 3 L858R 0.5 Sample 4 E746_A750del[1] 5 Sample 5 E746_A750del[1] 1 Sample 6 E746_A750del[1] 0.5 Sample 7 / / 2. RPA reaction with restriction endonuclease: Select the basic isothermal amplification reagent (KS101) of Xinda Gene to amplify the L858R site of sample 1, sample 2, sample 3 and sample 7, and the E19 site of sample 4, sample 5, sample 6 and sample 7. The endonucleases used are MscI (NEB, R0534) and MseI (NEB, R0525), respectively. The preparation of each sample system is shown in Table 10 and Table 11. Among them, the activator is added quickly after all other components are added to the PCR tube and mixed. The PCR tube is incubated at 37°C for 30 min, and then incubated at 56°C for 5 min to terminate the amplification reaction.

[0075] Table 10. L858R mutation RPA reaction system Components Volume (μL) RPA reagent 20 L858R-F(10μM) 2.5 L858R-R(10μM) 2.5 MscI (5U / μL) 2 DNA samples 2 <![CDATA[ddH2O]]> 19 Activator 2 Table 11. E19 deletion mutation RPA reaction system Components Volume (μL) RPA reagent 20 E19-F (10 μM) 2.5 E19-R (10 μM) 2.5 MseI (10U / μL) 1 DNA samples 2 ddH2O 20 Activator 2 3. CRISPR / Cas12a combined with test strips to detect mutation sites: 1) Cas12a / crRNA-L858R complex incubation system was prepared for sample 1, sample 2, sample 3 and sample 7, and Cas12a / crRNA-E19 complex incubation system was prepared for sample 4, sample 5, sample 6 and sample 7, and the first gene Cas12a protein and buffer reaction reagent (EM124) were selected to prepare Table 7 and Table 12. The reaction conditions are: incubation at 37°C for 30 minutes, which can be performed simultaneously during the RPA amplification reaction.

[0076] Table 12. Cas12a / crRNA-E19 complex incubation system Components Dosage (μL) LbCas12a 0.9 crRNA-E19-E746_A750[1][2](10 μM) 0.4 crRNA-E19-L747_P753>S(10 μM) 0.4 crRNA-E19-L747_T751 (10 μM) 0.4 <![CDATA[ddH2O]]> 2.4 2) Prepare the Cas12a trans-cleavage experiment reaction system for the sample according to Tables 8 and 13 and mix by pipetting. The reaction conditions are: incubate at 40°C for 20 min.

[0077] Table 13. E19 trans-cleavage reaction system Components Dosage (μL) Cas12a / crRNA-E19 complex incubation system 3 Cas12a reaction buffer 2 LFA ssDNA reporter 1 E19-RPA reaction products 5 <![CDATA[ddH2O]]> 9 3) CRISPR lateral flow test strip test: Add 30 μL ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has enough sample liquid to absorb. Insert the sample pad of the test strip into the liquid surface. After leaving it at room temperature for 5 to 10 minutes, the color of the test strip will be as follows: Figure 5 .

[0078] 4) Result analysis: The results of the test strips for the EGFR gene L858R and E19 deletion standards showed that obvious positive bands (detection line positions) were observed in the detection of 5% and 1% mutation frequency samples, while only quality control line bands appeared in the wild-type standard. For the 0.5% frequency sample, the positive band was relatively weak. Therefore, it is believed that the lower limit of the mutation that can be detected by the present invention at a sample dosage of 20 ng is 0.5%~1%, and the detection results for positive samples with lower frequencies may not be obvious enough.

[0079] Example 5: Rapid extraction and testing of paraffin samples from patients tested for EGFR mutations 1. Sample preparation: Six patient samples from Hangzhou Ruipu Medical Testing Laboratory that had been commercially tested (using a complete advance kit for paraffin sample extraction) were used for the verification experiment of the present invention, including four EGFR mutation-positive samples and two EGFR mutation-negative samples. The sample mutation information can be found in Table 14 below.

[0080] Table 14. Sample mutation information Sample name Sample Type Mutation and frequency Slice thickness Number of slices Sample 1 L858R positive L858R 16.70% 10 μM 5 Sample 2 L858R positive L858R 3.49% 10 μM 8 Sample 3 E19-del positive p.E746_A750del[2] 4.22% T790M 3.35% 10 μM 7 Sample 4 E19-del positive p.L747_T753>S 16.84% 10 μM 7 Sample 5 L858R and E19-del negative p.G719A 1.9% 10 μM 6 Sample 6 L858R and E19-del negative / 10 μM 6 2. Sample rapid extraction experiment: 1) Transfer the slice sample to a 1.5 mL centrifuge tube, add 1 mL of dewaxing solution (Beijing Jiuzhou Berlin Biotechnology, BLB-01), and incubate at 56°C for 3 min.

[0081] 2) After incubation, centrifuge at 12,000 g for 2 min and discard the supernatant.

[0082] 3) Add 1 mL of anhydrous ethanol, centrifuge at 12,000 g for 2 min, discard the supernatant, and repeat this step twice.

[0083] 4) After opening the lid and letting it stand for 5 minutes to dry, add 150 μL of nucleic acid release agent (XinDa Gene, NR201) and incubate at 95°C for 3-5 minutes. After incubation, the sample rapid extraction product, i.e. nucleic acid, is obtained for subsequent detection.

[0084] 3. RPA reaction with restriction endonuclease: Select the basic isothermal amplification reagent (KS101) of Xinda Gene to amplify the L858R site of sample 1, sample 2, sample 5 and sample 6, and the E19 site of sample 3, sample 4, sample 5 and sample 6. The endonucleases used are MscI (NEB, R0534) and MseI (NEB, R0525). The preparation of each sample system is shown in Table 15. Among them, the activator is added quickly after all other components are added to the PCR tube and mixed. The PCR tube is incubated at 37°C for 30 min, and then incubated at 56°C for 5 min to terminate the amplification reaction.

[0085] Table 15. RPA reaction system for rapid sample extraction L858R site amplification E19 site amplification Components Volume (μL) Components Volume (μL) Dissolving agent 20 Dissolving agent 20 L858R-F(10μM) 2.5 E19-F (10 μM) 2.5 L858R-R(10μM) 2.5 E19-R (10 μM) 2.5 MscI (5U / μL) 2 MseI (10U / μL) 1 Rapid sample extraction product 3 Rapid sample extraction product 3 <![CDATA[ddH2O]]> 18 <![CDATA[ddH2O]]> 19 Activator 2 Activator 2 4. CRISPR / Cas12a combined with test strips to detect mutation sites: a) The Cas12a / crRNA-L858R complex incubation system was prepared for sample 1, sample 2, sample 5 and sample 6, and the Cas12a / crRNA-E19 complex incubation system was prepared for sample 3, sample 4, sample 5 and sample 6. The Cas12a protein and buffer reaction reagent (EM124) of the first gene were selected, and the preparation table was shown in Table 7 and Table 12. The reaction conditions are: incubation at 37°C for 30 minutes. This step can be performed simultaneously during the RPA amplification reaction.

[0086] b) Prepare the Cas12a trans-cleavage reaction system for the sample according to Table 16 below and mix by pipetting. The reaction conditions are: incubate at 40°C for 20 minutes.

[0087] Table 16. Trans-cleavage reaction system for rapid sample extraction products L858R trans-cleavage reaction system E19 trans-cleavage reaction system Components Dosage (μL) Components Dosage (μL) Cas12a / crRNA-L858R complex incubation system 3 Cas12a / crRNA-E19 complex incubation system 4.8 10X Cas12a reaction buffer 2 10X Cas12a reaction buffer 2 LFA ssDNA reporter (10μM) 1 LFA ssDNA reporter 1 L858R amplification product 5 E19 amplification product 5 <![CDATA[ddH2O]]> 9 <![CDATA[ddH2O]]> 7.2 c) CRISPR lateral flow test strip test: Add 30 μL ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has enough sample liquid to absorb. Insert the sample pad of the test strip into the liquid surface. After leaving it at room temperature for 5-10 minutes, the color of the test strip will be as follows: Figure 6 .

[0088] 5. Result analysis: The test strip experiment showed that samples 1, 2, 3 and 4 were all positive, and samples 5 and 6 were all negative in the L858R and E19 detection systems. The final results were consistent with the commercial test results of the samples, so it is believed that the present invention can effectively perform rapid extraction and detection of paraffin-embedded tissue samples. Considering that after the extraction of paraffin-embedded tissue samples, DNA is degraded and contains more inhibitory substances, the extraction effect is worse than that of fresh tissues. This result also verifies that the present invention is also applicable to the detection of fresh tissue samples.

[0089] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A CRISPR / Cas12a-based EGFR gene mutation detection system, characterized in that: Including RPA system and reporting system; The RPA system includes a restriction endonuclease or a gene encoding the wild-type sequence of the EGFR mutation site, an RPA primer or a gene encoding the wild-type sequence of the EGFR mutation site, and an RPA reagent; The reporter system includes crRNA, Cas protein or its encoding gene, and single-stranded reporter DNA targeting the EGFR mutation site; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule; The EGFR mutation sites include L858R and / or E19 deletion mutation; the E19 deletion mutation includes at least one of E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751.

2. The detection system according to claim 1, characterized in that Contains at least one of the following: (1) The restriction endonuclease cleavage site sequence for the L858R wild-type sequence is 5'-TGGCCA-3'; (2) The restriction endonuclease cleavage site sequence for the E19 deletion mutant wild-type sequence is 5'-TTAA-3'; (3) The RPA primers for E19 deletion mutation include E19-F and E19-R, and their sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

3. The detection system according to claim 1, characterized in that Contains at least one of the following: (1) The PAM sequence recognized by crRNA for L858R is 5'-TTTG-3'; (2) The PAM sequence recognized by crRNA for the E19 deletion mutation is 5′-TTTC-3′; (3) The sequence of crRNA-L858R targeting L858R is shown in SEQ ID NO. 5; (4) The sequence of crRNA-E19-E746_A750 targeting E19-E746_A750[1][2] is shown in SEQ ID NO. 6; (5) The sequence of crRNA-E19-L747_P753>S for E19-L747_P753>S is shown in SEQ ID NO. 7; (6) The sequence of crRNA-E19-L747_T751 targeting E19-L747_T751 is shown in SEQ ID NO.

8.

4. The detection system according to claim 1, characterized in that Including RPA system for L858R, reporting system for L858R, RPA system for E19 deletion mutation, and reporting system for E19 deletion mutation; The RPA system for L858R includes a restriction endonuclease with a restriction site sequence of 5'-TGGCCA-3', an RPA primer L858R-F / R with a sequence as shown in SEQ ID NO. 3 and SEQ ID NO. 4, and an RPA reagent; The reporter system for L858R includes crRNA-L858R, Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3' as shown in SEQ ID NO. 5; The RPA system for E19 deletion mutation includes a restriction endonuclease with a restriction site sequence of 5'-TTAA-3', an RPA primer E19-F / R with sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and an RPA reagent; The reporter system for the E19 deletion mutation includes crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, crRNA-E19-L747_T751, Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3', respectively, as shown in SEQ ID NO. 6, SEQ ID NO. 7, and SEQID NO.

8.

5. The detection system according to claim 1, characterized in that Contains at least one of the following: (1) The sample detected by the detection system is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swab, oral swab, nasal swab or lavage; the tissue is selected from fresh tissue and / or paraffin-embedded tissue; (2) The detection system further comprises a DNA extraction system, and the DNA extraction system comprises a nucleic acid releasing agent; (3) The detection system also includes a DNA extraction system for paraffin-embedded tissue samples, and the DNA extraction system for paraffin-embedded tissue samples includes a dewaxing solution, a cleaning solution, and a nucleic acid release agent.

6. A product for detecting EGFR gene mutation, characterized in that: Comprising the detection system as described in any one of claims 1 to 5.

7. A method for detecting EGFR gene mutations based on CRISPR / Cas12a using the detection product of claim 6 for non-diagnostic purposes in vitro, characterized in that: The following steps are involved: obtaining nucleic acid from a sample; The obtained nucleic acid, the restriction endonuclease targeting the wild-type sequence of the EGFR mutation site, the RPA primers targeting the EGFR mutation site, and the RPA reagent are mixed to form an RPA reaction system, and an RPA reaction accompanied by the restriction endonuclease is performed to obtain an RPA reaction product; wherein, in the RPA reaction system, when the amount of nucleic acid used is 40 ng, the amount of the restriction endonuclease targeting the wild-type sequence of the EGFR mutation site is not less than 10 U; The crRNA targeting the EGFR mutation site was mixed with the Cas protein to form an incubation system targeting the EGFR mutation site, and incubated at 37-40°C for 15-30 min; The obtained RPA reaction product, the single-stranded reporter DNA, and the incubation system for the EGFR mutation site are mixed to form a trans-cleavage reaction system to obtain a cleavage product; The sheared products were then subjected to corresponding fluorescence detection or CRISPR lateral flow detection based on the single-stranded reporter DNA.

8. The method according to claim 7, characterized in that Contains at least one of the following: (1) The sample is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swab, oral swab, nasal swab or lavage; the tissue is selected from fresh tissue and / or paraffin-embedded tissue; (2) When the sample is paraffin-embedded tissue, the method for obtaining nucleic acid from the sample includes: dewaxing the paraffin-embedded tissue section with a dewaxing solution, washing the dewaxing product with a washing solution, adding a nucleic acid release agent after drying, and obtaining nucleic acid after incubation; (3) When the sample is fresh tissue, the method for obtaining nucleic acid from the sample includes: adding a nucleic acid releasing agent to the broken fresh tissue, and obtaining nucleic acid after incubation.

9. The method according to claim 7, characterized in that Contains at least one of the following: (1) When detecting the EGFR mutation site L858R, the 3 μL incubation system includes: 0.6 μL LbCas12a protein, 0.6 μL 10 μM crRNA-L858R; (2) When detecting the E19 deletion mutation at the EGFR mutation site, the 3 μL incubation system included: 0.9 μL LbCas12a protein, 0.4 μL 10 μM crRNA-E19-E746_A750, 0.4 μL 10 μM crRNA-E19-L747_P753>S, and 0.4 μL 10μM crRNA-E19-L747_T751.

10. The method according to claim 7, characterized in that When a single-stranded reporter DNA labeled with a CRISPR lateral flow assay strip reporter molecule is used, the cleavage product is subjected to CRISPR lateral flow assay using a CRISPR lateral flow assay strip.

Images