Multi-MNP Molecular Marker Combinations for Body Height Trait of Hybrid Pigs and Their Applications

Abstract

The present invention discloses a multi-MNP molecular marker combination for the body height trait of hybrid pigs and its application, which relates to the field of biotechnology. The multi-MNP molecular marker combination is composed of molecular markers numbered MNP-1, MNP-2, and MNP-3, and the nucleotide sequences of the molecular markers are respectively shown as the nucleotide sequences of SEQ NO.1 to SEQ NO.3 in the sequence listing. The present invention proposes an MNP molecular marker combination for the body height trait of binary hybrid pigs and designs specific primers that can be used for the early judgment of the body height trait of hybrid pigs. It can achieve precise gene selection, thereby efficiently cultivating hybrid pigs with an ideal body shape, realizing rapid and accurate genetic selection in population improvement, accelerating genetic progress, and thus improving economic benefits. It is expected to provide a new tool for the early judgment and evaluation of the body height trait.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a multi-MNP molecular marker combination for the body height trait of hybrid pigs and its application. Background Art

[0002] With the continuous growth of consumers' demand for high-quality pork, the importance of the development of the seed industry has become increasingly prominent. To meet the market demand for high-quality pork, breeding new varieties has become an urgent task in the breeding field. Local pigs, with their unique genetic advantage of excellent meat quality, have become the main object of the development of high-quality genetic resources and provide an ideal choice for cultivating new varieties in the market. However, in the actual production of crossbreeding local pigs, the body height trait of the new hybrid variety has not reached the expected level. As one of the important morphological characteristics of pigs, the body height trait has important reference value for its living function and economic value. Generally speaking, pigs with a higher body height tend to have a larger skeleton and body volume, can accommodate more muscles and internal organs, and thus can more efficiently ingest and utilize feed during the growth process, converting it into an increase in body weight. At the same time, good body height traits also help to improve the quality of pork, such as the texture, tenderness, and flavor of the meat.

[0003] Therefore, it is extremely important to select and breed for the body height trait of hybrid pigs. However, traditional breeding methods are not ideal for quickly improving the body height trait of new varieties, and there is an urgent need for a new breeding technology to accelerate the process of genetic improvement. Summary of the Invention

[0004] In view of the above deficiencies of the prior art, the present invention provides a multi-MNP molecular marker combination for the body height trait of hybrid pigs and its application, which helps breeders to more accurately and efficiently select and cultivate new varieties with good body height traits.

[0005] To achieve the above object of the invention, the technical solution adopted by the present invention is as follows:

[0006] Provide a multi-MNP molecular marker combination for the body height trait of hybrid pigs, the multi-MNP molecular marker combination is composed of molecular markers numbered MNP-1, MNP-2, and MNP-3, and the nucleotide sequences of the molecular markers are respectively shown as the nucleotide sequences of SEQ NO.1 to SEQ NO.3 in the sequence listing.

[0007] Further, the hybrid pig is a binary hybrid pig obtained by mating and breeding Rongchang pigs and Laiwu pigs.

[0008] Further, the molecular marker MNP-1 contains the following four SNP loci:

[0009] I. The SNP locus located at 37321687 bp on chromosome 10 of the pig, located at the 131st position of the sequence shown in SEQ NO.1, and its polymorphism is T / G;

[0010] Ii. The SNP locus at position 37321701 bp on porcine chromosome 10, located at position 145 of the sequence shown in SEQ NO.1, with polymorphism G / A;

[0011] Iii. The SNP locus at position 37321909 bp on porcine chromosome 10, located at position 352 of the sequence shown in SEQ NO.1, with polymorphism T / G;

[0012] Iv. The SNP locus at position 37321933 bp on porcine chromosome 10, located at position 377 of the sequence shown in SEQ NO.1, with polymorphism G / A;

[0013] The molecular marker MNP-2 contains the following four SNP loci:

[0014] a. The SNP locus at position 38648489 bp on porcine chromosome 10, located at position 200 of the sequence shown in SEQ NO.2, with polymorphism G / A;

[0015] b. The SNP locus at position 38648524 bp on porcine chromosome 10, located at position 235 of the sequence shown in SEQ NO.2, with polymorphism G / A;

[0016] c. The SNP locus at position 38648529 bp on porcine chromosome 10, located at position 240 of the sequence shown in SEQ NO.2, with polymorphism G / C;

[0017] d. The SNP locus at position 38648677 bp on porcine chromosome 10, located at position 388 of the sequence shown in SEQ NO.2, with polymorphism A / G;

[0018] The molecular marker MNP-3 includes the following three SNP loci:

[0019] ①. The SNP locus at position 41505867 bp on porcine chromosome 13, located at position 118 of the sequence shown in SEQ NO.3, with polymorphism T / C;

[0020] ②. The SNP locus at position 41506107 bp on porcine chromosome 13, located at position 358 of the sequence shown in SEQ NO.3, with polymorphism A / G;

[0021] ③. The SNP locus at position 41506113 bp on porcine chromosome 13, located at position 364 of the sequence shown in SEQ NO.3, with polymorphism A / G.

[0022] The present invention also provides a kit for identifying the body height trait of crossbred pigs prepared by using the above primer pair composition.

[0023] The present invention also provides the use of the above kit for identifying the body height trait of crossbred pigs, including:

[0024] (1) For the identification and genetic improvement of the body height trait of crossbred pigs;

[0025] (2) For the early prediction of the body height trait of crossbred pigs;

[0026] (3) For molecular marker-assisted breeding related to the body height trait of crossbred pigs. Further,

[0027] The present invention also provides a method for judging the body height trait of crossbred pigs by using the above kit for identifying the body height trait of crossbred pigs, including the following steps:

[0028] S1: Extract the genomic DNA of the crossbred pig to be tested;

[0029] S2: Using the genomic DNA of the crossbred pig to be tested as a template, perform a PCR amplification reaction with the primer pair composition in the kit to obtain a PCR product;

[0030] S3: Sequence the PCR product to obtain its genotype;

[0031] S4: Judge the body height trait of the crossbred pig to be tested according to the genotype.

[0032] Further, step S4 is specifically: when the individuals with SNP locus polymorphism showing the minor allele in the genotype of the crossbred pig to be tested have better body height traits compared to the individuals with polymorphism showing the major allele.

[0033] Further, the major allele is the allele with a frequency ≥ 90% in the population at the SNP locus of the molecular marker, and the minor allele is the allele with a frequency ≤ 10% in the population at the SNP locus of the molecular marker.

[0034] The present invention also provides a method for genetic improvement of the body height trait of crossbred pigs, specifically: after judging the body height trait of crossbred pigs, breed and select the crossbred pig individuals with SNP locus polymorphism showing the minor allele; the minor allele is the allele with a frequency ≤ 10% in the population at the SNP locus of the molecular marker.

[0035] The beneficial effects of the present invention are:

[0036] The present invention provides an MNP molecular marker combination for the body height trait of binary hybrid pigs, and designs specific primers that can be used for the early judgment of the body height trait of hybrid pigs. It can achieve precise gene selection, thereby efficiently breeding hybrid pigs with an ideal body shape, realizing rapid and accurate genetic selection in population improvement, accelerating genetic progress, and thus improving economic benefits. It is expected to provide a new tool for the early judgment and evaluation of body height traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is the Manhattan plot of the body height trait of hybrid pigs in GWAS analysis;

[0038] Figure 2 It is the box plot of the body height of 300 Rong-Lai binary hybrid pigs;

[0039] Figure 3 It is the box plot of the body height of 100 6-month-old Rong-Lai binary hybrid pigs. DETAILED DESCRIPTION OF THE INVENTION

[0040] The following describes the specific embodiments of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions made using the concept of the present invention are within the scope of protection.

[0041] Example 1 Development Process of MNP Molecular Marker Combination - Whole Genome Resequencing Library Construction

[0042] In this example, the experimental subjects are Rong-Lai binary hybrid pigs (hereinafter referred to as hybrid pigs) obtained by mating Rongchang pigs and Laiwu pigs, from the National Conservation Farm of Rongchang Pigs in Rongchang District, Chongqing. 300 60-day-old hybrid pigs are randomly selected, with half males and half females.

[0043] In the breeding process of hybrid pigs, regardless of whether Rongchang pigs are used as females or males, the same multi-MNP molecular marker combination can be used to evaluate and identify the body height trait of the obtained Rong-Lai binary hybrid pigs. This is because these molecular markers can stably reflect the genetic information of the body height trait and are not affected by the gender of the parents.

[0044] Collect 5 mL of venous blood from each hybrid pig, extract DNA by the traditional CTAB method, and detect the quality of the extracted genomic DNA with a Nanodrop-ND1000 spectrophotometer. When the A260 / 280 ratio is between 1.8 - 2.0 and the A260 / 230 ratio is around 1.7 - 1.9, it meets the quality standard;

[0045] Dilute the concentration of the qualified DNA samples to 50 ng / μl, and perform low-depth resequencing on each DNA sample using the HiSeq X Ten sequencing platform of Illumina. The average sequencing depth is about 7.8×. Align all the obtained paired-end reads to the 11.1 version of the international pig genome using the BWA software, and then use software such as SAMTools and GATK v4.1.7.0 in sequence to obtain the genotype data of each individual. Use Plink 1.9 to perform quality control on the obtained genotype data, and remove individuals with a minor allele frequency (MAF) < 0.03 and a pedigree Mendelian error rate > 0.1. Use a Hardy-Weinberg equilibrium (HWE) of 1×10-6 as the threshold for quality control. Finally, it is determined that there are 39,082,688 molecular markers in the Rong-Lai hybrid pig population;

[0046] Use the GEMMA (Genome-wide Efficient Mixed Model Association algorithm, version 0.98.3) software to perform genome-wide association analysis. Perform GWAS analysis on the molecular marker information of the Rong-Lai hybrid population obtained by the second-generation resequencing technology and the body height traits of 300 corresponding individuals. The GWAS analysis model is as follows: y = Xβ + Zu + p + e. Among them, y is the phenotypic vector; X is the fixed-effect design matrix, Z is the random-effect design matrix; β is the fixed-effect vector, mainly including the effects of farm, year, and season; p is the covariate, which is the result of the first five PCs; u is the random-effect vector and conforms to u ~ N(0, Gσu2), where G is the genomic relationship matrix; e is the residual vector and conforms to e ~ N(0, Iσ e 2 ), where σ e 2 is the residual variance, and I is the identity matrix.

[0047] Visualize the results of the association analysis through the R software, and the results are as Figure 1 shown. In this study, the Bonferroni method is used to correct multiple hypothesis tests to determine the significantly associated values. Loci with values less than 0.05 / (NSnp) are regarded as genome-level significant loci, and loci with values less than 1 / total SNP number are regarded as chromosome-level significant loci, and the nucleotide sequences shown in SEQ NO.1, SEQ NO.2, and SEQ NO.3 in the sequence listing are obtained.

[0048] For convenience of representation, the combination polymorphism of the MNP molecule with the major allele is called wild type (WT), and the polymorphism with the minor allele is called mutant type (MT). WT / WT means that at this SNP locus, both individuals are wild type and have two major alleles. WT / MT means that at this SNP locus, the individual is heterozygous and has one major allele and one minor allele. MT / MT means that at this SNP locus, both individuals are mutant type and have two minor alleles.

[0049] The vertical distance from the withers to the ground of each hybrid pig was measured using a body height measuring ruler, and the statistical results are shown in Table 1.

[0050] Table 1

[0051] Trait Number of individuals Maximum value Minimum value Average value Standard deviation Coefficient of variation Body height 300 62 46.3 54.04 5.42 10.03％

[0052] Combined with the body height phenotype data, as Figure 2 shown, among 300 Rong-Lai hybrid pigs, the number of individuals with the genotype WT / WT is 158, and the body height phenotype value range is mainly 46 - 54.5 cm; the number of individuals with the genotype WT / MT is 95, and the body height phenotype value range is mainly 54.5 - 60.5 cm; the number of individuals with the genotype MT / MT is 47, and the body height phenotype value range is mainly 60.5 - 65 cm.

[0053] Example 2 Primer Design and Verification

[0054] Specific primers were designed according to the nucleotide sequences obtained in Example 1, and the primer sequences are as follows:

[0055] SEQ NO.1-F: CCCCATGCATCTGCTTCTGTA;

[0056] SEQ NO.1-R: GTGTCTGCTGCTACGGCAA;

[0057] SEQ NO.2-F: GGGGCTTTACCTGGGGAGTTTC;

[0058] SEQ NO.2-R: CAGACCACCTTGCTCCTTTGA;

[0059] SEQ NO.3-F: TCCTCAGCCAGACAAGAAGGA;

[0060] SEQ NO.3-R: GTACCATCTGTTCCTCCCCAC;

[0061] Collect the DNA of 100 60-day-old crossbred pigs to be tested, and perform PCR amplification on the collected DNA template using the above specific primer combination. Specifically: dilute the DNA to 100 ng / μl and dilute the primers to 10 μmol / L; the amplification system is shown in Table 2, and the amplification program is shown in Table 3 to obtain the PCR product; electrophorese the PCR product of the crossbred pigs to be tested on 2% agarose for purification and recovery.

[0062] Table 2

[0063] Component Volume (μl) SYBR 10 Forward primer 1 Reverse primer 1 gDNA 2 <![CDATA[RNase Free H2O]]> 6 Total 20

[0064] Table 3

[0065]

[0066] Statistically analyze the genotypes of the polymorphic sites of the multi-MNP molecular marker combination in the crossbred pigs based on the sequencing results. Among the 100 crossbred pigs tested, the number of pigs with the genotype WT / WT is 53, the number of pigs with the genotype WT / MT is 28, and the number of pigs with the genotype MT / MT is 19.

[0067] Raise the above 100 crossbred pigs under the same conditions until they reach 6 months of age, and carry out the determination of the phenotypic value of body height. The results are as Figure 3 shown. Compare it with the predicted body height range according to the genotype at 60 days of age to verify the accuracy of the multi-MNP molecular marker combination in the early judgment and evaluation of body height traits in Rong-Lai crossbred pigs. As shown in Table 4, among the 100 Rong-Lai crossbred pigs tested, the prediction accuracy rate of the genotype WT / WT is 98.11%, the prediction accuracy rate of the genotype WT / MT is 92.86%, and the prediction accuracy rate of the genotype MT / MT is 94.74%.

[0068] Table 4

[0069] Genotype Number (heads) Number within reference range (heads) Phenotypic value reference range (cm) Accuracy rate (%) WT / WT 53 52 46-54.5 98.11 WT / MT 28 26 54.5-60.5 92.86 MT / MT 19 18 60.5-65 94.74

Claims

1. Use of a reagent for detecting multiple MNP molecular marker combinations for body height traits in dual-cross pigs in the identification and genetic improvement of body height traits in dual-cross pigs and the early prediction of body height traits, characterized in that, The multi-MNP molecular marker combination consists of molecular markers numbered MNP-1, MNP-2, and MNP-3, and the nucleotide sequences of the molecular markers are shown as the nucleotide sequences of SEQ NO.1 to SEQ NO.3 in the sequence listing respectively; The hybrid pigs are two-way hybrid pigs obtained by mating and breeding Rongchang pigs and Laiwu pigs; The molecular marker MNP-1 contains the following four SNP sites: I. The SNP site located at position 37321687 bp on porcine chromosome 10, located at position 131 of the sequence shown in SEQ NO.1, with a polymorphism of T / G; Ii. The SNP site located at position 37321701 bp on porcine chromosome 10, located at position 145 of the sequence shown in SEQ NO.1, with a polymorphism of G / A; Iii. The SNP site located at position 37321909 bp on porcine chromosome 10, located at position 352 of the sequence shown in SEQ NO.1, with a polymorphism of T / G; Iv. The SNP site located at position 37321933 bp on porcine chromosome 10, located at position 377 of the sequence shown in SEQ NO.1, with a polymorphism of G / A; The molecular marker MNP-2 contains the following four SNP sites: a. The SNP site located at position 38648489 bp on porcine chromosome 10, located at position 200 of the sequence shown in SEQ NO.2, with a polymorphism of G / A; b. The SNP site located at position 38648524 bp on porcine chromosome 10, located at position 235 of the sequence shown in SEQ NO.2, with a polymorphism of G / A; c. The SNP site located at position 38648529 bp on porcine chromosome 10, located at position 240 of the sequence shown in SEQ NO.2, with a polymorphism of G / C; d. The SNP site located at position 38648677 bp on porcine chromosome 10, located at position 388 of the sequence shown in SEQ NO.2, with a polymorphism of A / G; The molecular marker MNP-3 includes the following three SNP sites: ①. The SNP site located at position 41505867 bp on porcine chromosome 13, located at position 118 of the sequence shown in SEQ NO.3, with a polymorphism of T / C; ②. The SNP site located at position 41506107 bp on porcine chromosome 13, located at position 358 of the sequence shown in SEQ NO.3, with a polymorphism of A / G; ③. The SNP site located at position 41506113 bp on porcine chromosome 13, located at position 364 of the sequence shown in SEQ NO.3, with a polymorphism of A / G.

2. A primer pair composition for amplifying the multi-MNP molecular marker combination of the body height trait of the binary hybrid pigs described in claim 1, characterized in that, It includes primer pairs for amplifying MNP-1: SEQ NO.1-F: CCCCATGCATCTGCTTCTGTA; SEQ NO.1-R: GTGTCTGCTGCTACGGCAA; Primer pairs for amplifying MNP-2: SEQ NO.2-F: GGGGCTTTACCTGGGGAGTTTC; SEQ NO.2-R: CAGACCACCTTGCTCCTTTGA; Primer pair for amplifying MNP-3: SEQ NO.3-F: TCCTCAGCCAGACAAGAAGGA; SEQ NO.3-R: GTACCATCTGTTCCTCCCCAC.

3. A kit for identifying the body height trait of binary hybrid pigs prepared by using the primer pair composition described in claim 2.

4. A method for identifying and early predicting the body height trait of a binary hybrid pig, characterized in that Comprising the following steps: S1: Extract the genomic DNA of the hybrid pig to be tested; S2: Using the genomic DNA of the hybrid pig to be tested as a template, perform a PCR amplification reaction to obtain a PCR product; S3: Sequence the PCR product to obtain its genotype; S4: Judge the body height trait of the hybrid pig to be tested according to the genotype; The genotype is the polymorphism of eleven SNP sites on the molecular markers MNP-1, MNP-2 and MNP-3 described in claim 1; The hybrid pig is a binary hybrid pig obtained by mating and breeding Rongchang pigs and Laiwu pigs; Individuals of the hybrid pig to be tested with the genotype of the minor allele have better body height traits compared to individuals with the major allele.

5. The method for identifying and early predicting the body height trait of the binary hybrid pigs according to claim 4, wherein The major allele is the allele with a frequency ≥ 90% in the population at the SNP site of the molecular marker, and the minor allele is the allele with a frequency ≤ 10% in the population at the SNP site of the molecular marker.

6. A method for genetic improvement of body height traits in binary hybrid pigs, characterized in that, Comprising the following steps: Sequencing the genome of the hybrid pig to be tested to obtain the genotype of the hybrid pig to be tested, and the genotype is the polymorphism of eleven SNP sites on the molecular markers MNP-1, MNP-2 and MNP-3 described in claim 1; The hybrid pig is a binary hybrid pig obtained by mating and breeding Rongchang pigs and Laiwu pigs; Individual hybrid pigs with polymorphisms showing minor alleles are selected for breeding; the minor allele is the allele with a frequency ≤ 10% in the population at the SNP site of the molecular marker.

Images