Molecular marker of wheat gibberellic disease-resistant gene TaWRKY57 and application of molecular marker

Abstract

The invention belongs to the field of crop breeding science, and discloses a molecular marker of a wheat gibberellic disease resistant gene TaWRKY57 and application of the molecular marker. The invention discloses a CAPS (cleaved amplified polymorphic sequence) marker primer pair of a candidate gene TaWRKY57 of a wheat gibberellic disease resistant gene Qfhi.nau-5B, which comprises WGRB4579-F and WGRB4579-R. After the primer pair is used for carrying out PCR (polymerase chain reaction) amplification and enzyme digestion on wheat variety genome DNA (deoxyribonucleic acid), if three specific fragments with the sizes of 126bp, 135bp and 182bp are obtained, the material is proved to carry the gibberellic disease resistant gene TaWRKY57. The marker has the characteristics of rapidness, accuracy and high efficiency, can be used for determining whether Qfhi.nau-5B exists or not and determining the existence state of Qfhi.nau-5B and predicting the gibberellic disease resistance of wheat, and provides a molecular marker auxiliary means for rapidly screening plants carrying Qfhi.nau-5B and breeding disease-resistant varieties.

Description

Technical Field

[0001] The invention belongs to the field of crop breeding and relates to a molecular marker for detecting a wheat scab resistance gene Qfhi.nau-5B candidate gene TaWRKY57 and an application thereof. Background Art

[0002] Wheat fusarium head blight, caused by the facultative parasitic fungus Fusarium, is one of the main diseases in wheat production. It not only causes serious yield losses, but also leads to a decline in grain quality and produces a variety of harmful fungal toxins such as deoxynivalenol (DON) in the grains, which endangers the health of humans and animals (Kazan et al. 2018). In recent years, with the influence of global warming and changes in farming methods, wheat fusarium head blight has become more prevalent (Savary et al. 2019). The area of ​​wheat fusarium head blight in my country has increased from an average annual area of ​​about 60 million mu from 2001 to 2010 to an average annual area of ​​about 73 million mu from 2011 to 2020, an increase of 21.7% in ten years, causing an average annual direct economic loss of tens of billions of yuan, and has become the most serious disease affecting my country's wheat production. Cultivating varieties that show stable and lasting resistance to fusarium head blight is the most economical and effective means to prevent and control fusarium head blight and reduce the damage caused by fusarium head blight.

[0003] Discovering and using disease-resistant genes to breed disease-resistant varieties can effectively reduce the harm of Fusarium head blight to wheat production. However, there are not many applicable genes at present. In common wheat, only Fhb1, Fhb2, Fhb4, Fhb5, etc. have breeding applications. In addition, most QTLs lack tight linkage or diagnostic molecular markers and are basically not used (Ma et al. 2020). Qfhi.nau-5B is a Fusarium head blight resistance QTL located in the WMC75-BARC142 interval of chromosome 5B, which can explain 8.8% of the phenotypic variation (Li et al. 2008). The cloning of candidate genes for this QTL and the development of molecular markers can provide important genetic resources and technical support for molecular breeding of Fusarium head blight resistance. Summary of the invention

[0004] The object of the present invention is to provide a diagnostic molecular marker for detecting wheat fusarium head blight resistance gene Qfhi.nau-5B candidate gene TaWRKY57 in view of the deficiencies of the prior art.

[0005] Another object of the present invention is to provide an application of a molecular marker of the Qfhi.nau-5B candidate gene TaWRKY57.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0007] In the first aspect, the present invention firstly protects a primer pair for detecting a molecular marker of a wheat scab resistance gene Qfhi.nau-5B candidate gene TaWRKY57:

[0008] WGRB4579-F: CCCATGTCAAAGGAAACG, as shown in SEQ ID NO.1, WGRB4579-R: TTCGGGGTATATGCATACG, as shown in SEQ ID NO.2.

[0009] In the second aspect, the present invention protects a molecular marker for detecting the candidate gene TaWRKY57 of wheat fusarium head blight resistance gene Qfhi.nau-5B:

[0010] The wheat variety genomic DNA was amplified using the marker primer pair WGRB4579-F: SEQ ID NO.1, WGRB4579-R: SEQ ID NO.2, and the amplified product was digested with restriction endonucleases. If the digested fragments were 126 bp, 135 bp and 182 bp, they were the diagnostic molecular marker WGRB4579 of the wheat ergot resistance gene Qfhi.nau-5B candidate gene TaWRKY57. The marker was a codominant marker and was tightly linked to Qfhi.nau-5B. The genetic distance between the marker and the Qfhi.nau-5B gene was measured to be 0 cM using Mapmaker Macintosh V 3.0.

[0011] In a third aspect, the present invention also protects a reagent containing the primer pair described above, and / or the molecular marker described above.

[0012] In a fourth aspect, the present invention also protects a kit containing the primer pair described above, and / or the molecular marker described above, and / or the molecular marker described above.

[0013] In the fifth aspect, the present invention also protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent described above, and / or the kit described above in the identification of the ergot resistance gene Qfhi.nau-5B in wheat germplasm resources.

[0014] In the sixth aspect, the present invention also protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent described above, and / or the kit described above in the preparation of a product for identifying the ergot resistance gene Qfhi.nau-5B in wheat germplasm resources.

[0015] In a specific embodiment, the product is a system comprising the primer pair of claim 1, and / or the molecular marker of claim 2, and / or the reagent of claim 3, and / or the kit of claim 4.

[0016] In the seventh aspect, the present invention also protects a molecular marker method for the wheat ergot resistance gene Qfhi.nau-5B. If the WGRB4579-F and WGRB4579-R of the molecular marker WGRB4579 are used to PCR amplify the genomic DNA of the wheat to be tested, and the amplified product is digested with a restriction endonuclease, if the digested fragments are 126bp, 135bp and 182bp, it indicates that the wheat to be tested contains the ergot resistance gene Qfhi.nau-5B.

[0017] In an eighth aspect, the present invention also protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent described above, and / or the kit described above in screening wheat materials resistant to ergot disease.

[0018] In a specific implementation scheme, the genomic DNA of the wheat to be tested is amplified by PCR using the primer pairs described above, and the amplified product is digested with restriction endonucleases. If the digested fragments are 126bp, 135bp and 182bp, it indicates that the wheat to be tested is resistant to ergot disease and contains the ergot disease resistance gene Qfhi.nau-5B.

[0019] In a ninth aspect, the present invention also protects the use of the primer pair described above in cloning the ergot resistance gene TaWRKY57.

[0020] In a tenth aspect, the present invention also protects the use of the primer pair described above, and / or the molecular marker described above, and / or the reagent or kit described above in breeding wheat resistant to ergot.

[0021] The molecular marker of the wheat scab resistance gene TaWRKY57 was obtained by the following method:

[0022] (I) Wangshuibai and its cyclic parent PH691 BC3F 2：3 Creation of colony and screening of Qfhi.nau-5B segment recombinants:

[0023] (1) Wangshuibai (♀) was crossed with wheat variety PH691 (♂) to obtain hybrid F1, which was backcrossed with PH691 for three generations and then self-pollinated to produce a BC3F2 population;

[0024] (2) The boundary marker of Qfhi.nau-5B was used to screen heterozygous plants that underwent recombination in this segment in the BC3F2 population, and the same marker was used to screen homozygous plants that underwent recombination in this segment in the BC3F3 generation.

[0025] (II) Identification of disease resistance phenotype of recombinants

[0026] (3) About ten days before the recombinant blooms, the infected wheat kernels are sown in the field for inoculation, and the process is repeated one week later. The diseased spikelet rate is investigated 15 days after inoculation to evaluate its resistance;

[0027] (III) Molecular marker analysis

[0028] (4) The DNA of the disease-resistant parent Wangshuibai, the susceptible parent PH691, and each individual plant in the F2 population was extracted using the SDS method. Molecular markers were developed using sequences located on chromosome 5B of the Chinese spring reference genome, and polymorphism and specificity analyses were performed on Wangshuibai and PH691.

[0029] (5) Select molecular markers that are polymorphic between the parents, amplify them in the F2 generation population to obtain the genotype data of each individual plant in the population, and use these markers to detect the genotype of each individual plant in the F3 family of heterozygous recombinant offspring;

[0030] The PCR reaction system was 12.5 μl, including 10× buffer 1.25 μl, 25 mM MgCl2 0.75 μl, 2.5 mM dNTPs 1 μl, 0.2 μM left and right primers, 0.1 μl Taq enzyme (5 u / μl), 10 ng template DNA, and water was added to 12.5 μl;

[0031] The PCR amplification program was 94°C pre-denaturation for 5 min, 94°C denaturation for 30 sec, 55°C annealing for 40 min, 72°C extension for 30 min, 36 cycles, and finally 72°C extension for 10 min; PCR amplification was performed on a PE9600 thermal amplification instrument.

[0032] The enzyme digestion reaction system is 10 μl, including 1 μl of 10× buffer, 0.1 μl of NIalll restriction endonuclease (5u / μl), 4 μl of PCR product, and water is added to 10 μl.

[0033] The enzyme-digested products were separated by electrophoresis on 8% non-denaturing polyacrylamide gel, and then photographed on an ultraviolet transilluminator to record the results.

[0034] (IV) Obtaining the positioning interval

[0035] (6) According to the law of linkage and exchange, combined with the genotype data of each individual plant in the F2 generation population and the field disease resistance phenotype of the heterozygous recombinant F3 family, the genetic linkage map of Qfhi.nau-5B was constructed using the software Mapmaker Macintosh V3.0, and the location interval of Qfhi.nau-5B was narrowed down to between the molecular markers WMC75 and WGRB4677.

[0036] (V) Development and validation of TaWRKY57-CAPS marker

[0037] (7) Through the prediction and sequence alignment analysis of disease resistance candidate genes in the positioning interval, combined with the RNA-seq data and resequencing data of Wangshuibai and PH691 ear-inoculated Gibberella, WRKY 57 was selected as the candidate gene of Qfhi.nau-5B.

[0038] (VI) Development and verification of markers

[0039] Based on the difference of SNP in the coding region of TaWRKY57, a CAPS marker was developed, named WGRB4579, including forward primers WGRB4579-F: as shown in SEQ ID NO.1, and WGRB4579-R: as shown in SEQ ID NO.2. According to the law of linkage exchange, combined with the genotype data of each individual plant in the F2 generation population and the field disease resistance phenotype of the heterozygous recombinant F3 family (Table 1), the genetic linkage map of Wangshuibai Qfhi.nau-5B was constructed using the software Mapmaker Macintosh V3.0, and it was determined that the molecular marker WGRB4579 and the Qfhi.nau-5B gene were co-segregated. The band pattern amplified by the WGRB4579 molecular marker primer is shown in Figure 1 .

[0040] Beneficial Effects

[0041] The present invention obtains a molecular marker WGRB4579 for detecting the candidate gene TaWRKY57 of Qfhi.nau-5B. Further experiments have proved that the marker of the present invention can be used for molecular marker-assisted selection breeding of Fusarium head blight resistance. The present invention provides a good tool for accelerating the effective use of Qfhi.nau-5B in breeding.

[0042] 1. The diagnostic molecular marker WGRB4579 of the Qfhi.nau-5B candidate gene TaWRKY57 was obtained, which can help transfer the gene to promoted varieties and aggregate with other disease resistance genes.

[0043] 2. Easy identification. This marker is a co-dominant marker with the advantages of easy detection and stable amplification. Using marker WGRB4579 to detect the presence and state of Qfhi.nau-5B, and predict wheat resistance to fusarium head blight, and then quickly screen plants carrying Qfhi.nau-5B for breeding of disease-resistant varieties. In addition, laboratory testing using this molecular marker can avoid the impact of the environment on the variety.

[0044] 3. Improve the efficiency of disease-resistant variety selection and identification, and save costs. Traditional breeding for resistance to ergot is time-consuming, labor-intensive, difficult, and costly. By detecting the diagnostic molecular marker of the ergot resistance gene Qfhi.nau-5B, individual plants carrying the disease-resistant gene Qfhi.nau-5B can be identified at the seedling stage, and non-target plants can be eliminated, greatly reducing the phenotypic identification work, saving breeding costs, and improving the selection efficiency of disease-resistant varieties.

[0045] 4. It can be used to clone the ergot resistance gene Qfhi.nau-5B. The prerequisite for map-based cloning of the ergot resistance gene Qfhi.nau-5B is the determination of candidate genes. WRKY 57 is the main candidate gene of Qfhi.nau-5B obtained after combining expression analysis, sequence analysis, and natural population verification. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the specific implementation manner of the present invention or the technical solution in the prior art, the drawings required for describing the specific implementation manner are briefly introduced below.

[0047] Figure 1 The location of wheat fusarium head blight resistance QTL Qfhi.nau-5B on chromosome 5BL and its genetic linkage map with the marker WGRB4579 of the present invention. The right side of the figure shows the markers, and the left side shows the genetic distance between the markers.

[0048] Figure 2 Banding pattern of WGRB4579 amplification. M is PUC19 / MspI, and the left side is the molecular weight marker band size (bp). 1 is Wangshuibai, 2 is PH691, 1, 3, 4, 7, 8, 11 are disease-resistant genotype strains, and 2, 5, 6, 9, 10, 12 are disease-susceptible genotype strains. The arrows point to the specific enzyme digestion bands of the disease-resistant allele.

[0049] Figure 3 The ergot resistance phenotypes of the near-isogenic lines Qfhi.nau-5B and its recurrent parent PH691 in different environments. 5B-R35 and 5B-R37 are near-isogenic lines of Qfhi.nau-5B. *, *, and * indicate significant differences compared with the recurrent parent at P = 0.01 and 0.001 levels, respectively. DETAILED DESCRIPTION

[0050] The present invention will be further described in detail below in conjunction with the embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and the scope of protection of the present invention cannot be limited thereto. The reagents or instruments used that do not indicate the manufacturer are deemed to be conventional products that can be purchased on the market. As a professional agricultural research institution, the applicant has long-term storage of relevant germplasm materials, and the relevant wheat varieties are publicly available in the market or existing germplasm banks.

[0051] Example 1 Acquisition of molecular markers for wheat scab resistance gene TaWRKY57

[0052] (I) Wangshuibai and its cyclic parent PH691 BC3F 2：3 Creation of colony and screening of Qfhi.nau-5B segment recombinants:

[0053] (1) Wangshuibai (♀) was crossed with wheat variety PH691 (♂) to obtain hybrid F1, which was backcrossed with PH691 for three generations and then self-pollinated to produce a BC3F2 population containing 461 plants;

[0054] (2) Using the boundary markers WMC75 and BARC42 of Qfhi.nau-5B, 69 heterozygous strains that underwent recombination in this segment were screened. Further, 13 homozygous recombinants were screened from the progeny of some heterozygous recombinants. Genotypic analysis showed that these recombinants could be divided into seven recombination types.

[0055] (II) Identification of disease resistance phenotype of recombinants

[0056] About ten days before the recombinants bloomed, susceptible wheat kernels were sown in the field to inoculate these homozygous recombinants, and the same was repeated one week later. The diseased spikelet rate was investigated 15 days after inoculation, and the diseased kernel rate was investigated after harvest. The identification results showed that the resistance of these recombinants was obvious, and the strains carrying the Qfhi.nau-5B gene had significantly improved resistance compared with the susceptible parent (Table 1).

[0057] (III) Screening of polymorphic molecular markers and analysis of recombinant genotypes

[0058] (1) The developed markers were screened for polymorphism in Wangshuibai and PH691, and ultimately two molecular markers with polymorphism between the parents were obtained, namely GWM408 and WGRB4677.

[0059] (2) The genotypes of homozygous recombinants were analyzed using molecular markers GWM408 and WGRB4677 that were polymorphic between the parents.

[0060] The PCR reaction system was 12.5 μl, including 10× buffer 1.25 μl, 25 mM MgCl2 0.75 μl, 2.5 mM dNTPs 1 μl, 0.2 μM left and right primers, 0.1 μl Taq enzyme (5 u / μl), 10 ng template DNA, and water was added to 12.5 μl;

[0061] The PCR amplification program was 94°C pre-denaturation for 5 min, followed by 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 30 sec, 36 cycles, and finally 72°C extension for 10 min; PCR amplification was performed on a PE9600 thermal amplification instrument.

[0062] The enzyme digestion reaction system is 10 μl, including 1 μl of 10× buffer, 0.1 μl of NIalll restriction endonuclease (5u / μl), 4 μl of PCR product, and water is added to 10 μl.

[0063] The enzyme-digested products were separated by electrophoresis on 8% non-denaturing polyacrylamide gel, and then photographed on an ultraviolet transilluminator to record the results.

[0064] (IV) Qfhi.nau-5B positioning interval acquisition

[0065] The genetic linkage map of Wangshuibai Qfhi.nau-5B was constructed using Mapmaker Macintosh V3.0 software. According to the linkage exchange rule, combined with the genotype data of each individual plant in the F2 generation population and the field disease resistance phenotype of the heterozygous recombinant F3 family (Table 1), Qfhi-nau-5B was accurately located between the WMC75-WGRB4677 markers.

[0066] (V) Prediction and sequence alignment of disease resistance candidate genes within the localization interval

[0067] Prediction and sequence alignment of disease resistance candidate genes in the positioning interval. By analyzing the RNA-seq data of Wangshuibai and PH691 spike-inoculated Gibberella, it was found that there was a disease resistance-related gene WRKY57 in the interval. The expression in Wangshuibai was upregulated and the expression level was twice that of PH691. Comparing the second-generation sequencing data of Wangshuibai and PH691, the gene had variations in both the promoter and coding regions. WRKY57 is an important transcription factor involved in a variety of resistance reactions. WRKY57 can participate in Arabidopsis resistance to Botrytis cinerea by affecting the expression of jasmonic acid ZIM domain genes. Therefore, WRKY57 was selected as the main candidate gene for Qfhi.nau-5B, and the CAPS marker WGRB4579 was developed based on the sequence variation of the coding region (G / A at position 763).

[0068] Table 1 Wangshuibai-PH691 BC3F 2:3Genotypes and phenotypes of homozygous recombinants in the population

[0069]

[0070]

[0071] *Indicates significant difference compared with other recombinant types at 0.05 level

[0072] Example 2 Verification of molecular markers of wheat scab resistance gene TaWRKY57 in wheat variety populations

[0073] WGRB4579 molecular marker was used to genotype 279 wheat germplasm resources from different wheat regions in my country. There were 125 materials carrying the TaWRKY57 disease resistance haplotype and 154 materials not carrying the TaWRKY57 disease resistance haplotype. Using the infection resistance phenotype analysis in 2016 and 2024, the average diseased spikelet rates of materials not carrying the TaWRKY57 disease resistance haplotype were 43.1% and 22.3%, respectively, and the average diseased spikelet rates of materials carrying the TaWRKY57 disease resistance haplotype were 32.3% and 16.0%, respectively, with significant differences in resistance between the two. Compared with materials not carrying the TaWRKY57 disease resistance haplotype, the diseased spikelet rates of materials carrying the TaWRKY57 disease resistance haplotype decreased by 25.1% and 28.3%, which confirmed that the WGRB4579 molecular marker was significantly correlated with Fusarium head blight resistance.

[0074] Example 3 Application of molecular markers in wheat breeding for resistance to scab

[0075] The WGRB4579 molecular marker was used to select Qfhi.nau-5B in the BC3F2 population of 19 plants obtained by hybridization of Wangshuibai (♀) and PH691 (♂), and 4 plants homozygous for the Wangshuibai genotype in the Qfhi.nau-5B segment were selected for background recovery rate detection. A total of 96 pairs of SSR markers distributed on 21 chromosomes were selected to detect the background recovery rate of the above-mentioned plants, and finally 2 plants with background recovery rates of 97% and 98% were selected for self-pollination to obtain near-isogenic lines 5B-R-3 and 5B-R-5. The resistance effect of the constructed near-isogenic lines against Fusarium head blight infection was evaluated under two environments (see Example 1). The results showed that the disease resistance of the constructed near-isogenic lines was significantly improved. Compared with the susceptible control PH691, the near-isogenic lines could reduce the diseased spikelet rate by 25.3-41.7%. This shows that the WGRB4579 molecular marker can be effectively used to select the ergot resistance gene Qfhi.nau-5B, and has great application value in breeding applications.

[0076] The primer sequences involved in the experiment are as follows:

[0077] The left primer of WGRB4579, WGRB4579-F: CCCATGTCAAAGGAAACG, as shown in SEQ ID NO: 1. The right primer of WGRB4579, WGRB4579-R: TTCGGGGTATATGCATACG, as shown in SEQ ID NO: 2.

[0078] The left end primer of WMC75 is WMC75-F: GTCCGCCGCACACATCTTACTA, as shown in SEQ ID NO:3.

[0079] The right primer WMC75-R of WMC75: GTTTGATCCTGCGACTCCCTTG, as shown in SEQ ID NO: 4. The left primer GWM408-F of GWM408: TCGATTTATTTGGGCCACTG, as shown in SEQ ID NO: 5. The right primer GWM408-R of GWM408: GTATAATTCGTTCACAGCACGC, as shown in SEQ ID NO: 6. The left primer WGRB4677-F of WGRB4677: CCAAACCCCAAGGTCTCG, as shown in SEQ ID NO: 7. The right primer WGRB4677-R of WGRB4677: TGGTGACATAGGGGGAAAAT, as shown in SEQ ID NO: 8.

[0080] The left primer of BARC142, BARC142-F: CCGGTGAGAGGACTAAAA, as shown in SEQ ID NO: 9. The right primer of BARC142, BARC142-R: GGCCTGTCAATTATGAGC, as shown in SEQ ID NO: 10.

[0081] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A primer pair for molecular marker of wheat fusarium head blight resistance gene Qfhi.nau-5B candidate gene TaWRKY57, characterized in that: The primer pair is selected from the following: WGRB4579-F: as shown in SEQ ID NO.1, WGRB4579-R: as shown in SEQ ID NO.

2.

2. The molecular marker of wheat fusarium head blight resistance gene Qfhi.nau-5B candidate gene TaWRKY57 is characterized by: The genomic DNA of a wheat variety is amplified using the primer pair described in claim 1, and the amplified product is digested with a restriction endonuclease, and electrophoresis separation shows a 449bp band, or the digestion product shows three bands of 126bp, 135bp and 182bp; the marker WGRB4579 is a diagnostic molecular marker of the wheat ergot resistance gene Qfhi.nau-5B candidate gene TaWRKY57, and the marker is a co-dominant marker.

3. A reagent or kit comprising the primer pair according to claim 1 and / or the molecular marker according to claim 2.

4. A kit comprising the primer pair according to claim 1, and / or the molecular marker according to claim 2, and / or the reagent according to claim 3.

5. Use of the primer pair described in claim 1, and / or the molecular marker described in claim 2, and / or the reagent described in claim 3, and / or the kit described in claim 4 in detecting or assisting in detecting whether wheat germplasm resources have the ergot resistance gene Qfhi.nau-5B.

6. Use of the primer pair according to claim 1, and / or the molecular marker according to claim 2, and / or the reagent according to claim 3, and / or the kit according to claim 4 in preparing a product for identification or auxiliary identification of the fusarium head blight resistance gene Qfhi.nau-5B in wheat germplasm resources; Preferably, the product is a system comprising the primer pair according to claim 1, and / or the molecular marker according to claim 2, and / or the reagent according to claim 3, and / or the kit according to claim 4.

7. A method for identifying a wheat ergot resistance gene Qfhi.nau-5B candidate gene TaWRKY57, comprising: using the primer pair described in claim 1 to PCR amplify the wheat genomic DNA to be tested, and using the restriction endonuclease NIalll to digest the amplified product. If the digested fragments are 126 bp, 135 bp and 182 bp, the wheat variety to be tested has the ergot resistance gene Qfhi.nau-5B; if the digested fragments are 182 bp and 261 bp, the wheat variety to be tested does not contain the ergot resistance gene Qfhi.nau-5B.

8. The use according to claim 7, characterized in that: The genomic DNA of the wheat to be tested is amplified using the primer pair described in claim 1, and the amplified product is digested with a restriction endonuclease. If the digested fragments are 126bp, 135bp and 182bp, it indicates that the wheat to be tested is ergot resistant wheat with the ergot resistance gene Qfhi.nau-5B.

9. Use of the primer pair according to claim 1 in cloning the fusarium head blight resistance gene Qfhi.nau-5B.

10. Use of the primer pair according to claim 1, and / or the molecular marker according to claim 2, and / or the reagent according to claim 3, and / or the kit according to claim 4 in breeding wheat resistant to ergot.

Images