DCAPS molecular marker for identifying green fruit shoulder of eggplant and application of dCAPS molecular marker

Abstract

The invention discloses a dCAPS molecular marker for identifying a green fruit shoulder of an eggplant, the nucleotide sequence of the dCAPS molecular marker is as shown in SEQ ID NO.1, and the 25th Y of the sequence represents polymorphism and is T or C. The dCAPS molecular marker is a dCAPS molecular marker for identifying the green fruit shoulder of the eggplant. The molecular marker disclosed by the invention can be used for identifying and screening the eggplant green fruit shoulder phenotype, and can be used for rapidly, accurately and effectively breeding eggplant varieties with eggplant green fruit shoulder characteristics, so that the crop breeding process is accelerated, and the breeding efficiency and success rate are improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a dCAPS molecular marker for identifying green shoulder of eggplant and application thereof. Background Art

[0002] Eggplant (Solanum melongena L., 2n = 24) is a vegetable of the Solanaceae family with important economic and nutritional value. It originated in Asia and is cultivated all over the world. my country is the largest producer of eggplant, with a planting area of ​​818,000 hectares and a production of 38.319 million tons in 2022, accounting for 43.23% and 64.60% of the world respectively (FAO, 2022). It is generally believed that my country is the second origin and secondary evolution center of eggplant, with rich germplasm resources. In nature, most eggplant fruits have purple, green, white and other colors on the skin, but eggplants with fruit shoulders are not very common. Striped patterns enhance the attractiveness of pollinators and contribute to species diversity, and in production, they directly affect consumer preferences. The formation of eggplant fruit shoulders is mainly caused by the uneven distribution of anthocyanins, chlorophyll and carotenoids. Eggplant fruit appearance is a key commodity trait, so the precise selection of excellent new varieties with unique appearance is in line with current breeding goals.

[0003] The emergence of molecular markers has provided a new breeding approach for eggplant, which helps to breed better varieties. The development of molecular markers that are co-segregated or tightly linked with the target trait and stable, and easy and quick to detect, can greatly improve the accuracy and efficiency of selection in breeding and significantly shorten the breeding cycle, but the key is to develop efficient molecular markers, which is of great significance for eggplant variety improvement and new variety breeding.

[0004] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0005] The purpose of the present invention is to provide a dCAPS molecular marker for identifying green shoulder of eggplant and application thereof. The green shoulder of eggplant can be identified quickly and accurately by using the primer.

[0006] To achieve the above object, the present invention provides a dCAPS molecular marker for identifying green shoulder of eggplant. The nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO.1. The 25th Y of the sequence represents a polymorphism, which is T or C.

[0007] The dCAPS molecular marker SEQ ID NO.1 is as follows:

[0008] AACCTCCATCAATTGACAGTGAGTYGAAGGAATTACAACGTCATGAAATTACCAAAATACCCCCAACTTAATTTTATAATAATTTTAAGATATTTATTTTTCAAGGATTTTTTTGAATAAAACTTTTAAATTCAACGATATTTCTTGTACTTGATCTATATCTATAGATGAACTCAAATCATCTAAAGAAAAGGAATGG

[0009] A dCAPS molecular marker for identifying green shoulder of eggplant, wherein a 199 bp band is amplified using a dCAPS molecular marker primer pair in eggplant genomic DNA, wherein the amplified band of the green shoulder variety is digested with HinfI to obtain a main band of 174 bp, and the amplified band of the pure green skin variety is digested with HinfI to obtain a main band of 199 bp;

[0010] The nucleotide sequence of the upstream primer of the dCAPS molecular marker primer pair is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0011] SEQ ID NO.2, F: 5'-AACCTCCATCAATTGACAGTGAGT-3';

[0012] SEQ ID NO. 3, R: 5'-CCATTCCTTTTCTTTAGATGATTTG-3'.

[0013] A specific primer pair for detecting the dCAPS molecular marker according to claim 1 or 2, wherein the upstream primer nucleotide sequence of the specific primer pair is shown as SEQ ID NO.2, and the downstream primer nucleotide sequence is shown as SEQ ID NO.3.

[0014] A kit containing the specific primer pair described above.

[0015] Preferably, in the above technical solution, the kit contains HinfI enzyme.

[0016] The use of the above-mentioned specific primer pair or the above-mentioned kit in identifying eggplant green shoulder varieties.

[0017] Preferably, in the above technical solution, the application of dCAPS molecular markers for identifying green shoulder of eggplant includes:

[0018] (1) Application in identifying green shoulder of eggplant;

[0019] (2) Application in molecular marker-assisted breeding of green fruit shoulders in eggplant.

[0020] A method for identifying green shoulder of eggplant comprises the following steps:

[0021] (1) using the DNA of the eggplant material to be tested as a template, and performing PCR amplification using the specific primer pair shown in SEQ ID NO. 2-3 to obtain a PCR product;

[0022] (2) The PCR amplification product is digested with HinfI enzyme, the digestion product is subjected to polyacrylamide gel electrophoresis, and the electrophoresis detection result is observed.

[0023] Preferably, in the above technical solution, the PCR reaction system in step (1) is: in a 12 μL reaction system, 2 μL of DNA template solution, 5 μL of 2×Taq Mix, 1 μL of forward primer and reverse primer each with a concentration of 10 uM / L, and 3 μL of ddH 2 OFill the total volume to 12 μL;

[0024] PCR amplification reaction program: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 5 min;

[0025] The gel in step (2) is 8% non-denaturing polyacrylamide gel.

[0026] Reaction system: Hinf I 1 μL, 10×H Buffer 2 μL, DNA ≤ 1 μg, ddH 2 O to make up the total volume to 20 μL. Reaction conditions: Enzyme digestion at 37°C for 1 h.

[0027] Preferably, in the above technical solution, the method for determining the electrophoresis detection result in step (2) is:

[0028] After HinfI digestion, if the digestion product contains a 174 bp main band, it means that the eggplant sample to be tested is a green shoulder variety;

[0029] After HinfI digestion, if the digestion product contains a 199 bp main band, it means that the eggplant sample to be tested is a pure green peel variety;

[0030] After HinfI digestion, if the digestion product contains two main bands of 199 bp and 174 bp, it means that the eggplant sample to be tested is heterozygous.

[0031] Compared with the prior art, the present invention has the following beneficial effects: the dCAPS molecular marker primers and their application for identifying green shoulder of eggplant are used to identify green shoulder of eggplant by using the parent GS-01, WGS-02 and its F 1The developed dCAPS markers were screened for polymorphism. After screening, it was found that the molecular marker GS-dCm4.02-2 had stable polymorphism between the parents. 1 The test results show that GS-dCm4.02-2 is a dominant marker, and the product amplified by the marker has a clear band after HinfI digestion, and the difference between the parents is obvious. According to the dCAPS molecular marker, dCAPS molecular marker primers are designed, PCR amplification is performed, and the test results are observed to identify the green shoulder of eggplant. The molecular marker of the present invention can be used for the identification and screening of the green shoulder phenotype of eggplant, and eggplant varieties with the green shoulder characteristics of eggplant can be bred quickly, accurately and effectively, accelerating the crop breeding process and improving the efficiency and success rate of breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The invention relates to a dCAPS molecular marker primer for the green shoulder eggplant inbred line GS-01, the pure green skin eggplant inbred line WGS-02 and its F 1 The electrophoresis diagram of the amplified product and the digested product in the generation; 1 GS-01;P 2 WGS-02; F 1 It is the hybrid of GS-01 and WGS-02.

[0033] Figure 2 It is an electrophoresis diagram of the verification result of the dCAPS molecular marker primer according to the present invention in detecting 22 eggplant germplasm materials with known fruit skin with / without green shoulder phenotype. DETAILED DESCRIPTION

[0034] The specific implementation modes of the present invention are described in detail below in conjunction with the accompanying drawings, but it should be understood that the protection scope of the present invention is not limited by the specific implementation modes.

[0035] Unless explicitly stated otherwise, throughout the specification and claims, the term “comprise” or variations such as “include” or “comprising”, etc., will be understood to include the stated elements or components but not to exclude other elements or components.

[0036] 1. Acquisition of Molecular Markers

[0037] 1. Construction of positioning groups

[0038] The high-generation inbred lines GS-01 and WGS-02 were selected as female parents (P 1 ) and the male parent (P 2 ), construct genetically isolated populations (F 1 , B.C. 1 P 1 , B.C.1 P 2 and F 2 GS-01 has round fruits with green shoulders, while WGS-02 has long fruits with pure green skin. 1 Plants self-pollinated to construct F 2 The CTAB method was used to isolate high-quality genomic DNA from leaves.

[0039] 2. Molecular marker development

[0040] Based on the eggplant T2T genome assembled by our research group, we precisely located the candidate gene Eggplant.04G07850 that controls the green shoulder of eggplant. According to the BSA-seq results, primers were designed and PCR amplified at the stable variant sites in the Eggplant.04G07850 gene sequence to develop dCAPS markers.

[0041] 3. Obtaining the molecular marker GS-dCm4.02-2

[0042] Using the parents GS-01, WGS-02 and their F 1 The developed dCAPS markers were screened for polymorphism. After screening, it was found that the molecular marker GS-dCm4.02-2 had stable polymorphism between the parents. 1 The test results showed that GS-dCm4.02-2 was a dominant marker, and the product amplified by the marker had a clear band after HinfI digestion, with obvious differences between the two parents ( Figure 1 ). 1 GS-01;P 2 WGS-02; F 1 It is the hybrid of GS-01 and WGS-02.

[0043] Design of primer pair for molecular marker GS-dCm4.02-2:

[0044] SEQ ID NO.2, F: 5'-AACCTCCATCAATTGACAGTGAGT-3';

[0045] SEQ ID NO. 3, R: 5'-CCATTCCTTTTCTTTAGATGATTTG-3'.

[0046] The PCR amplification product based on this primer pair is 199 bp, as shown in SEQ ID NO.1. The 25th position of the sequence is T / C, which is a polymorphic site. According to the recognition sequence 5'-GANTC-3' / 5'-CTNAG-3' of the restriction endonuclease Hinf I, if the SNP site is T, it cannot be cut by the enzyme; if the SNP site is C, it can be cut by the enzyme.

[0047] like Figure 1 It showed that before HinfI digestion, the molecular marker GS-dCm4.02-2 was 1 The amplified products were all 199 bp fragments. After HinfI digestion, the product in the green-shouldered eggplant inbred line GS-01 was a 174 bp fragment, the product in the pure green-skinned eggplant inbred line WGS-02 was a 199 bp fragment, and the product in the parental hybrid F 1 The products of the next generation contained fragments of 199 bp and 174 bp in size.

[0048] The nucleotide sequence molecular marker SEQ ID NO.1 of dCAPS is as follows. The 25th Y in the sequence represents a polymorphism, which is T or C.

[0049] AACCTCCATCAATTGACAGTGAGTYGAAGGAATTACAACGTCATGAAATTACCAAAATACCCCCAACTTAATTTTATAATAATTTTAAGATATTTATTTTTCAAGGATTTTTTTGAATAAAACTTTTAAATTCAACGATATTTCTTGTACTTGATCTATATCTATAGATGAACTCAAATCATCTAAAGAAAAGGAATGG

[0050] 2. Application of molecular marker GS-dCm4.02-2

[0051] 1. Test materials

[0052] The present invention uses 7 eggplant germplasms with green peels and 15 eggplant germplasms with pure green peels to verify the molecular marker GS-IDm4.02-2. The germplasm materials used can be obtained from the Agricultural College of Guangxi University.

[0053] 2. Test methods

[0054] A method for identifying green shoulder of eggplant comprises the following steps:

[0055] (1) using the DNA of the eggplant material to be tested as a template, and performing PCR amplification using the specific primer pair shown in SEQ ID NO. 2-3 to obtain a PCR product;

[0056] (2) The PCR amplification product is digested with HinfI enzyme, the digestion product is subjected to polyacrylamide gel electrophoresis, and the electrophoresis detection result is observed.

[0057] Specifically, the molecular marker GS-dCm4.02-2 was used to perform genotype detection on the above test materials, and the template was the genomic DNA of the above test materials.

[0058] PCR reaction system (12 μL): 2 μL DNA template solution, 5 μL 2× Taq Mix, 1 μL each of forward primer and reverse primer (concentration is 10uM / L), 3 μL ddHO 2 O to make up the total volume to 12 μL. PCR amplification reaction program: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 5 min.

[0059] Subsequently, the amplified products were electrophoresed on 8% non-denaturing polyacrylamide gel, stained with 1% silver nitrate for 5 minutes, and then developed with a mixture of sodium hydroxide and formaldehyde, and finally observed and photographed. When the electrophoresis gel map was read, the same band type as 'GS-01' was recorded as 'b', the same band type as 'WGS-02' was recorded as 'a', and the hybrid containing both parental band types was recorded as 'h'.

[0060] Reaction system: Hinf I 1 μL, 10×H Buffer 2 μL, DNA ≤ 1 μg, ddH 2 O to make up the total volume to 20 μL. Reaction conditions: Enzyme digestion at 37°C for 1 h.

[0061] 3. Test results

[0062] The electrophoresis results are as follows Figure 2 As shown in the figure, before HinfI digestion, the PCR amplification products of molecular marker GS-dCm4.02-2 in 22 eggplant germplasms were all 199 bp fragments. After HinfI digestion, the PCR amplification products of molecular marker GS-dCm4.02-2 in eggplant germplasms with green fruit shoulders (1-7) all contained a fragment of 174 bp in size, and the PCR amplification products in eggplant germplasms with pure green fruit shoulders (8-22) all contained a fragment of 199 bp in size, which was consistent with the phenotypic identification results of the tested materials (with / without) green fruit shoulders.

[0063] The phenotype and genotype of the presence or absence of green shoulder on the fruit skin of 22 eggplant germplasm resources were statistically analyzed, and the results are shown in Table 1:

[0064] Table 1 Statistics of phenotype and genotype of 22 eggplant germplasm resources with or without green shoulder on the fruit skin

[0065]

[0066]

[0067] The above results indicate that the molecular marker GS-dCm4.02-2 of the present invention has strong specificity and can be used for identifying and screening the presence or absence of green shoulder phenotype in eggplant peel.

[0068] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. A dCAPS molecular marker for identifying green shoulder of eggplant, characterized in that: The nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO.1, and the 25th Y in the sequence represents a polymorphism, which is T or C.

2. A dCAPS molecular marker for identifying green shoulder of eggplant, characterized in that: A 199 bp band was amplified using the dCAPS molecular marker primer pair in the eggplant genomic DNA. After the amplified band of the green shoulder variety was digested with HinfI, a 174 bp main band was obtained. After the amplified band of the pure green skin variety was digested with HinfI, a 199 bp main band was obtained. The nucleotide sequence of the upstream primer of the dCAPS molecular marker primer pair is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A specific primer pair for detecting the dCAPS molecular marker according to claim 1 or 2, characterized in that: The nucleotide sequence of the upstream primer of the specific primer pair is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

4. A kit comprising the specific primer pair according to claim 3.

5. The kit according to claim 4, characterized in that The kit contains HinfI enzyme.

6. Use of the specific primer pair according to claim 3 or the kit according to claim 4 or 5 in identifying eggplant green shoulder varieties.

7. The use of the dCAPS molecular marker for identifying green shoulder of eggplant according to claim 1 or 2, comprising: (1) Application in identifying green shoulder of eggplant; (2) Application in molecular marker-assisted breeding of green fruit shoulders in eggplant.

8. A method for identifying green shoulder of eggplant, characterized in that: The following steps are involved: (1) using the DNA of the eggplant material to be tested as a template, and performing PCR amplification using the specific primer pair shown in SEQ ID NO. 2-3 to obtain a PCR product; (2) The PCR amplification product is digested with HinfI enzyme, the digestion product is subjected to polyacrylamide gel electrophoresis, and the electrophoresis detection result is observed.

9. The method according to claim 4, characterized in that Step (1) The PCR reaction system is: in a 12 μL reaction system, 2 μL of DNA template solution, 5 μL of 2×Taq Mix, 1 μL of forward primer and 1 μL of reverse primer, with a concentration of 10 uM / L, and the total volume is filled to 12 μL with 3 μL ddH2O; PCR amplification reaction program: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 5 min; The gel in step (2) is 8% non-denaturing polyacrylamide gel; Enzyme digestion reaction system: Hinf I 1μL, 10×H Buffer 2μL, DNA ≤ 1μg, and the total volume is made up to 20μL with ddH2O; reaction conditions: enzyme digestion at 37°C for 1h.

10. The method according to claim 4, characterized in that The method for determining the electrophoresis detection result in step (2) is as follows: After HinfI digestion, if the digestion product contains a 174 bp main band, it means that the eggplant sample to be tested is a green shoulder variety; After HinfI digestion, if the digestion product contains a 199 bp main band, it means that the eggplant sample to be tested is a pure green peel variety; After HinfI digestion, if the digestion product contains two main bands of 199 bp and 174 bp, it means that the eggplant sample to be tested is heterozygous.

Images