Linked KASP molecular marker of wheat stripe rust resistance gene YrBN1 and application of linked KASP molecular marker

Abstract

The invention relates to a linked KASP molecular marker of a wheat stripe rust resistance gene YrBN1 and application of the molecular marker. The KASP molecular marker is XK1D-8; the KASP molecular marker and a wheat stripe rust resistance gene YrBN1 are co-localized on a wheat 1DS chromosome, the nucleotide sequence of XK1D-8 is as shown in SEQ ID NO.1, the 100th basic group from the 5'end of the nucleotide sequence is an SNP site, and the polymorphism of the SNP site is C / A. The KASP molecular marker is closely linked with the stripe rust resistant gene YrBN1, can accurately identify wheat stripe rust resistant plants, and is of great significance to wheat germplasm resource stripe rust resistant gene screening, wheat stripe rust resistant material creation or molecular assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to a linked KASP molecular marker of a wheat stripe rust resistance gene YrBN1 and an application thereof. Background Art

[0002] Wheat is the most widely planted food crop in the world and the second largest in terms of total production. It is the staple food of 35%-40% of the world's population. However, wheat production is often threatened by a variety of pests and diseases. Among them, wheat stripe rust caused by the fungal pathogen Pucciniastriiformis Westend.f.sp.Tritic is one of the most important wheat diseases and occurs in all major wheat production areas around the world. There are two main methods for the prevention and control of wheat stripe rust: chemical fungicides and the cultivation and planting of disease-resistant varieties. Among them, discovering disease-resistant genes and cultivating and planting disease-resistant varieties are the most green and effective measures to prevent and control wheat stripe rust.

[0003] At present, 86 officially named stripe rust resistance genes (Yr1-86) and a large number of temporarily named stripe rust resistance genes have been reported in wheat. Wheat stripe rust resistance genes can be divided into adult plant resistance (APR) and full growth period resistance (ASR). Full growth period resistance is only effective against specific physiological races or virulent races, also known as race-specific resistance. It is generally a quality trait and is controlled by a single major gene. It is effective at all stages of wheat growth. However, due to the frequent mutation of stripe rust fungi and the prevalence of new toxic physiological races, many wheat varieties with a single resistance source will lose their resistance after only 3-5 years of use in production. A large number of disease-resistant genes in wheat have lost resistance to new toxic physiological races. Therefore, it is urgent to explore and utilize the Xinxiang stripe rust resistance source and the molecular markers of the corresponding genes to further accelerate the process of molecular-assisted breeding of wheat disease resistance.

[0004] Single Nucleotide Polymorphisms (SNP) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide, mainly including the deletion, insertion, conversion and transversion of a single base. In recent years, with the rapid development of wheat genome, SNP markers have been widely used. The third-generation KASP (Kompetitive allele-specific PCR) molecular marker based on SNP is a fluorescence-based homogeneous genotyping technology. Its principle is based on the specific matching of primer terminal bases. It can accurately perform double allele typing on the target SNP and InDel at a specific site. It has the characteristics of ultra-high accuracy and conversion rate, low cost, high throughput and simple and fast result analysis. It has played an important role in gene positioning, molecular marker-assisted selection breeding and germplasm resource identification. Based on this, the development of KASP markers closely linked to stripe rust resistance genes is of great significance for the rapid screening of rust resistance genes in wheat germplasm resources and molecular marker-assisted selection breeding, which will accelerate the breeding process of new wheat varieties resistant to stripe rust. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects in the prior art and provide a KASP molecular marker linked to a wheat stripe rust resistance gene YrBN1 and an application thereof. The wheat stripe rust resistance gene YrBN1 provides a basis for breeding excellent disease-resistant varieties, and the KASP molecular marker closely linked to it accurately identifies the stripe rust resistance gene YrBN1, promotes the application of the stripe rust resistance gene YrBN1 in molecular breeding, and is of great significance for the creation of wheat stripe rust resistance materials or wheat stripe rust resistance molecular marker-assisted selection breeding.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] A wheat stripe rust resistance gene YrBN1, wherein the wheat stripe rust resistance gene YrBN1 is located on the wheat 1DS chromosome, within the 0-8.2cM interval of the Chinese Spring reference genome IWGSC RefSeq v1.0 genome version, and the corresponding physical position is 7.92-10.41Mb).

[0008] As a further technical solution, the Chinese Spring reference genome IWGSC RefSeq v1.0 genome version is available at http: / / 202.194.139.32 / download.html.

[0009] A KASP molecular marker linked to the wheat stripe rust resistance gene YrBN1, the KASP molecular marker is XK1D-8; the nucleotide sequence of XK1D-8 is shown in SEQ ID NO.1, and the 100th base from the 5' end of the nucleotide sequence is a SNP site, and the polymorphism of the SNP site is C / A respectively.

[0010] As a further technical solution, the XK1D-8 and the wheat stripe rust resistance gene YrBN1 are co-localized on the wheat 1DS chromosome.

[0011] A specific primer set for amplifying the KASP molecular marker, comprising a forward primer XK1D-8-FAM, a forward primer XK1D-8-HEX and a common reverse primer XK1D-8-Common; wherein,

[0012] The nucleotide sequence of the forward primer XK1D-8-FAM is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the forward primer XK1D-8-HEX is shown in SEQ ID NO.3;

[0014] The nucleotide sequence of the common reverse primer XK1D-8-Common is shown in SEQ ID NO.4.

[0015] A detection kit for wheat stripe rust gene YrBN1 comprises a specific primer set of the functional KASP molecular marker.

[0016] A method for identifying whether a wheat material contains a stripe rust resistance gene YrBN1, comprising the following steps: using genomic DNA of a wheat material to be tested as a template, amplifying with a specific primer set of the KASP molecular marker according to claim 4, and transferring the amplified product to an ELISA reader to read fluorescence data, and judging whether the wheat to be tested contains the stripe rust resistance gene YrBN1 according to the fluorescence data of the amplified product;

[0017] When the obtained genotype is a homozygous allele genotype with FAM fluorescence or a heterozygous genotype, the wheat material to be tested contains the stripe rust resistance gene YrBN1; when the obtained genotype is a homozygous allele genotype with HEX fluorescence, the wheat material to be tested does not contain the stripe rust resistance gene YrBN1.

[0018] As a further technical solution, in step (2), the reaction system for PCR amplification is: 0.2 μg DNA, 0.0448 μL primer mixture, 2 μL 2×KASPv4.0 Master mix, 2 μL ddH 2 O 1.9552 μL;

[0019] In the primer mixture, the concentrations of the forward primer and the reverse primer are 12 μM, and the concentration of the shared reverse primer is 30 μM.

[0020] As a further technical solution, in step (2), the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6°C each cycle; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 32 cycles.

[0021] The functional KASP molecular marker, the specific primer set or the detection kit are used in identifying whether wheat materials contain the stripe rust resistance gene YrBN1, detecting the stripe rust resistance shape of wheat, screening the germplasm resources of the wheat stripe rust resistance gene YrBN1, creating stripe rust resistance wheat materials or molecular assisted breeding of wheat stripe rust resistance.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention discovered the wheat stripe rust resistance gene YrBN1 through research, and found a SNP marker closely linked to the wheat stripe rust resistance gene YrBN1. Based on the SNP marker, a KASP marker closely linked to YrBN1 was developed. The two markers have a co-segregation characteristic, and can accurately identify whether the wheat stripe rust resistance gene YrBN1 is contained, so that susceptible plants are eliminated during the breeding process, and the breeding efficiency is improved. This is of great significance for the creation of wheat stripe rust resistance materials or wheat stripe rust resistance molecular marker assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the preliminary localization result of the wheat stripe rust resistance gene YrBN1 on chromosome 1DS in Example 1 of the present invention;

[0025] Figure 2 The XK1D-8 marker F in Example 3 of the present invention 2 genotyping results of genetically segregating populations;

[0026] Figure 3 The XK1D-8 marker F in Example 3 of the present invention 2 Genotype-phenotype association results of population typing. DETAILED DESCRIPTION

[0027] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Example 1: Genetic localization of YrBN1 and development of tightly linked KASP molecular markers

[0029] The method for localizing a wheat stripe rust resistance gene YrBN1 and developing a tightly linked KASP molecular marker comprises the following steps:

[0030] The recombinant inbred lines formed by hybridization of the stripe rust-resistant wheat variety Baomai No. 6 and the stripe rust-susceptible wheat variety Avocet S and continuous self-pollination constituted the initial genetic mapping population, and the families with phenotype separation were selected from the population as the remaining heterozygous lines to construct the fine positioning population. The stripe rust fungus selected the CYR32 physiological race, and the entire experiment was completed in a plant artificial climate box (incubator). The specific steps are: the wheat material was planted in a 10×10×10cm seedling pot, and the planted wheat was placed in an incubator for growth. The incubator conditions were set to a light-dark cycle of 16℃ light 16h / 10℃ dark 8h, the light intensity was set to 20000xl, and the relative humidity of the incubator was set to 85%. At the second leaf stage of wheat, 10ul of a mixture of stripe rust and fluoride solution (1:1000) was evenly applied to wheat leaves using a pipette. The inoculated wheat seedlings were sealed with a wet black plastic bag and cultured in the dark at 10°C for 24 hours. Then they were transferred to normal culture conditions for growth. Water was sprayed every two days to maintain a moist environment. The phenotype was recorded after the wheat seedlings were fully diseased (approximately 14-16 days). The phenotypic identification used the infection type (IT) evaluation index, and IT used the 0-9 level identification standard (Line and Qayoum 1992). The CTAB (Cetyltrimethylammonium Bromide) method was used to extract the parent Baomai No. 6 and Avocet S, F 2 The genomic DNA of the leaves of the secondary segregant population and the RIL population was collected (Rogers and Bendich 1985, Plant Mol. Biol., 1985, 5: 69-76). DNA quality was tested by agarose gel detection, and DNA was quantified by Thermo Fisher's NanoDrop TM The samples were measured by One / OneC ultra-micro UV spectrophotometer, and qualified DNA was sent to Shijiazhuang Boridi Co., Ltd. for 16K SNP chip typing, and the genetic map was constructed using IciMapping V4.2.

[0031] Using the Inclusive Composite Interval Mapping-ADD (ICIM-ADD) method in QTL IciMapping V4.2, the threshold LOD ≥ 2.5 was set, and the stripe rust resistance phenotype at the seedling stage was used to detect QTLs, and the wheat stripe rust resistance gene YrBN1 was located. The genetic distance between the position of YrBN1 and the molecular markers was calculated. YrBN1 was initially located in the 15.5cM interval of 1DS through the RIL population, and the corresponding physical position of the Chinese Spring reference genome 1.0 was 0-12.8Mb. Then, new molecular markers in the corresponding interval were developed using GBW16K and Wheat660K SNP chip data, and YrBN1 was finally located in the 8.2cM interval using a secondary segregation population (population size 464), with a corresponding physical position of 7.92-10.41Mb, and co-segregated with the KASP marker XK1D-8 ( Figure 1 ).

[0032] The KASP molecular marker used in this example was derived from the GBW16K and Wheat660K SNP chip data of the parents Baomai No. 6 and Avocet S. The obtained SNP sites were converted into KASP markers using the Polymarker website and synthesized at Shanghai Sangon Biotechnology Co., Ltd.

[0033] The KASP molecular marker XK1D-8 is derived from the Wheat660K SNP chip data of the parents Baomai No. 6 and Avocet S, and is co-segregated with YrBN1. The nucleotide sequence of XK1D-8 is shown in SEQ ID NO.1, specifically:

[0034] 5′-TACCTTTGCAAGTACCCATTCGTCTCGAGTTAAAACTTAGAAGAGGCACATTTTT CTGTCGTGGGATCCAATGAACTCGACTAAGCTATTAAAGTTGTG[C / A]TGAATATTATCGT ACAATGTAGGTTATAGTTGGACTCGGGGTCATACAGTGTGTGGATAGAATATGGAGTCAT GTCGTAGTTGGACCTCTTATATATGAG-3′.

[0035] The 100th base from the 5′ end of the nucleotide sequence of XK1D-8 is a SNP site, and the polymorphisms of the SNP site are C / A.

[0036] The specific primer set of KASP molecular marker XK1D-8 includes:

[0037] The forward primer XK1D-8-FAM, whose nucleotide sequence is shown in SEQ ID NO.2, is specifically: 5′-gaaggtgaccaagttcatgcttcgactaagctattaaagttgtgC-3′;

[0038] The forward primer XK1D-8-HEX has a nucleotide sequence as shown in SEQ ID NO. 3, specifically: 5′-gaaggtcggagtcaacggatttcgactaagctattaaagttgtgA-3′;

[0039] The reverse primer XK1D-8-Common has a nucleotide sequence as shown in SEQ ID NO.4, specifically: 5′-actgtatgaccccgagtcca-3′.

[0040] Among them, 5′-gaaggtgaccaagttcatgct-3′ is the FAM fluorescent universal primer, and the FAM fluorescent group is observed and read at an excitation light of 485nm and an emission light of 520nm; 5′-gaaggtcggagtcaacggatt-3′ is the HEX fluorescent universal primer, and the HEX fluorescent group is observed and read at an excitation light of 535nm and an emission light of 556nm.

[0041] Example 2: Genotyping method of XK1D-8 (method for identifying whether wheat materials contain stripe rust resistance gene YrBN1)

[0042] The method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1 comprises the following steps:

[0043] Step 1, synthesizing the specific primer set of the KASP molecular marker XK1D-8 described in Example 1, and preparing a primer mixture, wherein the concentrations of the forward primer and the reverse primer are 12 μM, and the concentration of the shared reverse primer is 30 μM;

[0044] Step 2: Using the CTAB method to extract the genomic DNA of the wheat material to be tested as an amplification template;

[0045] Step 3, using the genomic DNA of the wheat material to be tested as a template, and using the specific primer set of the KASP molecular marker XK1D-8 obtained in Example 1, the genomic DNA of the wheat material to be tested is subjected to fluorescent quantitative PCR amplification to obtain an amplification product;

[0046] The reaction system of fluorescence quantitative PCR amplification was as follows: 0.2 μg of genomic DNA of the wheat material to be tested, 2 μL of 2×KASPV4.0 Master mix, 0.0448 μL of primer mixture, and ddH 2O 1.9552mL.

[0047] In the primer mixture, the concentrations of XK1D-8-FAM and XK1D-8-HEX were both 12 μM, and the concentration of XK1D-8-Common was 30 μM;

[0048] The reaction procedure of fluorescence quantitative PCR amplification was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6°C each cycle; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 32 cycles.

[0049] Step 3, moving the amplified product to an ELISA reader to read the fluorescence data, and then importing the fluorescence data into KlusterCaller software for analysis to obtain genotype data and obtain the genotype;

[0050] The genotype of the homozygous allele with HEX fluorescence is "Y:Y", the genotype of the homozygous allele with FAM fluorescence is "X:X", the genotype of the heterozygous allele is "X:Y" or "Y:X", and the genotype of the missing value is "?".

[0051] In the KASP marker XK1D-8, if the genotype is "X:X", the wheat material to be tested contains the stripe rust resistance gene YrBN1; if the genotype is "Y:Y", the wheat material to be tested does not contain the stripe rust resistance gene YrBN1; if the genotype is "X:Y" or "Y:X", the wheat material to be tested contains the heterozygous stripe rust resistance gene YrBN1.

[0052] It has been verified that wheat materials with genotypes of "X:X", "X:Y" or "Y:X" are all resistant to stripe rust.

[0053] Example 3: Application of molecular marker XK1D-8 in selecting stripe rust resistance gene YrBN1

[0054] The F of Baomai No. 6 and Avocet S was analyzed by using the KASP molecular marker XK1D-8 described in Example 1 and the method described in Example 2. 2 Genotyping of the offspring showed that the F 2 The offspring were clearly divided into three types, and co-segregated with disease resistance. Figure 2 and Figure 3As shown, if the genotype is "X:X", the tested wheat material contains the stripe rust resistance gene YrBN1, which is recorded as A; if the genotype is "Y:Y", the tested wheat material does not contain the stripe rust resistance gene YrBN1, which is recorded as B; if the genotype is "X:Y" or "Y:X", the tested wheat material contains the heterozygous stripe rust resistance gene YrBN1, which is recorded as H. According to the genotype of marker XK1D-8, the average IT of plants containing the stripe rust resistance gene YrBN1 is 2, which is significantly lower than the average IT of plants without the stripe rust resistance gene YrBN1, which is 7.5. In addition, the average IT of plants containing the heterozygous stripe rust resistance gene YrBN1 is 4, which is also significantly lower than that of plants without the stripe rust resistance gene YrBN1. The actual results were consistent with the expected results. The molecular marker XK1D-8 of the present invention can replace phenotypic selection to select YrBN1 and screen germplasm resources, and can be applied to molecular assisted selection breeding of YrBN1 to accelerate the breeding process.

[0055] The above-described embodiments are only preferred embodiments of the present invention, and are not exhaustive of the feasible implementations of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A wheat stripe rust resistance gene YrBN1, characterized in that: The wheat stripe rust resistance gene YrBN1 is located on the wheat chromosome 1DS, within the 0-8.2 cM interval of the Chinese Spring reference genome IWGSC RefSeq v1.0 genome version, and corresponds to a physical position of 7.92-10.41 Mb.

2. A KASP molecular marker linked to the stripe rust resistance gene YrBN1, characterized in that: The KASP molecular marker is XK1D-8; the nucleotide sequence of XK1D-8 is shown in SEQ ID NO.1, and the 100th base from the 5' end of the nucleotide sequence is a SNP site, and the polymorphism of the SNP site is C / A respectively.

3. The KASP molecular marker according to claim 2, characterized in that: The XK1D-8 and the wheat stripe rust resistance gene YrBN1 are co-localized on the wheat 1DS chromosome.

4. A specific primer set for amplifying the KASP molecular marker as claimed in claim 3, characterized in that: It includes forward primer XK1D-8-FAM, forward primer XK1D-8-HEX and common reverse primer XK1D-8-Common; wherein, The nucleotide sequence of the forward primer XK1D-8-FAM is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer XK1D-8-HEX is shown in SEQ ID NO.3; The nucleotide sequence of the common reverse primer XK1D-8-Common is shown in SEQ ID NO.

4.

5. A detection kit for wheat stripe rust gene YrBN1, characterized in that: A specific primer set comprising the functional KASP molecular marker according to claim 3.

6. A method for identifying whether wheat materials contain the stripe rust resistance gene YrBN1, characterized in that: The method comprises the following steps: using the genomic DNA of the wheat material to be tested as a template, amplifying with the specific primer set of the KASP molecular marker according to claim 4, transferring the amplified product to an ELISA instrument to read the fluorescence data, and judging whether the wheat to be tested contains the stripe rust resistance gene YrBN1 according to the fluorescence data of the amplified product; When the obtained genotype is a homozygous allele genotype with FAM fluorescence or a heterozygous genotype, the wheat material to be tested contains the stripe rust resistance gene YrBN1; when the obtained genotype is a homozygous allele genotype with HEX fluorescence, the wheat material to be tested does not contain the stripe rust resistance gene YrBN1.

7. A method for identifying whether a wheat material contains the stripe rust resistance gene YrBN1 according to claim 6, characterized in that: In step (2), the reaction system for PCR amplification is: DNA 0.2 μg, primer mixture 0.0448 μL, 2×KASPv4.0 Master mix 2 μL, ddH2O 1.9552 μL; In the primer mixture, the concentrations of the forward primer and the reverse primer are 12 μM, and the concentration of the shared reverse primer is 30 μM.

8. The method for identifying whether a wheat material contains the stripe rust resistance gene YrBN1 according to claim 6, characterized in that: In step (2), the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6°C each cycle; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 32 cycles.

9. Use of the KASP molecular marker according to claim 2 or 3, the specific primer set according to claim 4 or the detection kit according to claim 4 in identifying whether wheat materials contain the stripe rust resistance gene YrBN1, detecting the stripe rust resistance shape of wheat, screening the germplasm resources of the wheat stripe rust resistance gene YrBN1, creating stripe rust resistance wheat materials or molecular assisted breeding of wheat stripe rust resistance.

Images