Method for detecting genomic abnormalities in cell

Abstract

The present disclosure relates to methods for detecting genomic abnormalities or variants, such as chromosomal abnormalities or structural variations, in cell populations, including engineered cell populations.

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 366,096, filed on June 9, 2022, and U.S. Provisional Application No. 63 / 386,436, filed on December 7, 2022, the contents of both of which are hereby incorporated by reference in their entireties.

[0003] Reference to a sequence listing

[0004] This application contains a sequence listing, which is submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy created on June 2, 2023 is named AT-051-03WO_ST26.xml and is 30,695 bytes in size. Technical Field

[0005] The present disclosure relates to methods for detecting genomic abnormalities or variants, such as chromosomal abnormalities in cell populations, such as chromosomal structural variations. The methods can be used to detect genomic abnormalities in cells obtained from patients to whom engineered cell drug products such as CAR T cells have been administered. Background Art

[0006] It is critical and challenging to assess cell viability and health during the cell therapy manufacturing process. Monitoring the cell state at various stages of the drug product manufacturing process is important for maintaining overall cell health and function. Some cell-based therapeutic products are produced using various modification techniques (e.g., gene editing techniques), in which identification and / or detection of genomic abnormalities or variants (e.g., from off-target effects or not from off-target effects) will be beneficial for assessing viability and health. At different stages of the cell therapy manufacturing process, such as the donor cell stage involving cells from healthy donors or cells from autologous donors (i.e., subjects in need of cell therapy) before any modification, it may be appropriate to identify and / or detect genomic abnormalities in cells. Modified or engineered cell stages, such as after donor cells are modified or engineered to (i) express one or more exogenous molecules, such as chimeric antigen receptors and / or (ii) eliminate or reduce the expression of one or more endogenous molecules, are also of concern. In addition, after in vitro or in vivo amplification, identification and / or detection of genomic abnormalities or variants in donor cells and / or engineered cells is of concern. Summary of the invention

[0007] The present disclosure provides compositions, kits, methods and systems that allow monitoring of cell status to ensure that cell health and viability are maintained during the drug product manufacturing process. Such monitoring is particularly advantageous in the case of manufacturing engineered cells (such as engineered immune cells), which can be produced in large quantities during the drug product manufacturing process to ensure overall cell health and viability and uniformity of cell dosage content. Reagents and methods for assessing cell viability and health for cell-based therapies are provided herein, which may help improve the efficiency of manufacturing and drug product processes.

[0008] On the one hand, the present disclosure provides a method for detecting genomic abnormalities in engineered cell populations. In one embodiment, the method includes providing a genomic deoxyribonucleic acid (gDNA) molecule from an engineered cell population, the engineered cell population being suspected of having a genomic abnormality or variant (such as a chromosome inversion) and having an edited genomic region. In another embodiment, the engineered cell population (i) is suspected of including a chromosome 14 inversion, the chromosome 14 inversion being characterized by a centromere inversion site at the T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at the immunoglobulin heavy chain (IGH) variable region, and (ii) including an edited genomic region. In other embodiments, the method further includes subjecting the gDNA molecule to conditions sufficient to produce one or more nucleic acid extension products, wherein the nucleic acid extension product includes a sequence corresponding to the chromosome 14 inversion or its complement. The nucleic acid extension product can be detected as an indicator of the presence of the chromosome 14 inversion in the engineered cell population.

[0009] In one embodiment, the centromere inversion site (i) of the chromosome 14 inversion is present at the first genomic region and / or (ii) is present at the T cell receptor connection gene TRAJ7. In other embodiments, the TCR A / D locus is located at 14q11. In another embodiment, the TCR A / D locus is located at 14q11.2. In another embodiment, the telomeric inversion site (i) of the chromosome 14 inversion is present at the second genomic region and / or (ii) is present at the IGHV3-69-1 pseudogene. In one embodiment, the IGHV3-69-1 pseudogene is located in the IGH variable region. In another embodiment, the IGH variable region is located at 14q32. In another embodiment, the chromosome 14 inversion (i) is located between TRAJ7 and IGHV3-69-1 and / or (ii) is a 14q11 inversion. In another embodiment, the edited genomic region of the engineered cell population is present at the third genomic region. In a further embodiment, the third genomic region is different from the first genomic region and / or the second genomic region. The third genomic region (i.e., the edited genomic region) includes a T cell receptor alpha constant (TRAC) gene and / or a CD52 gene. In other embodiments, the first genomic region and / or the second genomic region are separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb.

[0010] In some embodiments, the chromosome 14 inversion occurs independently of the gene editing process. The gene editing process can be an in vitro or in vivo gene editing process. In another embodiment, the chromosome 14 inversion occurs spontaneously.

[0011] In other embodiments, the method for detecting genomic abnormalities in an engineered cell population further includes subjecting the gDNA to conditions sufficient to produce a control nucleic acid extension product. The method may further include detecting the control nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product. In addition, the method may further include providing additional gDNA molecules from additional engineered cell populations. The additional engineered cell population may be characterized by (i) lacking or not including the chromosome 14 inversion and (ii) including the edited genomic region. In one embodiment, the additional gDNA molecules from the additional engineered cells do not include chromosome 14 inversion. The method may further include subjecting the additional gDNA molecules to conditions sufficient to produce (i) additional nucleic acid extension products and (ii) additional control nucleic acid extension products, the additional nucleic acid extension products including sequences corresponding to the chromosome 14 inversion or their complements. In another embodiment, the method further comprises detecting the additional control nucleic acid extension product without detecting the additional nucleic acid extension product as an indicator of (i) the absence of the chromosome 14 inversion in the additional engineered cell population and / or (ii) the conditions are sufficient to produce the control nucleic acid extension product. In other embodiments, the control nucleic acid extension product includes a sequence corresponding to an endogenous gene sequence. The endogenous gene sequence can be a human ribonuclease P protein subunit p30 (RPP30) gene sequence.

[0012] In another embodiment, the method further comprises extracting gDNA from the cell population before step a). The extracted gDNA can be fragmented to provide the gDNA molecules.

[0013] In other embodiments, the engineered cell colony is an engineered immune cell colony. In one embodiment, the engineered immune cell colony includes a chimeric antigen receptor (CAR) nucleic acid sequence. In another embodiment, the CAR nucleic acid sequence expresses BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2 (Claudin-18.2), Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34 combined CAR.

[0014] On the other hand, the present disclosure provides a method for detecting genomic abnormalities in engineered cell populations using a partition-based method. In one embodiment, the partition-based method includes providing a gDNA molecule from an engineered cell population, the engineered cell population having or suspected of having a genomic abnormality or variant (such as a chromosome inversion) and having an edited genomic region. In another embodiment, the engineered cell population (analyzed using a partition-based method) (i) is suspected of including chromosome 14 inversions, the chromosome 14 inversions being characterized by the centromere inversion site at the T cell receptor α / δ locus (TCR A / D) and the telomere inversion site at the immunoglobulin heavy chain (IGH) variable region, and (ii) including edited genomic regions. In one embodiment, the centromere inversion site of the chromosome 14 inversion (i) is present at the first genomic region and / or (ii) is present at the T cell receptor connection gene TRAJ7. In other embodiments, the TCR A / D locus is located at 14q11. In another embodiment, the TCR A / D locus is located at 14q11.2. In one other embodiment, the telomere inversion site of the chromosome 14 inversion (i) is present in the second genomic region and / or (ii) is present in the IGHV3-69-1 pseudogene. In one embodiment, the IGHV3-69-1 pseudogene is located in the IGH variable region. In one other embodiment, the IGH variable region is located at 14q32. In another embodiment, the chromosome 14 inversion (i) is located between TRAJ7 and IGHV3-69-1 and / or (ii) is a 14q11 inversion. In another embodiment, the edited genomic region of the engineered cell colony is present in the third genomic region. In a further embodiment, the third genomic region is different from the first genomic region and / or the second genomic region. The third genomic region (i.e., the edited genomic region) includes T cell receptor alpha constant (TRAC) gene and / or CD52 gene. In other embodiments, the first genomic region and / or the second genomic region are separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb. In some embodiments, the chromosome 14 inversion occurs independently of a gene editing process, which can be an in vitro or in vivo gene editing process. In one embodiment, the chromosome 14 inversion occurs spontaneously.

[0015] In other embodiments, the method further includes generating a plurality of partitions. One or more partitions may contain a gDNA molecule and a primer molecule complementary to the genomic region corresponding to the inversion of the chromosome 14. In some embodiments, the primer molecule includes a pair of primer molecules. In another embodiment, the method further includes the step of producing an amplicon from the gDNA molecule in the partition using the primer molecule. In some embodiments, the amplicon includes a sequence corresponding to the inversion of the chromosome 14. The method may further include detecting the amplicon in the partition. In another embodiment, the method further includes counting the amplicon in the partition. In one embodiment, the counting of the amplicon quantifies the number of chromosome 14 inversions in the genome of the engineered cell population. In other embodiments, the method further includes counting the number of partitions including the amplicon, thereby quantifying the number of chromosome 14 inversions. In other embodiments, a subset of the plurality of partitions includes no more than one gDNA molecule per partition or the plurality of partitions substantially all include no more than one gDNA molecule.

[0016] In other embodiments, additional partitions of the plurality of partitions include additional gDNA molecules and additional primer molecules, the additional primer molecules being complementary to the genomic region corresponding to the inversion of the chromosome 14. In one embodiment, the additional primer molecules include an additional pair of primer molecules. The method may further include subjecting the additional gDNA molecules to conditions sufficient to produce (i) additional amplicons and (ii) control nucleic acid extension products in the partition, the additional amplicons including sequences corresponding to the inversion of the chromosome 14 or their complements. In addition, the method may include generating and / or detecting the additional amplicons in the additional partitions.

[0017] In other embodiments, the method further comprises generating and / or detecting the control nucleic acid extension product without generating and / or detecting the additional amplicon in the additional partition, wherein detecting the control nucleic acid extension product without detecting the additional amplicon in the additional partition is an indicator of (i) the absence of the chromosome 14 inversion in the additional gDNA molecule and / or (ii) the conditions are sufficient to generate the control nucleic acid extension product. In other embodiments, the control nucleic acid extension product includes a sequence corresponding to an endogenous gene sequence. The endogenous gene sequence can be a human ribonuclease protein subunit p30 (RPP30) gene sequence.

[0018] In some embodiments, the method further comprises extracting gDNA from the engineered cells prior to the step of providing gDNA molecules. The extracting step may further comprise fragmenting the extracted gDNA to provide the gDNA molecules.

[0019] In other embodiments, the engineered cell colony analyzed using a partition-based method is an engineered immune cell colony. In one embodiment, the engineered immune cell colony includes a chimeric antigen receptor (CAR) nucleic acid sequence. In another embodiment, the CAR nucleic acid sequence expresses the CAR combined with BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34.

[0020] In one other aspect, the present disclosure provides an in vitro method for detecting genomic abnormalities in patient cell colonies. In one embodiment, the method includes providing a genomic deoxyribonucleic acid (gDNA) molecule from a patient cell colony. The patient cell colony may include an immune cell, and the immune cell includes or is suspected of including a genomic abnormality or variant (such as a chromosome inversion) and includes an edited genomic region. In one other embodiment, the immune cell (i) includes or is suspected of including a chromosome 14 inversion, and the chromosome 14 inversion is characterized by a centromere inversion site at the T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at the immunoglobulin heavy chain (IGH) variable region, and (ii) includes an edited genomic region. In one embodiment, the centromere inversion site (i) of the chromosome 14 inversion is present at the first genomic region and / or (ii) is present at the T cell receptor connection gene TRAJ7. In other embodiments, the TCR A / D locus is located at 14q11. In another embodiment, the TCR A / D locus is located at 14q11.2. In one other embodiment, the telomeric inversion site of the chromosome 14 inversion (i) is present at the second genomic region and / or (ii) is present at the IGHV3-69-1 pseudogene. In one embodiment, the IGHV3-69-1 pseudogene is located within the IGH variable region. In one other embodiment, the IGH variable region is located at 14q32. In another embodiment, the chromosome 14 inversion (i) is located between TRAJ7 and IGHV3-69-1 and / or (ii) is a 14q11 inversion. As described in Example 1, next generation sequencing (NGS) is used to check the precise breakpoints of the patient's inversion. Sequencing confirmed the presence of the chromosome 14 inversion and identified the inversion breakpoint site (see Figure 2 The centromeric (14q11.2) inversion site occurs within the TCR A / D locus at the beginning of the T cell receptor junction gene TRAJ7 (chr14:22537626; hg38 reference genome version). The telomeric (14q32) inversion site occurs at the IGHV3-69-1 pseudogene (chr14:106728167; hg38 reference genome version) within the IGH variable region.

[0021] In another embodiment, the edited genomic region of the immune cell colony is present in the third genomic region. In a further embodiment, the third genomic region is different from the first genomic region and / or the second genomic region. The third genomic region (i.e., the edited genomic region) includes T cell receptor alpha constant (TRAC) gene and / or CD52 gene. In other embodiments, the first genomic region and / or the second genomic region are separated from the third genomic region by at least about 5 kilobases (kb), about 6kb, about 7kb, about 8kb, about 9kb, about 10kb, about 11kb, about 12kb, about 13kb, about 14kb or about 15kb.

[0022] In a further embodiment, the patient cell colony is derived from a patient treated with an engineered immune cell colony. In another embodiment, the chromosome 14 inversion is present or absent in the engineered immune cell colony. In other embodiments, the chromosome 14 inversion occurs in the immune cells after treatment with the engineered immune cell colony. In some embodiments, the chromosome 14 inversion occurs independently of a gene editing process, which can be an in vitro or in vivo gene editing process. In one embodiment, the chromosome 14 inversion occurs spontaneously.

[0023] In another embodiment, the method further comprises subjecting the gDNA molecule to conditions sufficient to produce a nucleic acid extension product. In another embodiment, the nucleic acid extension product comprises a sequence corresponding to the chromosome 14 inversion or its complement. The method may further comprise detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the immune cell.

[0024] In other embodiments, the method further comprises subjecting the gDNA to conditions sufficient to produce a control nucleic acid extension product. The method may further comprise detecting the control nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product. In other embodiments, the control nucleic acid extension product comprises a sequence corresponding to an endogenous gene sequence, such as a human ribonuclease P protein subunit p30 (RPP30) gene sequence.

[0025] In other embodiments, the immune cell from patient cell colony analyzed using in vitro method is an immune cell including chimeric antigen receptor (CAR) nucleic acid sequence. In another embodiment, the CAR nucleic acid sequence expresses the CAR combined with BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34. The immune cells from the patient cell population can be engineered immune cells previously administered to the patient, or can be immune cells that are part of a clonal population of previously administered engineered immune cells, such as a clonal population of CAR T cells after in vivo expansion.

[0026] In a further aspect, the present disclosure provides a drug product release assay for an allogeneic immune cell drug product. In one embodiment, the release assay includes a step of providing an allogeneic immune cell drug product including an engineered immune cell, wherein the engineered immune cell includes an edited genomic region. The release assay may further include a step of extracting gDNA molecules from the engineered immune cells. In addition, the release assay may include a step of subjecting the gDNA molecules to conditions sufficient to produce nucleic acid extension products. The nucleic acid extension includes a sequence corresponding to a genomic abnormality or variant (such as a chromosome inversion). In one embodiment, the nucleic acid extension includes a sequence corresponding to a chromosome 14 inversion or its complement, and the chromosome 14 inversion is characterized by a centromere inversion site at a T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at an immunoglobulin heavy chain (IGH) variable region. In another embodiment, the chromosome 14 inversion occurs independently of a gene editing process, and the gene editing process may be an in vitro or in vivo gene editing process. In other embodiments, the chromosome inversion occurs spontaneously. In one embodiment, the centromere inversion site (i) of the chromosome 14 inversion is present at the first genomic region and / or (ii) is present at the T cell receptor connection gene TRAJ7. In other embodiments, the TCR A / D locus is located at 14q11. In another embodiment, the TCR A / D locus is located at 14q11.2. In another embodiment, the telomere inversion site (i) of the chromosome 14 inversion is present at the second genomic region and / or (ii) is present at the IGHV3-69-1 pseudogene. In one embodiment, the IGHV3-69-1 pseudogene is located in the IGH variable region. In another embodiment, the IGH variable region is located at 14q32. In another embodiment, the chromosome 14 inversion (i) is located between TRAJ7 and IGHV3-69-1 and / or (ii) is a 14q11 inversion. In another embodiment, the edited genomic region of the immune cell colony is present at the third genomic region. In a further embodiment, the third genomic region is different from the first genomic region and / or the second genomic region. The third genomic region (i.e., the edited genomic region) includes a T cell receptor alpha constant (TRAC) gene and / or a CD52 gene. In other embodiments, the first genomic region and / or the second genomic region are separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb.

[0027] In further embodiments, the release assay comprises detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the engineered immune cell.

[0028] In another embodiment, the extracting step of the release assay comprises fragmenting the gDNA to provide gDNA molecules.

[0029] In other embodiments, the release assay further comprises a step of subjecting the gDNA to conditions sufficient to produce a control nucleic acid extension product. The release assay may further comprise detecting the control nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product. In other embodiments, the release assay further comprises a step of extracting additional gDNA molecules from additional engineered immune cells. The additional engineered immune cells (i) do not include the chromosome 14 inversion and (ii) include the edited genomic region. In addition, the release assay comprises a step of subjecting additional gDNA molecules to conditions sufficient to produce (i) additional nucleic acid extension products and (ii) additional control nucleic acid extension products, the additional nucleic acid extension products comprising a sequence corresponding to the chromosome 14 inversion or its complement. The release assay may further comprise a step of detecting the additional control nucleic acid extension product without detecting the additional nucleic acid extension product as an indicator that (i) the chromosome 14 inversion is not present in the additional engineered immune cells and / or (ii) the conditions are sufficient to produce the control nucleic acid extension product. In other embodiments, the control nucleic acid extension product includes a sequence corresponding to an endogenous gene sequence, such as a human ribonuclease P protein subunit p30 (RPP30) gene sequence.

[0030] In other embodiments, the engineered immune cell from the drug product analyzed using the release assay is an engineered immune cell including a chimeric antigen receptor (CAR) nucleic acid sequence. In another embodiment, the CAR nucleic acid sequence expresses the CAR combined with BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34.

[0031] In certain embodiments, the engineered immune cells are T cells, inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, helper T lymphocytes, effector T lymphocytes, tumor infiltrating lymphocytes (TIL), NK cells, NK-T cells, TCR expressing cells, TCR knockout T cells, dendritic cells, macrophages, killer dendritic cells, mast cells or B cells. In certain embodiments, the engineered immune cells are CAR T cells. In certain embodiments, the engineered immune cells are allogeneic CAR T cells. In certain embodiments, the engineered immune cells are autologous CAR T cells. In some embodiments, the engineered immune cells are human cells.

[0032] In another aspect, the present disclosure provides a pharmaceutical product comprising engineered immune cells prepared by the pharmaceutical product method disclosed herein.

[0033] In yet another aspect, the disclosure provides a method for treating a subject in need of treatment, the method comprising administering a pharmaceutical product disclosed herein to the subject. In certain embodiments, the subject is human. In some embodiments, the treatment step is after the results of the method or release determination step described herein.

[0034] The presence of genomic abnormalities in allogeneic immune cell drug products may cause safety issues, thereby possibly preventing the drug product from being administered to a subject. In a further aspect, the present disclosure provides a method for confirming the safety of allogeneic immune cell drug products. In one embodiment, the method for confirming the safety of allogeneic immune cell drug products includes providing a step of an allogeneic immune cell drug product comprising an engineered immune cell, wherein the engineered immune cell comprises an edited genomic region. The method may further include the step of extracting gDNA molecules from the engineered immune cells. In addition, the method may include the step of subjecting the gDNA molecules to conditions sufficient to produce nucleic acid extension products. The nucleic acid extension includes a sequence corresponding to a genomic abnormality or variant (such as a chromosome inversion). In one embodiment, the nucleic acid extension includes a sequence corresponding to a chromosome 14 inversion or its complement, and the chromosome 14 inversion is characterized by a centromere inversion site at a T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at an immunoglobulin heavy chain (IGH) variable region. In another embodiment, the chromosome 14 inversion occurs independently of the gene editing process, and the gene editing process can be an in vitro or in vivo gene editing process. In other embodiments, the chromosome inversion occurs spontaneously. In one embodiment, the centromere inversion site (i) of the chromosome 14 inversion is present at the first genome region and / or (ii) is present at the T cell receptor connection gene TRAJ7. In other embodiments, the TCR A / D locus is located at 14q11. In another embodiment, the TCR A / D locus is located at 14q11.2. In one other embodiment, the telomere inversion site (i) of the chromosome 14 inversion is present at the second genome region and / or (ii) is present at the IGHV3-69-1 pseudogene. In one embodiment, the IGHV3-69-1 pseudogene is located in the IGH variable region. In one other embodiment, the IGH variable region is located at 14q32. In another embodiment, the chromosome 14 inversion (i) is located between TRAJ7 and IGHV3-69-1 and / or (ii) is a 14q11 inversion. In another embodiment, the edited genomic region of the immune cell colony is present in the third genomic region. In a further embodiment, the third genomic region is different from the first genomic region and / or the second genomic region. The third genomic region (i.e., the edited genomic region) includes T cell receptor alpha constant (TRAC) gene and / or CD52 gene.In other embodiments, the first genomic region and / or the second genomic region is separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb.

[0035] In further embodiments, the method comprises detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the engineered immune cell, thereby confirming the safety of the allogeneic immune cell drug product.

[0036] In another embodiment, the extracting step of the method for confirming the safety of an allogeneic immune cell drug product comprises fragmenting the gDNA to provide the gDNA molecules.

[0037] In other embodiments, the method for confirming the safety of the allogeneic immune cell drug product further includes a step of subjecting the gDNA to conditions sufficient to produce a control nucleic acid extension product. The method may further include detecting the control nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product. In other embodiments, the method further includes the step of extracting additional gDNA molecules from additional engineered immune cells. The additional engineered immune cells (i) do not include the chromosome 14 inversion and (ii) include the edited genomic region. In addition, the method includes subjecting additional gDNA molecules to conditions sufficient to produce (i) additional nucleic acid extension products and (ii) additional control nucleic acid extension products, the additional nucleic acid extension products including a sequence corresponding to the chromosome 14 inversion or its complement. The method may further include detecting the additional control nucleic acid extension product without detecting the additional nucleic acid extension product as an indicator that (i) the chromosome 14 inversion is not present in the additional engineered immune cells and / or (ii) the conditions are sufficient to produce the control nucleic acid extension product. In other embodiments, the control nucleic acid extension product includes a sequence corresponding to an endogenous gene sequence, such as a human ribonuclease P protein subunit p30 (RPP30) gene sequence.

[0038] In other embodiments, the engineered immune cell from the drug product analyzed using the method is an engineered immune cell including a chimeric antigen receptor (CAR) nucleic acid sequence. In another embodiment, the CAR nucleic acid sequence expresses the CAR combined with BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34.

[0039] In certain embodiments, the engineered immune cells are T cells, inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, helper T lymphocytes, effector T lymphocytes, tumor infiltrating lymphocytes (TIL), NK cells, NK-T cells, TCR expressing cells, TCR knockout T cells, dendritic cells, macrophages, killer dendritic cells, mast cells or B cells. In certain embodiments, the engineered immune cells are CAR T cells. In certain embodiments, the engineered immune cells are allogeneic CAR T cells. In certain embodiments, the engineered immune cells are autologous CAR T cells. In some embodiments, the engineered immune cells are human cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1A Longitudinal measurements of patients' CAR T cell VCN, ALC, and TCRβ clones are shown. Figure 1B Confirmed that the dominant clone from the patient was not detected in the drug product. Figure 1C Split FISH probe configuration is depicted. Figure 1D The % of dominant clones are shown.

[0041] Figure 2 A diagram showing chromosome 14 inversions detected and characterized by short-read and long-read whole-genome sequencing from a patient's peripheral blood sample on day 61.

[0042] Figure 3A-3B A method to develop a telomere inversion ligation ddPCR assay is described. Figure 3A Raw data of ddPCR from Quantasoft software are shown. Figure 3BThe linear double-stranded DNA template (gBlock TM ).

[0043] Figure 4 Longitudinal detection of telomere breakpoint junctions in patient peripheral blood samples by ddPCR is shown.

[0044] Figure 5 Chromosomal translocations are depicted.

[0045] Figure 6 A screening assay workflow for donor cell populations and / or drug product batches comprising engineered cells is shown. DETAILED DESCRIPTION

[0046] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are fully explained in the following literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1998) Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JPather and PE Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (JP Cellis, ed., 1998) Academic Press; Procedures (A. Doyle, JB Griffiths and DG Newell, eds., 1993-1998) John Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FMAusubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (John Wiley & Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 1994); Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995). For example, gene editing techniques using TALEN, CRISPR / Cas9, and megaTAL nucleases are within the skill of the art and are fully explained in the literature, such as T. Gaj et al., Genome-Editing Technologies: Principles and Applications, Cold Spring Harb Perspect Biol 2016; 8:a023754 and citations therein. .

[0047] definition

[0048] As used herein, the terms "a" and "an" are used to indicate one or more. For example, reference to a "cell" or "antibody" refers to "one or more cells" or "one or more antibodies".

[0049] As used herein, "autologous" means a cell, cell line, or population of cells obtained from a subject for use in treating the subject.

[0050] As used herein, "allogeneic" means a cell or population of cells that is not obtained from the subject but rather is obtained from a donor for treating the subject.

[0051] As used herein, the term "endogenous" refers to any material that originates or originates from within an organism, cell, tissue or system.

[0052] As used herein, the term "exogenous" refers to any material introduced or generated from outside an organism, cell, tissue, or system.

[0053] As used herein, "immune cell" refers to a cell of hematopoietic origin that is functionally involved in the initiation and / or execution of an innate and / or adaptive immune response. Examples of immune cells include T cells, such as α / βT cells and γ / δT cells, regulatory T (Treg) cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and bone marrow-derived phagocytes.

[0054] As used herein, "edited genomic region" refers to a genomic region within a cell of an organism, which is an object of genome editing by a genome editing agent. Any form of genome editing may be suitable, including but not limited to point mutations, deletions, insertions, and substitutions. For example, a genome may be subjected to genome editing to insert or introduce a nucleic acid sequence encoding an exogenous molecule (e.g., an antigen binding domain) to allow the cell to express the exogenous molecule. In another example, a genome may be subjected to genome editing to delete or destroy a nucleic acid sequence of a gene expressing an endogenous molecule (e.g., a T cell receptor) so that the expression of the endogenous molecule is reduced or eliminated in the cell.

[0055] As used herein, "genome editing reagents" refers to one or more reagents that can be used to edit a genomic region within a cell. In general, one or more reagents comprise an enzyme and a targeting component. In one embodiment, the targeting component is a transcription factor domain or a transcription activator-like (TAL) effector DNA binding domain (or derived or separated therefrom). The targeting component can be a TAL effector DNA binding domain that has been coupled (e.g., fused) to an enzyme (e.g., a nuclease). Alternatively, the targeting component can be a zinc finger domain coupled (e.g., fused) to a nuclease. In another embodiment, the targeting component can contain a nucleic acid, such as a guide RNA, such as those used in a CRISPR / Cas type system. Examples of nucleases include, but are not limited to, type IIS restriction endonucleases (e.g., Fok I), Cas nucleases (e.g., Cas9), or derivatives thereof.

[0056] As used herein, the term "nucleic acid product" generally refers to a nucleic acid product produced by one or more of hybridization, connection, extension, transcription, reverse transcription and amplification. Nucleic acid extension products are produced by using polymerases (e.g., DNA or RNA polymerases), template nucleic acid molecules (e.g., genomic DNA), nucleotides and primer molecules. Nucleic acid amplification products are produced in a manner similar to nucleic acid extension products, but involve the use of more than one primer. Nucleic acid hybridization products are produced by the combination of a first nucleic acid molecule (e.g., primer molecules or probe molecules) with a second nucleic acid molecule (e.g., template nucleic acid). The first nucleic acid molecule (e.g., probe molecule) may optionally include a label or part (e.g., a detectable label or a detectable part, or a reporter gene label or a reporter gene part). Nucleic acid transcription products are produced by using polymerases (e.g., RNA polymerases), DNA templates and primer molecules. Reverse transcription products are produced by using polymerases (e.g., DNA polymerases), RNA templates and primer molecules. Nucleic acid ligation products are produced by using ligases (e.g., DNA or RNA ligases), template molecules (e.g., DNA or RNA templates) and two or more probe molecules. The probe molecules are complementary to some or all of the districts of the template. In one embodiment, two probes are complementary to two districts adjacent to each other of the template. In another embodiment, when hybridizing with the template, there is a gap between the two probes, and the gap can be filled with a polymerase. The nucleic acid product can be produced by (i) sample nucleic acid to provide a sample nucleic acid product or (ii) control nucleic acid to provide a control nucleic acid product, as further described herein. In general, the sample nucleic acid product can include a target sequence, and the control nucleic acid product does not include a target sequence.

[0057] As used herein, the term nucleic acid "amplification" or nucleic acid "amplification reaction" refers to any in vitro method or process for producing a nucleic acid chain identical or complementary to at least a portion of a template nucleic acid molecule. Typically, nucleic acid amplification is used to produce multiple copies of a template nucleic acid molecule or its complement by using one or more polymerases and / or transcriptases. Examples of in vitro nucleic acid amplification include, but are not limited to, polymerase chain reaction (PCR), reverse transcriptase-PCR (RT-PCR), replicase-mediated amplification and ligase chain reaction (LCR), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA) and isothermal amplification reactions (e.g., single primer isothermal amplification (SPIA)). The process of "amplification" involves subjecting an aqueous reaction to conditions sufficient to allow amplification of a target or template nucleic acid molecule in the presence of all necessary reaction components. The components of the amplification reaction include, but are not limited to, one or more primers, nucleic acid templates, polymerases, and nucleotides. The term "amplification" generally refers to an exponential increase in a target nucleic acid, but "amplification" may also refer to a linear increase in the number of target sequences from a nucleic acid template, such as obtained by cycle sequencing or linear amplification. The process of "amplifying" or the step of "amplifying" produces an amplification product or "amplicon".

[0058] As used herein, the term "reaction mixture" refers to an aqueous solution comprising different reagents for producing a nucleic acid product. Reagents include, but are not limited to, enzymes, aqueous buffers, salts, primers, target or template nucleic acids, nucleoside triphosphates, stabilizers, and other additives to improve or optimize efficiency and / or specificity. The reaction mixture can be a ligation reaction mixture, an extension reaction mixture, a transcription reaction mixture, a reverse transcription reaction mixture, and an amplification reaction mixture.

[0059] As used herein, "oligonucleotide" refers to a linear oligomer of natural or modified nucleoside monomers connected by a phosphodiester bond or its analogs. Oligonucleotides include deoxyribonucleosides, ribonucleosides, anomeric forms thereof, peptide nucleic acids (PNA), etc. that can specifically bind to a target nucleic acid. Typically, monomers are connected by phosphodiester bonds or their analogs to form oligonucleotides with a size range of several monomer units, such as 3-4 to tens of monomer units, such as 40-60. Whenever an oligonucleotide is represented by a letter sequence, such as "ATGCCTG", it should be understood that the nucleotides are in 5'-3' order from left to right, and "A" represents deoxyadenosine, "C" represents deoxycytidine, "G" represents deoxyguanosine, "T" represents deoxythymidine, and "U" represents ribonucleoside, uridine, unless otherwise specified. Typically, oligonucleotides include four natural deoxynucleotides; however, they may also include ribonucleosides or non-natural nucleotide analogs. In cases where the enzyme has a specific oligonucleotide or polynucleotide substrate requirement for activity, e.g., single-stranded DNA, RNA / DNA duplex, etc., then the selection of an appropriate composition for the oligonucleotide or polynucleotide substrate is within the knowledge of the ordinary artisan.

[0060] As used herein, the term "polymerase chain reaction" or "PCR" refers to a method in which a specific segment or sequence (e.g., a subsequence or partial sequence) of a target double-stranded nucleic acid molecule (e.g., DNA or RNA) is amplified in a geometric progression. PCR is well known to those skilled in the art; see, for example, U.S. Patent Nos. 4,683,195 and 4,683,202, and PCR Protocols: A Guide to Methods and Applications, Innis et al., eds., 1990. Exemplary PCR reaction conditions typically include two or three-step cycles. A two-step cycle has a denaturation step followed by a hybridization / extension step. A three-step cycle includes a denaturation step followed by a hybridization step followed by a separate extension step.

[0061] As used herein, "primer molecule" or "primer" refers to a polynucleotide sequence coupled to (e.g., hybridized with) a specific sequence on a template or target nucleic acid, wherein it is used to initiate (or start) nucleic acid synthesis. Primers can be of various lengths, and the length is generally less than 50 nucleotides, for example, 12 to 30 nucleotides in length. The length and sequence of the primers for nucleic acid synthesis reactions (e.g., PCR) can be designed based on principles known to those skilled in the art. Primers can include DNA and / or RNA, chimeras comprising DNA and RNA portions. In some cases, primers can include one or more modified or non-natural nucleotide bases. In some cases, primers include a label or portion (e.g., a detectable label or a detectable portion, or a reporter gene label or a reporter gene portion). Primers that initiate the amplification (e.g., PCR) of a target or template polynucleotide molecule are referred to as "amplification primers." In non-amplification embodiments, primers can be used to generate structures that can be cut by a cutting agent.

[0062] As used herein, the term "probe" refers to a molecule (e.g., nucleic acid, polypeptide or protein, aptamer, etc.) that specifically binds to a target molecule, such as a target nucleic acid or polynucleotide (or specifically interacts with it) to allow specific detection of the target molecule. Non-limiting examples of molecules that specifically bind to or interact with a target molecule (e.g., a target nucleic acid or polynucleotide) include nucleic acids (e.g., oligonucleotides), proteins (e.g., antibodies, transcription factors, zinc finger proteins, non-antibody protein scaffolds, etc.) and aptamers. Typically, the probe includes a label (e.g., a detectable label or a detectable portion, or a reporter gene label or a reporter gene portion). The probe can indicate the presence and / or amount of the target polynucleotide by increasing or decreasing the signal from the label. In some cases, the probe detects the target polynucleotide in the amplification reaction by being digested by the 5' to 3' exonuclease activity of a DNA-dependent DNA polymerase. As used herein, an "oligonucleotide probe" refers to a polynucleotide sequence that can be coupled (e.g., hybridized or annealed) to a target nucleic acid of interest and allows specific detection of a target nucleic acid.

[0063] A "reporter moiety" or "reporter molecule" is a molecule that confers a detectable signal. The detectable phenotype can be, for example, colorimetric, fluorescent, or luminescent. A "quencher moiety" or "quencher molecule" is a molecule that is capable of quenching a detectable signal from a reporter moiety.

[0064] As used herein, "control" or "control nucleic acid" is a nucleic acid with a control sequence, from which a control nucleic acid product is produced and / or detected. The control nucleic acid product can be an external control produced in a control assay in conjunction with a sample assay. The control nucleic acid product can be an internal control produced in the same assay as the sample nucleic acid product. In general, the control nucleic acid product (and / or its detection) is used to confirm that the assay is performed as expected. Droplet digital PCR (ddPCR) assays allow for absolute quantification of nucleic acids, and the internal control nucleic acid can be used as an internal reference control for the amount of input genomic DNA material and / or can assess the relative abundance (relative to the control sequence of the control nucleic acid) of the target sequence (e.g., there is an inversion) signal of each genome. The external control measured by ddPCR includes a negative external control (e.g., a nucleic acid without a target sequence) and a positive external control (e.g., a nucleic acid with a target sequence), which helps to ensure the appropriate performance and reliability of the results of the sample assay.

[0065] As used herein, "genomic abnormality", "genome abnormality" or "chromosomal abnormality" refers to a variant, abnormality, distortion or mutation in a genome relative to a reference genome. Such abnormalities or variants may occur in the form of point mutations or chromosomal structural variations. Structural variations include but are not limited to deletions, insertions, inversions, duplications (e.g., tandem or interspersed) and translocations. Such changes may be balanced or unbalanced. As used herein, chromosomal structural variation refers to a chromosomal structural change that occurs and / or is detected in the genome of a cell compared to the chromosomal structure of a wild-type genome. In some embodiments, the cell is an engineered cell (e.g., an immune cell, such as a CAR T cell). In some embodiments, the cell is a CAR T cell. In other embodiments, the CAR T cell is an allogeneic CAR T cell derived from a donor cell. In further embodiments, the CAR T cell is an autologous CAR T cell derived from a subject who will eventually receive the engineered cell.

[0066] In some embodiments, chromosome structural variation includes chromosome inversion. In some embodiments, chromosome structural variation includes chromosome translocation. Inversion or chromosome inversion refers to a chromosome rearrangement in which a segment of a chromosome is inverted end to end. When a single chromosome undergoes double-stranded DNA breaks and rearrangements within the same chromosome, an inversion may occur. Chromosome translocation refers to a type of chromosomal abnormality in which a chromosome breaks and a portion of it reattaches to a different chromosome.

[0067] As used herein, the term "biological sample" or "sample" refers to a composition obtained from an individual subject or patient or derived from an individual subject or patient, wherein the composition comprises a cell colony. In one embodiment, the cell colony is suspected of containing or containing one or more cells with a variant or genomic abnormality. The individual can be a donor (e.g., a healthy individual) or a patient (before, during or after treatment with a therapeutic agent, such as a cell therapy agent). Different types of biological samples include but are not limited to blood, peripheral blood mononuclear cells (PBMC), bone marrow and tissue biopsy. Biological samples can be obtained from an individual before, during or after treatment. The sample can include any number of molecules from a cell colony, such as nucleic acids and / or proteins.

[0068] As used herein, the term "molecular composition" generally refers to macromolecules contained in or from cells or cell colonies.Molecular composition can include nucleic acids, such as RNA or DNA.DNA can be a genomic deoxyribonucleic acid (gDNA) molecule, which can be fragmented (e.g., enzymatic fragmentation).RNA can be (i) coding or non-coding, or (ii) messenger RNA (mRNA), ribosomal RNA (rRNA) transfer RNA (tRNA), 5.8S ribosomal RNA (rRNA), 5SrRNA, transfer RNA (tRNA), microRNA (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNA), Piwi interacting RNA (piRNA), small RNA (tsRNA) derived from tRNA, RNA (srRNA) derived from small rDNA, clustered regularly spaced short palindromes (CRISPR) RNA molecules (crRNA) or single guide RNA (sgRNA).RNA can be a transcript, or it can be double-stranded RNA or single-stranded RNA.RNA can be circular RNA.Molecular composition can include proteins, peptides or polypeptides.

[0069] Analysis of cell populations

[0070] On the one hand, the present disclosure provides methods, assays, systems, compositions and kits for detecting (and / or quantifying or counting) one or more nucleic acid products produced by nucleic acids of a cell population, such as engineered cells and / or cells obtained from a patient or subject. In general, nucleic acid products are produced by engineered cells (or cells of a biological sample) and / or genomic DNA (gDNA) extracted from engineered cells (or cells of a biological sample) or fragments thereof. In one embodiment, the engineered cells (or cells from a biological sample) include genomic anomalies or variants, wherein the sequence information about the genomic anomalies or variants is known. For example, the sequence information corresponding to the first breakpoint and / or the second breakpoint of a chromosome inversion may be known, so that primers and probe molecules may be designed to detect inversions, for example, by amplification methods.

[0071] In one embodiment, the nucleic acid product produced by the method described herein includes a sequence corresponding to one or more variants or genomic abnormalities. In another embodiment, the cell colony includes one or more engineered cells. The engineered cell can be an engineered immune cell, such as a chimeric antigen receptor T (CAR T) cell. The detection of a nucleic acid product (e.g., a product including a sequence corresponding to one or more variants or genomic abnormalities) can provide important information about a cell colony (e.g., a cell colony including engineered cells, including engineered immune cells) before or after it is formulated as a drug product or before it is applied to a subject as part of a drug product. In addition, detecting such nucleic acid products in cells from patients or subjects who have applied engineered cells (e.g., engineered immune cells) can provide valuable information about cells during and / or after a treatment regimen. For example, the disclosed method allows for the detection of nucleic acid products during and / or after the application of engineered cells as a part of a drug product as a part of a drug product. In addition, the detection of variants or genomic abnormalities in a cell colony from a subject or patient can be performed after the application of a first engineered cell colony but before the application of a second engineered cell colony. The patient cell population being tested may include immune cells that are part of a clonal population of the administered engineered cell population, such as a clonal population of CAR T cells after in vivo expansion.

[0072] In one other aspect, the present disclosure provides assays, methods, systems, kits and compositions for analyzing, characterizing or screening one or more donor cell populations prior to any engineering.

[0073] In one embodiment, a screening method or assay is provided for two or more different donor cell populations, two or more engineered cell populations, and / or two or more cell populations obtained from a subject or patient to which at least one engineered cell population has been administered.

[0074] Sample preparation

[0075] Different protocols can be used to prepare suitable samples for the methods and assays described herein. Sample preparation will generally involve any appropriate manipulation of the sample, including but not limited to collection, lyophilization, freezing, extraction, purification, concentration, dilution or any combination thereof. Sample preparation may further include adding a biological sample to form a mixture, such as a reaction mixture, with one or more assay reagents, and / or running at least one upstream reaction to prepare a biological sample for one or more downstream reactions in the assay. Sample preparation may extract and / or separate one or more molecular analytes, such as nucleic acids comprising one or more target sequences, and may include additional manipulations, such as nucleic acid modification and / or nucleic acid fragmentation.

[0076] In one embodiment, the methods described herein include processing a cell population to obtain (e.g., extract or separate) nucleic acids. The processing may include any number of different steps and / or techniques, depending on a number of factors, including but not limited to, the nature of the cell population, the type of nucleic acid of interest, and the type of dPCR method to be used. In general, the processing will include a nucleic acid purification step and / or a subsequent dilution or concentration step. Nucleic acid purification methods are well known in the art and include but are not limited to homogenization, washing, centrifugation, extraction, etc.

[0077] The biological sample that comprises cell colony can be destroyed by the different techniques that comprise physical force (for example, polytron, grinding or freezing) or chemical method (for example, cell lysis).Homogenization scheme can comprise the use of detergent or chaotropic agent.The extraction of nucleic acid can be realized by using acid phenol / chloroform, filter, glass particles or chromatography (for example, having suitable nucleic acid as binding partner).Optionally, the extracted nucleic acid can be further processed to remove pollutant and / or nucleic acid (for example, not concerned about and / or may affect the nucleic acid molecule of the analysis of the nucleic acid molecule of being concerned about).Potent can be removed using enzyme such as DNA enzyme, RNA enzyme and / or protease, or the nucleic acid molecule of being concerned about can be protected with suitable reagent such as DNA enzyme inhibitor or RNA enzyme inhibitor.

[0078] On the one hand, nucleic acid from the cell population is extracted for analysis. In one embodiment, the extracted nucleic acid (e.g., genomic DNA) is fragmented before further processing. In one embodiment, the fragmentation of nucleic acid can include random shearing or use enzymes such as nucleases or transposases.

[0079] On the other hand, methods, methods, assays, systems, compositions and kits for detecting (and / or quantifying or counting) one or more nucleic acid products can be applicable to stored (e.g., fixed) biological samples. When the biological sample is removed from its living environment, such as a subject or a cell culture bottle, degradation begins immediately. The rate of decay is affected by many factors, such as time, temperature, solution buffer conditions, the origin or source of the sample, and physical manipulation (e.g., pipetting, centrifugation). Therefore, as described herein, it may be advantageous to stabilize the biological sample obtained from an individual patient or subject. Fixation methods can be used to preserve or stabilize the sample immediately after removal from the individual. Different preservation methods for biological samples include, but are not limited to, dehydration (e.g., methanol), cryopreservation, high salt storage (e.g., using RNAssist or ) and treated with a chemical fixative. In general, chemical fixatives (e.g., paraformaldehyde) produce covalent crosslinks in the molecular composition of the sample. Different techniques for stabilizing biological samples can be used alone or in combination. In one embodiment, fixing a biological sample refers to a fixed cell population, which means cells that have been contacted with a fixative under conditions sufficient to allow or result in the formation of intramolecular and intermolecular covalent crosslinks between biomolecules in the biological sample.

[0080] Detection of nucleic acid targets

[0081] In other embodiments, the biological sample is treated by combining the biological sample with one or more reagents to provide a reaction mixture including nucleic acids from the biological sample for performing nucleic acid reactions, such as nucleic acid extension reactions, such as amplification reactions. The nucleic acid reaction can be specific to one or more target sequences, and the result of the reaction can be reported, such as whether the reaction occurs within a certain range or at a certain threshold. The reaction mixture reagents include, but are not limited to, primer molecules for nucleic acid targets (e.g., one or more pairs of primer molecules for the target), probe molecules (e.g., one or more sequences, such as one or more probes for the target sequence), one or more enzymes (e.g., polymerases, ligases, reverse transcriptases, restriction enzymes, or any combination thereof) and dNTPs and / or NTPs.

[0082] As described herein, the reaction mixture may include a set of reagents sufficient to perform one or more nucleic acid reactions. The set of reagents may be sufficient to perform nucleic acid reactions to produce nucleic acid extension products, thereby allowing detection of one or more nucleic acid target sequences (if present) in a biological sample. As described herein, detection of nucleic acid extension products may be performed using probe molecules. The probe molecules may include sequences complementary to the sequences of nucleic acid extension products (e.g., target sequences of nucleic acid extension products) and labels. Different probe molecules may be present in the reaction mixture to detect different target sequences in different nucleic acid extension products. Alternatively, the same probe molecule may be present in the reaction mixture to detect different nucleic acid extension products with different target sequences. For example, the same reporter gene molecule may include a sequence complementary to the sequence of one or more primer molecules used to produce nucleic acid extension products.

[0083] On the other hand, the disclosure relates to detecting more than one nucleic acid target or nucleic acid target sequence from a nucleic acid molecule of a biological sample from a cell colony. Nucleic acid target or target sequence can be present on a single-stranded or double-stranded nucleic acid template. Target and / or target sequence can be a part of a surrogate molecule, such as a nucleic acid molecule (such as a primer molecule), which can be coupled to a nucleic acid template, for example, via hybridization, and / or can correspond to a target or target sequence. Nucleic acid templates can include at least a portion or all of a target or target sequence that forms a nucleic acid template. In one other embodiment, target or target sequence corresponds to a nucleic acid extension product (e.g., an amplicon) produced by a nucleic acid extension reaction as described herein. Nucleic acid extension products can be partial or complete single-stranded or double-stranded nucleic acid products.

[0084] In one embodiment, more than one nucleic acid target or nucleic acid target sequence that can be detected includes a target or target sequence corresponding to a variant or genomic abnormality, such as chromosome 7 and / or 14 variants or genomic abnormalities. In other embodiments, variants or genomic abnormalities include chromosomal inversions with two breakpoints. The method disclosed herein may include detecting a first nucleic acid target or target sequence corresponding to a first breakpoint of an inversion and / or a second nucleic acid target or target sequence corresponding to a second breakpoint of an inversion. In another embodiment, the first breakpoint is located at or near the T cell receptor junction gene TRAJ7 (e.g., 14q11) of chromosome 14, and the second breakpoint is located at or near the immunoglobulin heavy chain variable region pseudogene (IGHV3-69-1) (e.g., 14q32) of chromosome 14. In another embodiment, the first breakpoint is located at or near the T cell receptor γ chain gene (e.g., 7p13) of chromosome 7, and the second breakpoint is located at or near the T cell receptor β chain (e.g., 7q35) of chromosome 7.

[0085] In one aspect, the present disclosure relates to detecting a genomic region of a cell from a cell population, the cell population comprising one or more genomic anomalies or variants, such as inversions that occur due to recombination activating gene (RAG)-mediated activity. In one embodiment, the site of the inversion is characterized by the presence of one or more common RAG recombination signal sequences (RSS). In one embodiment, the genomic anomaly or variant comprises an inversion of a first gene and a second gene, wherein the first gene and the second gene each comprise an adjacent common RSS. In one other embodiment, the first gene is TRAJ7 including an adjacent RSS-12 sequence, and the second gene is IGHV3-69-1 including an adjacent RSS-23 sequence (see 12 / 23 Rule - van Gent et al. The RAG1 and RAG2 Proteins Establish the 12 / 23 Rule in V(D)J Recombination, Cell 85(1), 107-113, 10.1016 / s0092-8674(00)81086-7 (1996)). In one embodiment, the consensus RSS generally comprises a conserved heptamer (consensus 5'-CACAGTG-3') and nonamer (consensus 5'-ACAAAAACC-3') sequence separated by 12 (RSS-12) or 23 (RSS-23) nucleotides of variable sequence. An exemplary RSS is depicted below.

[0086] CACAGTGX A CACAGTGX A CACAGTGX A CACAGTGX A CACAGTGX A C ACAGTGX A CACAGTGX A , where X A = 12 to 23 nucleotides (SEQ ID NO: 15).

[0087] ACAAAAACCX A ACAAAAACCX A ACAAAAACCX A ACAAAAACCX A ACAAAAACCX A ACAAAAACCX A ACAAAAACCX A ACAAAAACCX A ACA AAAACCX A , where XA = 12 to 23 nucleotides (SEQ ID NO: 16).

[0088] As discussed in Example 1, chromosome 14 inversions were detected in patients, and a common RAG recombination signal sequence (RSS) was observed at two inversion sites. Without being bound by any theory, the existence of the RSS at the two ends of the inversion supports the following hypothesis: the initial inversion is the result of the V (D) J reorganization of the RAG mediation between 2 distal sites. It is known that TRAJ7 carries adjacent RSS-12 sequences, and IGHV3-69-1 contains adjacent RSS-23 sequences, both of which meet the 12 / 23 standard. It is also observed that the disappearance after the break and before the connection of TRAV38-2DV8 and TRAJ7 and IGHV3-42 and IGHV3-69-1. It has been observed that insertion of signal end fragments generated by RAG proteins almost always produces deletions or other rearrangements of the target DNA (Chatterji, M. et al., Mobilization of RAG-generated signal ends by transposition and insertion in vivo. Mol Cell Biol 26, 1558-1568, doi: 10.1128 / MCB.26.4.1558-1568.2006 (2006)).

[0089] Chromosome 14 inversions have been detected in post-thymic mature T cells of normal individuals and are believed to be mediated by V(D)J recombination mechanisms (Callen, E. et al. Chimeric IgH-TCRalpha / delta translocations in T lymphocytes mediated by RAG. Cell Cycle 8, 2408-2412, doi: 10.4161 / cc.8.15.9085 (2009); Machado, HE et al. Genome-wide mutational signatures of immunological diversification in normal lymphocytes. lymphocytes). BioRxiv, 2021.2004.2029.441939, doi: 10.1101 / 2021.04.29.441939 (2021); Aurias, A. et al. Inversion (14) (q12qter) or (q11.2q32.3): the most frequently acquired rearrangement in lymphocytes. Hum Genet, 71, 19-21, doi: 10.1007 / BF00295660 (1985). In addition, chromosomal breakpoints involving 14q11 and / or 14q32 have been detected (Hecht, F. et al. Fragile sites limited to lymphocytes: molecular recombination and malignancy. Cancer Genet Cytogenet 26, 95-104, doi: 10.1016 / 0165-4608(87)90137-3(1987)).Studies examining chromosomal integrity in normal cultured lymphocytes have revealed four frequent sites of chromosomal breakage: 7p13 (nearby location of the TCRγ chain), 7q35 (location of the TCRβ chain), 14q11 (location of the TCRα chain), and 14q32 (location of the IGH chain), and suggested that these frequent sites serve specifically as fragile sites in normal lymphocytes, as defined by the non-random frequency of chromosomal translocations or inversions associated therewith (Hecht, F. (1987); Welch, JP et al. Non-random occurrence of 7-14 translocations in human lymphocyte cultures. Nature 255, 241-245, doi: 10.1038 / 255241a0 (1975)).

[0090] In another embodiment, the more than one nucleic acid target or nucleic acid target sequence that can be detected further comprises a target or target sequence corresponding to a gene-edited genomic region comprising a variant or genomic abnormality. The gene-edited region can be a region of chromosome 14 and / or chromosome 1. The variant of the gene-edited region of chromosome 14 can be a translocation from chromosome 14 to a gene break of another chromosome (such as chromosome 1). In one embodiment, the translocation is located at a break from the T cell receptor alpha constant (TRAC) gene of chromosome 14 to a gene of chromosome 1 (e.g., the CD52 gene). In another embodiment, the translocation is located at a break from the CD52 gene of chromosome 1 to a gene of chromosome 14 (e.g., the TRAC gene) (see Figure 5 In one embodiment, the TRAC / CD52 translocation is a t(1;14)(p36;q32) translocation.

[0091] In another embodiment, the gene editing region can be a region of chromosome 14 and / or chromosome 15. A variant of the gene editing region of chromosome 14 can be a translocation from chromosome 14 to a gene break of another chromosome (such as chromosome 15). In one embodiment, the translocation is located at the break of the T cell receptor alpha constant (TRAC) gene from chromosome 14 to a gene from chromosome 15 (e.g., beta-2 microglobulin (β2M) gene). In another embodiment, the translocation is located at the break of the β2M gene from chromosome 15 to a gene from chromosome 14 (e.g., TRAC gene).

[0092] In another embodiment, the gene editing region can be a region of chromosome 19 and chromosome 14 or 15. The variant of the gene editing region of chromosome 19 can be a translocation from chromosome 19 to a gene break of another chromosome (such as chromosome 14 or 15). In one embodiment, the translocation is located at the break of the CD70 gene from chromosome 19 to a gene from chromosome 14 (e.g., the TRAC gene from chromosome 14). In another embodiment, the translocation is located at the break of the CD70 gene from chromosome 19 to a gene from chromosome 15 (e.g., the β2M gene from chromosome 15).

[0093] In other embodiments, the gene editing region can be a region of chromosome 15 and chromosome 16. The variant of the gene editing region of chromosome 15 can be a translocation from chromosome 15 to a gene break of another chromosome, such as chromosome 16. In one embodiment, the translocation is located at the break of the β2M gene from chromosome 15 to a gene from chromosome 16 (e.g., the class II major histocompatibility complex transactivator (CIITA) gene on chromosome 16).

[0094] In another embodiment, the method for detecting one or more nucleic acid targets or nucleic acid target sequences further comprises detecting a control sequence. The control sequence can be a sequence from the human ribonuclease P protein subunit p30 (RPP30) gene.

[0095] In one aspect, the invention relates to nucleic acid-based (e.g., digital PCR, such as droplet digital PCR or ddPCR) methods for detecting and / or quantifying one or more variants or genomic abnormalities in a sample using a series of reaction mixtures or multiple partitions. The extension products (e.g., amplicons) generated in the dPCR method can be used to determine the presence of genomic abnormalities or variants in a cell population. In one embodiment, the extension product can be between about 100 bp to about 1000 bp, between about 100 bp to about 950 bp, between about 100 bp to about 900 bp, between about 100 bp to about 850 bp, between about 100 bp to about 800 bp, between about 100 bp to about 750 bp, between about 100 bp to about 700 bp, between about 100 bp to about 650 bp, between about 100 bp to about 600 bp, between about 550 bp to about 500 bp, between about 100 bp to about 450 bp, between about 100 bp to about 400 bp, between about 100 bp to about 350 bp, between about 100 bp to about 300 bp, between about 100 bp to about 200 bp, or between about 100 bp to about 150 bp. In other embodiments, the extension product is about 100 bp, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 550 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 950 bp, or about 1000 bp.

[0096] dPCR is an improved method based on conventional PCR methods, which advantageously allows users to directly quantitatively and clonally amplify different types of nucleic acids, including DNA, cDNA, RNA or a combination thereof. Importantly, compared with conventional PCR (e.g., quantitative PCR or qPCR), the dPCR method for quantifying the amount of nucleic acids is more precise and accurate. dPCR is performed in a single reaction within a biological sample, but the biological sample is separated into a large number of separate partitions or reaction mixtures, in which separate reactions can occur. The method using separate partitions or reaction mixtures is not only more reliable and more sensitive, but also allows for more accurate quantification. The distribution of dPCR samples allows individual nucleic acid molecules to be present in multiple partitions or reaction mixtures, allowing users to estimate the number of nucleic acid molecules by assuming that the molecules follow a Poisson distribution. Each partition or reaction mixture will contain a negative or positive reaction (e.g., "0" or "1", respectively). The results of the dPCR experiment are plotted on a graph of fluorescence intensity and the number of droplets. Based on a fluorescence intensity threshold, all positive droplets are scored as positive (e.g., above the threshold) and are assigned a value of 1, while all negative droplets are scored as negative (e.g., below the threshold) and are assigned a value of 0. After the amplification reaction, the nucleic acid molecules can be quantified based on the count of each individual partition or reaction mixture containing the final product of the positive amplification reaction.While qPCR quantification can depend on PCR amplification efficiency, dPCR does not therefore avoid relying on potentially uncertain exponential data to quantify the target nucleic acid.

[0097] In conventional quantitative PCR, the quantitative results can depend on the amplification efficiency of the PCR process. However, dPCR does not depend on the number of amplification cycles used to determine the initial sample amount, which means that there is less reliance on uncertainty index data to quantify the target nucleic acid, thereby providing absolute quantification.

[0098] Digital PCR, for example, droplet digital PCR, allows multiple detection of many targets simultaneously in different ways, including but not limited to amplitude multiplexing and probe mixing multiplexing. For amplitude multiplexing, the concentration of probe molecules and / or primer molecules can be manipulated so that positive droplets are distinguishable on a two-dimensional (2-D) graph. Probe mixing multiplexing involves detecting a unique signal (e.g., a fluorescent signal) based on different ratios of probes in at least two different fluorescence configurations. For example, two probes with different detectable parts, such as one probe with fluorescein (FAM) and another probe with hexachlorofluorescein (HEX), can be used in the same assay of two different targets or target sequences. The amplification of two different targets can be viewed as a 2-D graph, where FAM fluorescence and HEX fluorescence are plotted for each droplet, which can be in one of the following four groups: FAM+ / HEX-; FAM+ / HEX+; FAM- / HEX+ or FAM- / HEX-. Software can be used to fit the fraction of positive droplets to a Poisson distribution to determine the absolute starting copy number in copies / ul of sample and report the target DNA concentration as copies per ul in sample (QuantaSoft software from Bio-Rad). When compared to amplitude-pooling multiplexing, probe-pooling multiplexing may be more suitable for detecting rare mutations or low-concentration samples. In one embodiment, different detectable moieties can be used to label the nucleic acid probe, including but not limited to 5,6-FAM: 5- and 6-carboxyfluorescein; 6-FAM: 6-carboxyfluorescein; JOE: 6-carboxy-4'-, 5'-dichloro-2'-, 7'-dimethoxy-fluorescein (JOE); 4,7,2',4',5',7'-hexachloro-6-carboxy-fluorescein (HEX); 4,7,2',7'-tetrachloro-6-carboxy-fluorescein (TET); 6-carboxytetramethyl-rhodamine (TAMRA); 2'-chloro-7'phenyl-1,4-dichloro-6-carboxy-fluorescein (VIC); 2'-chloro-5'-fluoro-7',8'-benzo-1,4-dichloro-6-carboxyfluorescein (NED); 5- and 6-carboxy-X-rhodamine (ROX); or any combination thereof.

[0099] Cell population analysis

[0100] In other aspects, the present disclosure relates to the analysis of different cell populations. In one embodiment, the analysis includes using a determination including digital polymerase chain reaction (dPCR), such as droplet dPCR (ddPCR) reaction to detect variants or genome abnormalities in cell populations and / or a screening method for quantifying them. As discussed herein, the method for understanding the degree of variant or genome abnormality in cell populations is valuable, regardless of the cause, such as caused by gene editing off-target effects or not caused by gene editing off-target effects. It may not only be desirable to clarify whether there are variants or genome abnormalities in the cells of biological samples, but also may be necessary to quantify the frequency of occurrence of variants or genome abnormalities (e.g., structural variants, such as chromosome structural variants) in biological samples with high precision and accuracy. Biological samples may include nucleic acids from cell populations (e.g., engineered cell populations and / or cell populations derived from subjects of previously applied engineered cell populations). Screening methods of interest include, but are not limited to, screening (i) donor cells prior to modification or engineering (e.g., by gene editing); (ii) engineered cells (e.g., modified donor cells) that include one or more genomic regions that have been modified; and / or (iii) cells derived from a biological sample obtained from a patient who has been treated with a cell-based therapeutic composition, such as a composition that includes engineered cells.

[0101] On the one hand, the present invention relates to nucleic acid-based (e.g., dPCR) methods for detecting one or more variants or genomic abnormalities in a sample and / or quantifying them by using a series of reaction mixtures or multiple partitions. In one embodiment, the method includes providing a cell colony comprising cells containing engineered cells, such as genetically modified cells, such as genetically modified immune cells. Genetically modified cells may include one or more genomic regions that have been subjected to gene editing.

[0102] In addition, one or more engineered cells from a patient or subject may be suspected of including or including one or more variants or genomic abnormalities, or may include one or more variants or genomic abnormalities. In one embodiment, the one or more variants or genomic abnormalities are known. For example, the sequence information corresponding to the first breakpoint and / or the second breakpoint of a chromosomal translocation may be known, so that primers and probe molecules may be designed to detect translocations, for example, by amplification methods. In other embodiments, variants or genomic abnormalities may be attributed to a genetic modification process (e.g., gene editing), or may exist independently of a genetic modification process. In another embodiment, the one or more variants or genomic abnormalities are present in chromosome 14. In an alternative embodiment, an engineered cell includes chromosome 14, and the chromosome includes one or more variants or genomic abnormalities.

[0103] In a further embodiment, the method includes providing a cell colony comprising immune cells from a biological sample obtained from a patient. The patient may be being treated with or may have previously been treated with an engineered cell drug product, such as a CAR T cell drug product. Immune cells from a biological sample may include immune cells derived from engineered cells previously administered to a patient. For example, immune cells may be part of a clonal population of engineered cells administered, such as a clonal population of a CAR T cell population administered after in vivo amplification. As described herein, the identity of such clones may be determined using methods such as T cell receptor β (TCRB) group library sequencing and single cell methods. Immune cells may include (i) one or more genomic regions corresponding to regions subjected to gene editing in engineered cells and / or (ii) one or more variants or genomic abnormalities. In one embodiment, the one or more variants or genomic abnormalities are known. For example, sequence information corresponding to variants or genomic abnormalities may be known, so that primers and probe molecules may be designed to detect variants, such as by amplification methods. In other embodiments, the variant or genomic abnormality may exist due to the genetic modification process (e.g., gene editing) of the engineered cell, or may exist independently of the genetic modification process of the engineered cell, for example, due to a spontaneous event, such as an event during in vivo expansion. In another embodiment, the one or more variants or genomic abnormalities are present in chromosome 14. In an alternative embodiment, the engineered cell includes chromosome 14, which includes one or more variant genomic abnormalities.

[0104] In a further embodiment, the present disclosure provides a method for detecting variants or genomic abnormalities in engineered immune cells using genomic deoxyribonucleic acid (gDNA) from a cell population including engineered immune cells. Engineered immune cells have chromosome 14, which (i) is suspected of containing or containing variants or genomic abnormalities, and (ii) contains edited genomic regions. One or more gDNA molecules (according to the methods described herein) in the gDNA molecules from engineered immune cells can be tested to determine whether they include variants or genomic abnormalities. In a further embodiment, the method includes subjecting the gDNA molecules to conditions sufficient to produce nucleic acid extension products. The nucleic acid extension products include sequences corresponding to variants or genomic abnormalities or their complements. The method may further include detecting nucleic acid extension products as indicators of variants or genomic abnormalities in engineered immune cells.

[0105] In one aspect, the screening method is a quantitative and / or qualitative method. In one embodiment, the quantitative screening method is a nucleic acid extension assay. In one aspect, the methods, assays, systems, compositions and kits described herein can be used to make engineered cell populations and / or monitor different stages of a patient or subject to whom an engineered cell population has been administered. Figure 6 As shown, a donor cell population 10 can be screened for variants or genomic abnormalities 11 to inform a decision about whether to proceed with one or more modifications of the donor cell population, such as those described herein for use in manufacturing engineered immune cells, such as CAR T cells. If a variant 12 is detected, the donor cell population can be considered to have failed the screening assay. If no variant 13 is detected, the donor cell population can be considered to have passed the screening assay and can move forward in the drug product manufacturing process.

[0106] like Figure 6 As further shown in FIG. 1 , a drug product batch 14 comprising engineered cells can be screened for variants or genomic abnormalities 15 to inform a decision as to whether to advance the drug product batch for administration to a patient or subject. If the variant is detected 16, the drug product batch can be considered to have failed the screening assay. If the variant is not detected 17, the drug product batch can be considered to have passed the screening assay and can be advanced as a drug product batch suitable for administration 18 to a patient or subject.

[0107] In one embodiment, drug product batch 14 may include engineered cells derived from a donor cell population. In another embodiment, the donor cell population may have been previously screened for variants or genomic abnormalities, e.g., Figure 6 Step 11. In some embodiments, the donor cell population can be obtained from a subject who will eventually receive an engineered cell population derived from a donor cell population. For example, the donor cell population can include autologous immune cells obtained from a subject who will eventually receive CART cells derived from a donor cell population. In other embodiments, the donor cell population can be obtained from a donor who is an individual different from the subject who will receive the engineered cell population derived from the donor cell population. For example, the donor cell population can include allogeneic immune cells obtained from a donor who is an individual different from the subject who will receive CAR T cells derived from a donor cell population.

[0108] Screening one or more drug product batches and cells from patients or subjects to whom the one or more drug product batches have been administered can provide valuable information about the occurrence of variants or genomic abnormalities. Figure 6As further shown in, screening 20 for variants or genomic abnormalities in one or more cells from a patient or subject can include a biopsy 19 of a biological sample. In the event that a variant or genomic abnormality is not detected 17 in a batch of a drug product and is subsequently administered to a patient but a variant or genomic abnormality is detected 21 in cells of the same patient after treatment, then this can indicate that the variant appeared in vivo after administration.

[0109] In one embodiment, one or more cells from a patient or subject can be immune cells that are part of a clonal population of an administered engineered cell population, such as a clonal population of CAR T cells after in vivo expansion. In one embodiment, 21 is detected in an engineered immune cell (e.g., CAR T cell) previously administered to a patient and / or in a clonal population of immune cells that emerges after administration (e.g., a clonal population of CAR T cells after in vivo expansion) (see Figure 6 ) variant.

[0110] On the one hand, the present disclosure provides a method for detecting variants or genomic abnormalities during the treatment of a patient or subject. In one embodiment, the method includes producing a drug product including an engineered immune cell colony (e.g., CAR T cell colony), wherein the cell colony includes an edited genome. In another embodiment, the engineered immune cell colony is derived from a donor cell colony. In another embodiment, the method further includes administering a drug product to a patient or subject in need. In another embodiment, the method includes obtaining a biopsy from a patient, wherein the biopsy includes one or more of the following: an engineered immune cell or an immune cell as a part of a clonal colony of an engineered immune cell colony administered. The method may further include detecting variants or genomic abnormalities in one or more cells from a biopsy. In one embodiment, the method further includes detecting variants or genomic abnormalities in engineered immune cells from a drug product batch and / or a donor cell colony.

[0111] Before screening for genomic abnormalities or variants, batches of drug products and / or cells from patients can be subjected to other screening methods. For example, cells can be subjected to G banding (or Giemsa banding), which is a cytogenetic technique for producing visible karyotypes by staining condensed chromosomes. Cells can also be subjected to fluorescence in situ hybridization (FISH), which allows visualization and mapping of genetic material in individual cells, including parts of specific genes or genes. FISH assays utilize probes with attached fluorescent reporter molecules, which, when observed under a fluorescent microscope, can anneal to specific target sequences of nucleic acids from cells to confirm the presence or absence of specific genetic abnormalities or variants. If the presence of genomic abnormalities or variants is suspected based on the results of G banding or FISH assay results, one or more genomic abnormalities or variants of cells can be screened.

[0112] In addition, the drug product batch and / or cells from the patient can be subjected to cell proliferation assays. For example, IL-2 independent proliferation assays can be used to evaluate any abnormal proliferation of engineered cells of drug product batches, such as CAR T cells. In the absence of target activation of CAR T cells and the absence of IL-2, CAR T cells are not expected to proliferate. In one embodiment, the sensitivity of the cell proliferation assay is about 1 abnormal cell in about 100,000 cells.

[0113] On the one hand, the present disclosure provides a method for detecting genomic abnormalities in engineered cell populations. In one embodiment, the method includes providing a genomic deoxyribonucleic acid (gDNA) molecule from an engineered cell population, wherein the engineered cell population is suspected of including a chromosome 14 inversion, and the chromosome 14 inversion is characterized by a centromere inversion site at a T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at an immunoglobulin heavy chain (IGH) variable region. In another embodiment, the engineered cell population further includes an edited genomic region. In another embodiment, the method includes subjecting the gDNA molecule to a condition sufficient to produce a nucleic acid extension product, wherein the nucleic acid extension product includes a sequence corresponding to the chromosome 14 inversion or its complement. In another embodiment, generating a nucleic acid extension product includes extending the nucleic acid with a primer molecule. In one embodiment, the primer molecule includes a pair of primer molecules. In another embodiment, the pair of primer molecules includes SEQ ID NO: 1 and 2, wherein the pair of primer molecules corresponds to a telomeric inversion site. In another embodiment, the pair of primer molecules include SEQ ID NO: 4 and 5, wherein the pair of primer molecules correspond to the centromere inversion site. In a further embodiment, the method includes the step of detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the engineered cell population. In one embodiment, the detection includes the use of a probe molecule specific for the nucleic acid extension product. The nucleic acid extension product may correspond to a telomeric inversion site, wherein the probe molecule includes SEQ ID NO: 3. Alternatively, the nucleic acid extension product may correspond to a centromere inversion site, wherein the probe molecule includes SEQ ID NO: 6.

[0114] Single-cell methods for detecting nucleic acid products

[0115] As further described herein, the engineering of cells generally utilizes different genetic modification methods, including gene editing techniques. Off-target effects in gene editing are undesirable, and there are significant risks in the development of clinical cell therapy products. Although mixed pool next generation sequencing technology is a valuable tool for identifying potential off-target effects, the genetic heterogeneity of cell populations at the single cell level may be obscured by the average reading provided by mixed pool measurements. Rare events within and throughout the cell population may not be detected with such average signals. Therefore, it may be advantageous to detect one or more variants or genomic abnormalities in one or more cells at the single cell level. In one embodiment, single cell RNA sequencing (scRNA-seq), single cell DNA sequencing (scDNA-seq), transposase accessible chromatin (scATAC-seq) determination, protein-based single cell techniques (e.g., CITE-seq and REAP-seq) and combinations thereof may be used. Different single-cell analysis platforms can be used, including droplet-in-emulsion approaches (e.g., Chromium instrument - 10x Genomics, Tapestri instrument - Mission Bio) and pore-based approaches (e.g., BD Rhapsody - Becton Dickinson, Singleron Matrix - Singleron Biotechnologies).

[0116] On the other hand, the present disclosure provides methods, compositions, systems and kits for producing one or more barcoded nucleic acid molecules from a cell population including engineered cells, wherein the engineered cells are suspected of including or including one or more variants or genomic abnormalities. In some embodiments, one or more barcoded nucleic acid molecules correspond to nucleic acids or protein components of a single cell (e.g., a single engineered cell) in a cell population. In one embodiment, one or more barcoded nucleic acid molecules include a barcode sequence corresponding to a single cell and a sequence corresponding to a region of genomic deoxyribonucleic acid (gDNA). The region of gDNA may include one or more variants or genomic abnormalities. One or more barcoded nucleic acid molecules may further include a barcode sequence corresponding to a single cell and a sequence corresponding to a protein component of a single cell. Protein components may include extracellular surface proteins, intracellular proteins or proteins secreted from a single cell. As further described herein, in one embodiment, a protein component includes one or more regions of a chimeric antigen receptor (CAR), including but not limited to an antigen binding domain (e.g., a scFV domain), a transmembrane domain and an intracellular domain (e.g., a domain including an immune cell activation domain). In another embodiment, CAR is a part of an engineered immune cell from a cell colony. In other embodiments, a single cell (e.g., a single engineered cell) of a cell colony includes a protein marker with a nucleic acid reporter molecule. Nucleic acid reporter molecules may include identification or correspond to a nucleic acid sequence of a target of a protein marker and / or a protein marker.

[0117] In additional embodiments, the one or more barcoded nucleic acid molecules may further include a barcode sequence corresponding to a single cell and a sequence corresponding to a ribonucleic acid (RNA) sequence (e.g., messenger RNA or mRNA transcript) of a single cell. In one other embodiment, the RNA sequence corresponds to a sequence corresponding to a region of genomic deoxyribonucleic acid (gDNA). The region of gDNA may include one or more variants or genomic abnormalities.

[0118] In other embodiments, one or more barcoded nucleic acid molecules may include a barcode sequence corresponding to a single cell and a sequence corresponding to (or indicating) a region of accessible (or open) chromatin of a single cell. The region of accessible (or open) chromatin may include one or more variants or genomic abnormalities. In additional embodiments, one or more barcoded nucleic acid molecules further include (i) a barcode sequence corresponding to a single cell and a sequence corresponding to a ribonucleic acid (RNA) sequence (e.g., messenger RNA or mRNA transcript) of a single cell and / or (ii) a barcode sequence corresponding to a single cell and a sequence corresponding to a protein component of a single cell.

[0119] In other embodiments, one or more barcoded nucleic acid molecules DNA may include a barcode sequence corresponding to a single cell and a sequence corresponding to a region of genomic DNA. Genomic DNA (gDNA) from cells having or suspected of having genomic abnormalities, such as engineered cells, can be processed using a single cell method. In one embodiment, the method comprises providing a single cell lysate comprising gDNA from engineered cells (such as engineered immune cells). The single cell lysate is then isolated or divided into partitions having primer molecules targeting regions corresponding to genomic abnormalities and nucleic acid molecules comprising barcode sequences and capture sequences. In another embodiment, the method further comprises the step of generating a barcoded nucleic acid molecule, the barcoded nucleic acid molecule comprising a barcode sequence or its complement and a sequence corresponding to the region or its complement.

[0120] In another embodiment, the generation step includes using primer molecules and gDNA to produce nucleic acid products. The nucleic acid product may include a sequence complementary to the capture sequence. In one other embodiment, the generation step includes hybridizing the nucleic acid barcode molecule with the nucleic acid product via a sequence complementary to the capture sequence. In some embodiments, the generation step further includes an extension of the sequence complementary to the capture sequence to produce a barcoded nucleic acid molecule. The generation step may include using additional primer molecules to produce nucleic acid products. Extension may further include using additional primer molecules to produce barcoded nucleic acid molecules. In other embodiments, the generation step includes nucleic acid amplification.

[0121] In some embodiments, the partition is a droplet or a hole and / or the partition is between multiple partitions. In one embodiment, the barcode sequence is specific to the partition. In other embodiments, the genomic abnormality is located at chromosome 14. Engineered cells (e.g., engineered immune cells) can be chimeric antigen receptor T (CAR-T) cells. In addition, the cell colony can further include other engineered immune cells without genomic abnormalities. In other embodiments, the cell colony is analyzed before being applied to the subject. In another embodiment, the cell colony is derived from a biological sample obtained from a subject previously applying engineered cells, comprising engineered immune cells. In one embodiment, the biological sample is a bone marrow sample or a peripheral blood sample. Engineered cells may have been derived from donor immune cells. In one embodiment, a sample is obtained between about 5 days to about 60 days after applying engineered cells (comprising engineered immune cells).

[0122] Immune cells

[0123] Cells suitable for the methods and / or reagents described herein include immune cells. Before in vitro manipulation or genetic modification (e.g., as described herein), cells (e.g., immune cells) used for the methods described herein can be obtained from subjects. Cells can be obtained from multiple non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, stem cells or iPSC-derived immune cells, tissues from infection sites, ascites, pleural effusions, spleen tissues and tumors. In some embodiments, any number of available and known T cell lines of technicians in the field can be used. In some embodiments, cells can be derived from healthy donors, from patients diagnosed with cancer, or from patients diagnosed with infection. In some embodiments, cells can be part of a mixed cell population presenting different phenotypic characteristics.

[0124] In some embodiments, the immune cells are autologous immune cells obtained from the subject that will ultimately receive the engineered immune cells. In some embodiments, the immune cells are allogeneic immune cells obtained from a donor that is a different individual than the subject that will receive the engineered immune cells.

[0125] In some embodiments, immune cells include T cells. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells (PBMC), bone marrow, lymph node tissue, cord blood, thymus tissue, stem cells or iPSC-derived T cells, tissue from the site of infection, ascites, pleural effusion, spleen tissue and tumors. In some embodiments, any number of techniques known to the skilled person can be used, such as FICOLL TM Isolate and obtain T cells from a volume of blood collected from a subject.

[0126] Cells can be obtained from the circulating blood of an individual by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells, and platelets. In some embodiments, the cells collected by apheresis can be washed to remove the plasma fraction, and the plasma fraction is placed in an appropriate buffer or culture medium for subsequent processing.

[0127] Using methods as described herein, PBMC can be directly used for the genetic modification of immune cells (such as CAR or TCR). In certain embodiments, after separating PBMC, T lymphocytes can be further separated, and cytotoxic and helper T lymphocytes can be sorted into primary, memory and effector T cell subsets before or after genetic modification and / or amplification.

[0128] In some embodiments, for example, using PERCOLL TMGradient centrifugation, by lysing red blood cells and removing monocytes, separates T cells from PBMC. T cells, such as CCR7+, CD95+, CD122, CD27+, CD69+, CD127+, CD28+, CD3+, CD4+, CD8+, CD25+, CD62L+, CD45RA+ and CD45RO+T cells can be further separated by positive or negative selection techniques known in the art. For example, the enrichment of T cell colonies by negative selection can be achieved by a combination of antibodies for surface markers unique to cells selected for negative selection. One of the methods used herein is to sort cells and / or select by negative magnetic immunoadhesion or flow cytometry, which uses a monoclonal antibody mixture for cell surface markers present on cells selected for negative selection. For example, in order to enrich for CD4+ cells by negative selection, a monoclonal antibody mixture generally includes antibodies for CD14, CD20, CD11b, CD16, HLA-DR and CD8. Flow cytometry and cell sorting can also be used to isolate cell populations of interest for use in the present disclosure.

[0129] In some embodiments, the T cell population is enriched for CD4+ cells.

[0130] In some embodiments, the T cell population is enriched for CD8+ cells.

[0131] In some embodiments, CD8+ cells are further sorted into primary, central memory, and effector cells by identifying cell surface antigens associated with each of these cell types. In some embodiments, the expression of phenotypic markers of primary T cells comprises CD45RA+, CD95-, IL2Rβ-, CCR7+, and CD62L+. In some embodiments, the expression of phenotypic markers of stem cell memory T cells comprises CD45RA+, CD95+, IL2Rβ+, CCR7+, and CD62L+. In some embodiments, the expression of phenotypic markers of central memory T cells comprises CD45RO+, CD95+, IL2Rβ+, CCR7+, and CD62L+. In some embodiments, the expression of phenotypic markers of effector memory T cells comprises CD45RO+, CD95+, IL2Rβ+, CCR7-, and CD62L-. In some embodiments, the expression of phenotypic markers of T effector cells comprises CD45RA+, CD95+, IL2Rβ+, CCR7-, and CD62L-. Thus, CD4+ and / or CD8+ T helper cells can be sorted into naive, stem cell memory, central memory, effector memory, and T effector cells by identifying cell populations that have cell surface antigens.

[0132] It should be understood that PBMCs may further comprise other cytotoxic lymphocytes, such as NK cells or NKT cells. Expression vectors carrying coding sequences of chimeric receptors as disclosed herein may be introduced into populations of human donor T cells, NK cells or NKT cells. Standard procedures are used to cryopreserve CAR-expressing T cells for storage and / or preparation for human subjects. In one embodiment, in vitro transduction, culture and / or expansion of T cells are performed in the absence of non-human animal-derived products, such as fetal bovine serum (fetal calf serum / fetalbovine serum). In various embodiments, cryopreservation medium may include, for example CS2, CS5 or CS10 or other culture medium including DMSO, or culture medium excluding DMSO.

[0133] Engineered immune cells

[0134] Provided herein are engineered immune cells (e.g., CAR-T cells) expressing the CARs of the present disclosure.

[0135] In some embodiments, the engineered immune cells include a CAR population, each CAR including an extracellular antigen binding domain. In some embodiments, the engineered immune cells include a CAR population, each CAR including a different extracellular antigen binding domain. In some embodiments, the immune cells include a CAR population, each CAR including the same extracellular antigen binding domain.

[0136] The engineered immune cells can be allogeneic or autologous.

[0137] In some embodiments, the engineered immune cells are T cells (e.g., inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, helper T lymphocytes, or tumor infiltrating lymphocytes (TIL)), NK cells, NK-T cells, TCR expressing cells, dendritic cells, killer dendritic cells, mast cells, or B cells. In some embodiments, the cells may be derived from a group consisting of CD4+T lymphocytes and CD8+T lymphocytes. In some exemplary embodiments, the engineered immune cells are T cells. In some exemplary embodiments, the engineered immune cells are αβT cells. In some exemplary embodiments, the engineered immune cells are γδT cells. In some exemplary embodiments, the engineered immune cells are macrophages. In some embodiments, the engineered immune cells are human cells.

[0138] In some embodiments, the engineered immune cells can be derived from, for example but not limited to, stem cells. Stem cells can be adult stem cells, non-human embryonic stem cells, more specifically non-human stem cells, umbilical cord blood stem cells, progenitor cells, bone marrow stem cells, induced pluripotent stem cells (iPSCs), totipotent stem cells, or hematopoietic stem cells. Stem cells can be CD34+ or CD34-.

[0139] In some embodiments, the cell is obtained from peripheral blood or prepared therefrom. In some embodiments, the cell is obtained from peripheral blood mononuclear cells (PBMC) or prepared therefrom. In some embodiments, the cell is obtained from bone marrow or prepared therefrom. In some embodiments, the cell is obtained from umbilical cord blood or prepared therefrom. In some embodiments, the cell is a human cell. In some embodiments, a method selected from the group consisting of the following items is used to transfect or transduce cells by a nucleic acid vector: electroporation, sonoporation, biolistics (e.g., gene gun), transfection, lipofection, polymer transfection, nanoparticles, viral transduction or viral transfection (e.g., retrovirus, slow virus, AAV) or polymer complex (polyplex). In some embodiments, the cell is a T cell that has been reprogrammed from a non-T cell. In some embodiments, the cell is a T cell that has been reprogrammed from a T cell.

[0140] Binder

[0141] In embodiments, the disclosed methods include the use of antibodies or antigen binding agents (eg, including antigen binding domains or including antibodies or fragments thereof). As discussed below, in various embodiments, the engineered immune cells may additionally include a binding agent.

[0142] As used herein, the term "antibody" refers to a polypeptide comprising canonical immunoglobulin sequence elements sufficient to confer specific binding to a specific target antigen. As known in the art, a complete antibody produced in nature is a tetrameric reagent of approximately 150 kD, comprising two identical heavy chain polypeptides (each about 50 kD) and two identical light chain polypeptides (each about 25 kD), which are associated with each other into a structure generally referred to as a "Y-shape". Each heavy chain comprises at least four domains (each about 110 amino acids in length) - these four domains are the amino-terminal variable (VH) domain (located at the end of the Y structure), followed by three constant domains: CHI, CH2, and carboxyl-terminal CH3 (located at the base of the stem of the Y). The short region is called a "switch" that connects the heavy chain variable region to the constant region. The "hinge" connects the CH2 and CH3 domains to the rest of the antibody. Two disulfide bonds in this hinge region connect the two heavy chain polypeptides in the complete antibody to each other. Each light chain comprises two domains - the two domains are an amino-terminal variable (VL) domain followed by a carboxyl-terminal constant (CL) domain. Those skilled in the art are very familiar with antibody structure and sequence elements, recognize the "variable" and "constant" regions in the provided sequences, and understand that there can be some flexibility in defining the "borders" between these domains, so that different presentations of the same antibody chain sequence can, for example, mean that such borders at a certain position are offset by one or a few residues relative to different presentations of the same antibody chain sequence.

[0143] The complete antibody tetramer contains two heavy chain-light chain dimers, in which the heavy chain and the light chain are connected to each other by a single disulfide bond; the other two disulfide bonds connect the heavy chain hinge region to each other, so that the dimers are connected to each other and form a tetramer. Naturally produced antibodies are also glycosylated, usually on the CH2 domain. Each domain in a natural antibody has a structure characterized by an "immunoglobulin fold", which is formed by stacking two β folds (e.g., 3, 4 or 5 chain folds) in a compressed antiparallel β barrel. Each variable domain contains three hypervariable loops called "complement determining regions" (CDR1, CDR2 and CDR3) and four slightly unchanged "framework" regions (FR1, FR2, FR3 and FR4). When the natural antibody is folded, the FR region forms a β fold that provides a structural framework for the domain, and the CDR loop regions of the heavy and light chains are gathered together in three-dimensional space, thereby producing a single hypervariable antigen binding site located at the end of the Y structure. The Fc region of a naturally occurring antibody binds to elements of the complement system and also to receptors on effector cells (including, for example, effector cells that mediate cytotoxicity). As is known in the art, the affinity and / or other binding properties of the Fc region for Fc receptors can be modulated by glycosylation or other modifications. In some embodiments, antibodies produced and / or employed in accordance with the present invention comprise a glycosylated Fc domain, including Fc domains having modified or engineered such glycosylation.

[0144] For the purposes of this disclosure, in certain embodiments, any polypeptide or polypeptide complex comprising sufficient immunoglobulin domain sequences present in natural antibodies may be referred to and / or used as an "antibody", whether such polypeptide is produced naturally (e.g., by an organism reacting with an antigen) or produced by recombinantly engineered, chemically synthesized, or other artificial systems or methods. In some embodiments, the antibodies are polyclonal; in some embodiments, the antibodies are monoclonal. In some embodiments, the antibodies have constant region sequences that are characteristic of mouse, rabbit, primate, or human antibodies. In some embodiments, antibody sequence elements are humanized, primatized, chimeric, etc., as known in the art.

[0145] In addition, as used herein, the term "antibody" may refer to any of the constructs or forms known or developed in the art for utilizing antibody structural and functional characteristics in alternative presentation. For example, in some embodiments, the form of the antibody used in the methods of the present disclosure is selected from, but not limited to: a complete IgA, IgG, IgE, or IgM antibody; a bispecific or multispecific antibody (e.g., , etc.); antibody fragments, such as Fab fragments, Fab fragments, F(ab)2 fragments, Fd fragments and isolated CDRs or collections thereof; single chain variable fragments (scFV); polypeptide-Fc fusions; single domain antibodies (e.g., shark single domain antibodies, such as IgNAR or fragments thereof); camelid antibodies (also referred to herein as nanobodies or VHH); shark antibodies, masked antibodies (e.g., ); Small modular immunopharmaceuticals (SMIPs) TM ); single-chain or tandem bivalent antibodies VHH; microantibodies; Ankyrin repeat protein or DART;TCR-like antibody; microprotein; and In some embodiments, the antibody may lack covalent modifications (e.g., attachment of polysaccharides) that are present in nature. In some embodiments, the antibody may contain covalent modifications (e.g., attachment of polysaccharides), payloads (e.g., detectable moieties, therapeutic moieties, catalytic moieties, etc.), or other side groups (e.g., polyethylene glycol, etc.).

[0146] As used herein, the term "antibody agent" generally refers to an agent that specifically binds to a specific antigen. In some embodiments, the term encompasses any polypeptide or polypeptide complex comprising an immunoglobulin structural element sufficient to confer specific binding. Exemplary antibody agents include, but are not limited to, monoclonal antibodies or polyclonal antibodies. In some embodiments, an antibody agent may comprise one or more constant region sequences having the characteristics of a mouse, rabbit, primate, or human antibody. In some embodiments, an antibody agent may comprise one or more sequence elements that are humanized, primatized, chimeric, etc., as known in the art. In a number of embodiments, the term "antibody agent" is used to refer to one or more of the constructs or forms known or developed in the art for utilizing antibody structure and functional characteristics in alternative presentation. For example, the form of the antibody agent used according to the present invention is selected from, but is not limited to: a complete IgA, IgG, IgE, or IgM antibody; a bispecific or multispecific antibody (e.g., etc.); antibody fragments, such as Fab fragments, Fab' fragments, F(ab')2 fragments, Fd fragments and isolated CDRs or collections thereof; single-chain Fv; polypeptide-Fc fusions; single-domain antibodies (e.g., shark single-domain antibodies, such as IgNAR or fragments thereof); camel antibodies; masked antibodies (e.g., ); Small modular immunopharmaceuticals (SMIPs) TM ); single-chain or tandem bivalent antibodies VHH; microantibodies; Ankyrin repeat protein or DART;TCR-like antibody; microprotein; and

[0147] The antibody or antibody agent for carrying out the method of the present disclosure can be single-stranded or double-stranded. In certain embodiments, the antibody or antigen-binding molecule is single-stranded. In certain embodiments, the antigen-binding molecule is selected from the group consisting of the following: scFv, Fab, Fab', Fv, F(ab')2, dAb and any combination thereof.

[0148] Antibodies and antibody agents include antibody fragments. Antibody fragments include a portion of a complete antibody, such as the antigen binding or variable region of a complete antibody. Antibody fragments include, but are not limited to, Fab, Fab', Fab'-SH, F(ab')2, Fv, bifunctional antibodies, linear antibodies, multispecific antibodies formed by antibody fragment antibodies and scFv fragments and other fragments. Antibodies also include, but are not limited to, polyclonal, monoclonal, chimeric dAb (domain antibodies), single chain, Fab, Fa, F(ab')2 fragments and scFv. Antibodies can be complete antibodies, or immunoglobulins, or antibody fragments. Antibody fragments can be prepared by a variety of techniques, including, but not limited to, proteolytic digestion of complete antibodies and production by recombinant host cells (e.g., Escherichia coli (E. coli), Chinese hamster ovary (CHO) cells or phages), as known in the art.

[0149] In some embodiments, the antibody or antibody agent may be a chimeric antibody (see, e.g., U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). A chimeric antibody may be an antibody in which a portion of the heavy chain and / or light chain is derived from a particular source or species, while the remainder of the heavy chain and / or light chain is derived from a different source or species. In one example, a chimeric antibody may include a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate (such as a monkey)) and a human constant region. In another example, a chimeric antibody may be a "class-switched" antibody in which the class or subclass has been changed from a parent antibody. A chimeric antibody comprises an antigen-binding fragment thereof.

[0150] In some embodiments, the chimeric antibody can be a humanized antibody (see, e.g., Almagro and Fransson, Front. Biosci., 13:1619-1633 (2008); Riechmann et al., Nature, 332:323-329 (1988); Queen et al., Proceedings of the National Academy of Sciences of the United States of America, 86:10029). -10033 (1989); U.S. Pat. Nos. 5,821,337, 7,527,791, 6,982,321 and 7,087,409; Kashmiri et al., Methods 36:25-34 (2005); Padlan, Mol. Immunol, 28:489-498 (1991); Dall'Acqua et al., Methods 36:43-60 (2005); Osbourn et al., Methods 36:61-68 (2005); and Klimka et al., Br. J. Cancer 83:252-260 (2000). Humanized antibodies are chimeric antibodies comprising amino acid residues from non-human hypervariable regions and amino acid residues from human FRs. In certain embodiments, a humanized antibody will include substantially all of at least one, typically two variable domains, wherein all or substantially all of the hypervariable regions (e.g., CDRs) correspond to those of a non-human antibody, and all or substantially all of the framework regions (FRs) correspond to those of a human antibody. A humanized antibody optionally may include at least a portion of an antibody constant region derived from a human antibody.

[0151] In some embodiments, the antibodies or antibody agents provided herein are human antibodies. Human antibodies can be produced using various techniques known in the art (see, for example, van Dijk and van de Winkel, Curr. Opin. Pharmacol., 5: 368-74 (2001); and Lonberg, Curr. Opin. Immunol, 20: 450-459 (2008)). Human antibodies can be antibodies having amino acid sequences corresponding to those produced by humans or human cells or derived from antibodies derived from non-human sources using human antibody repertoires or other human antibody encoding sequences. This definition of human antibodies explicitly excludes humanized antibodies including non-human antigen binding residues. Human antibodies can be prepared using methods well known in the art.

[0152] Chimeric Antigen Receptor

[0153] As used herein, a chimeric antigen receptor (CAR) is a protein that specifically recognizes a target antigen (e.g., a target antigen on a cancer cell). When bound to a target antigen, CAR can activate immune cells to attack and destroy cells carrying the antigen (e.g., cancer cells). CAR can also have co-stimulatory or signaling domains to increase its effectiveness. See Krause et al., Journal of Experimental Medicine (J. Exp. Med.), Vol. 188, No. 4, 1998 (619–626); Finney et al., Journal of Immunology (Journal of Immunology) Immunology, 1998, 161:2791–2797; Song et al., Blood, 119:696-706 (2012); Kalos et al., Sci. Transl. Med., 3:95 (2011); Porter et al., N. Engl. J. Med., 365:725-33 (2011); and Gross et al., Annu. Rev. Pharmacol. Toxicol., 56:59–83 (2016); U.S. Pat. Nos. 7,741,465 and 6,319,494.

[0154] The chimeric antigen receptor described herein comprises an extracellular domain, a transmembrane domain and an intracellular domain, wherein the extracellular domain comprises an antigen binding domain that specifically binds to the target.

[0155] In some embodiments, the antigen-specific CAR further comprises a safety switch and / or one or more monoclonal antibody-specific epitopes.

[0156] Antigen binding domain

[0157] As discussed above, the CAR described herein includes an antigen binding domain. As used herein, "antigen binding domain" means any polypeptide that binds to a specified target antigen. In some embodiments, the antigen binding domain binds to an antigen on a tumor cell. In some embodiments, the antigen binding domain binds to an antigen on a cell involved in a hyperproliferative disease.

[0158] In some embodiments, the antigen binding domain comprises a variable heavy chain, a variable light chain and / or one or more CDRs as described herein. In some embodiments, the antigen binding domain is a single chain variable fragment (scFv) comprising a light chain CDR (CDR1, CDR2 and CDR3) and a heavy chain CDR (CDR1, CDR2 and CDR3).

[0159] An antigen binding domain is said to be "selective" when it binds one target more tightly or with higher affinity than it binds a second target.

[0160] The antigen binding domain of CAR selectively targets cancer antigens. In some embodiments, the cancer antigen is selected from EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, BCMA, FLT3, CD70, DLL3, CD52 or CD34. In some embodiments, the CAR comprises an antigen binding domain targeting EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein-18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, BCMA, FLT3, CD70, DLL3, CD52 or CD34.

[0161] In some embodiments, the cancer antigen is selected from the group consisting of carbonic anhydrase IX (CAIX), carcinoembryonic antigen (CEA), CDS, CD7, CDIO, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD123, CD133, CD138, antigens of cytomegalovirus (CMV) infected cells (e.g., cell surface antigens), epithelial glycoprotein (EGP 2), epithelial glycoprotein-40 (EGP-40), epithelial cell adhesion molecule (EpCAM), receptor tyrosine protein kinase erb-B2,3,4, folate binding protein (FBP), fetal acetylcholine receptor (AChR), folate receptor, ganglioside G2 (GD2), ganglioside G3 (GD3), human epidermal growth factor receptor 2 (HER-2), human telomerase reverse transcriptase (hTERT), interleukin-13 receptor subunit alpha-2 (IL-13Ra2), kappa-light chain, kinase insert domain receptor (KDR), Lewis A (CA19.9), LI cell adhesion molecule (LICAM), melanoma antigen family A, 1 (MAGE-AI), mucin 16 (Muc-16), mucin 1 (Muc-1), mesothelin (MSLN), NKG2D ligand, cancer-testis antigen NY-ESO-1, carcinoembryonic antigen (h5T4), prostate stem cell antigen (PSCA), prostate specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), vascular endothelial growth factor R2 (VEGF-R2) and Wilms tumor protein (WT-1).

[0162] Variants of antigen binding domains (e.g., variants of CDRs, VH and / or VL) are also within the scope of the present disclosure, e.g., variable light chains and / or variable heavy chains, each of which has at least 70%-80%, 80%-85%, 85%-90%, 90%-95%, 95%-97%, 97%-99% or greater than 99% identity to the amino acid sequence of the antigen binding domain sequence. In some cases, such molecules comprise at least one heavy chain and one light chain, while in other cases, the variant forms contain two variable light chains and two variable heavy chains (or sub-portions thereof). Technicians will be able to use well-known techniques to determine suitable variants of antigen binding domains as shown herein. In certain embodiments, those skilled in the art can identify suitable regions of the molecule by targeting regions that are considered to be unimportant for activity, which regions can be altered without destroying activity.

[0163] In some embodiments, the polypeptide structure of the antigen binding domain is based on antibodies, including but not limited to monoclonal antibodies, bispecific antibodies, miniantibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), and fragments thereof, respectively. In some embodiments, the antigen binding domain comprises or consists of an avimer.

[0164] In some embodiments, the antigen binding domain is a scFv. In some embodiments, the antigen selective CAR comprises a leader sequence or a signal peptide.

[0165] In other embodiments, the present disclosure relates to isolated polynucleotides encoding any of the antigen binding domains described herein. In some embodiments, the present disclosure relates to isolated polynucleotides encoding CAR. Also provided herein are vectors comprising polynucleotides and methods for preparing them.

[0166] In other embodiments, the present disclosure relates to isolated polynucleotides encoding any of the antigen binding domains described herein. In some embodiments, the present disclosure relates to isolated polynucleotides encoding CAR. Also provided herein are vectors comprising polynucleotides and methods for preparing them.

[0167] In some embodiments, CAR immune cells (e.g., CAR-T cells) may form a component of a cell population produced by implementing the method of the present disclosure, and the CAR immune cells include polynucleotides encoding safety switch polypeptides (e.g., RQR8). See, for example, WO2013153391A, which is hereby incorporated by reference in its entirety. In CAR immune cells (e.g., CAR-T cells) including polynucleotides, safety switch polypeptides may be expressed on the surface of CAR immune cells (e.g., CAR-T cells).

[0168] Hinge domain

[0169] The extracellular domain of the CAR disclosed herein may include a "hinge" domain (or hinge region). The term generally refers to any such polypeptide having the function of connecting the transmembrane domain in CAR to the extracellular antigen-binding domain in CAR. Specifically, the hinge domain can be used to provide greater flexibility and accessibility for the extracellular antigen-binding domain.

[0170] The hinge domain may include up to 300 amino acids - in some embodiments 10 to 100 amino acids or in some embodiments, 25 to 50 amino acids. The hinge domain may be derived from all or part of a naturally occurring molecule, such as all or part of the extracellular region from CD8, CD4, CD28, 4-1BB or IgG (especially, the hinge region of IgG; it should be understood that the hinge region may contain immunoglobulin family members, such as IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgE, IgM or some or all of their fragments), or from all or part of the constant region of the heavy chain of an antibody. Alternatively, the hinge domain may be a synthetic sequence corresponding to a naturally occurring hinge sequence, or may be a fully synthetic hinge sequence. In some embodiments, the hinge domain is a part of a human CD8 α chain (e.g., NP_001139345.1). In other embodiments, the hinge and transmembrane domain include a part of a human CD8 α chain. In some embodiments, the hinge domain of the CAR described herein includes a subsequence of CD8α, IgG1, IgG4, PD-1 or FcγRIIIα, in particular a hinge region of any one of CD8α, IgG1, IgG4, PD-1 or FcγRIIIα. In some embodiments, the hinge domain includes a human CD8α hinge, a human IgG1 hinge, a human IgG4, a human PD-1 or a human FcγRIIIα hinge. In some embodiments, the CAR disclosed herein includes scFv, a CD8α human hinge and a transmembrane domain, a CD3ζ signaling domain, and a 4-1BB signaling domain.

[0171] Transmembrane domain

[0172] The CAR of the present disclosure is designed to have a transmembrane domain fused to the extracellular domain of CAR. It can be similarly fused to the intracellular domain of CAR. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to avoid such domains from binding to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex. In some embodiments, a short linker can form a bond between any one or some of the extracellular, transmembrane and intracellular domains of CAR.

[0173] Suitable transmembrane domains of the CARs disclosed herein have the ability to: (a) express on the surface of immune cells, such as, but not limited to, lymphocytes, such as T helper cells (T h ) cells, cytotoxic T (T c ) cells, T regulatory (T reg) cells or natural killer (NK) cells, and / or (b) interact with the extracellular antigen binding domain and the intracellular signaling domain to direct the cellular response of the immune cell against the target cell.

[0174] The transmembrane domain may be derived from a natural or synthetic source. When the source is natural, the domain may be derived from any membrane-bound or transmembrane protein.

[0175] The transmembrane region particularly used in the present disclosure may be derived from (including, or corresponding to) CD28, OX-40, 4-1BB / CD137, CD2, CD7, CD27, CD30, CD40, programmed death-1 (PD-1), inducible T cell co-stimulatory molecule (ICOS), lymphocyte function-associated antigen-1 (LFA-1, CD1-1a / CD18), CD3γ, CD3δ, CD3ε, CD247, CD276 (B7-H3), LIGHT, (TNFSF14), NKG2C, Igα (CD79a), DAP-10, Fcγ receptor, MHC Class 1 molecules, TNF receptor proteins, immunoglobulins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activated NK cell receptors, BTLA, Toll ligand receptors, ICAM-1, B7-H3, CDS, ICAM-1, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL-2Rβ, IL-2Rγ, IL-7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1 1d, ITGAE, CD103, ITGAL, CD1 1a, LFA-1, ITGAM, CD1 1b, ITGAX, CD1 1c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, a ligand that specifically binds to CD83, or any combination thereof.

[0176] As a non-limiting example, the transmembrane region can be derived from a T cell receptor, or a part of a T cell receptor, such as α, β, γ or δ, a polypeptide constituting a CD3 complex, an IL-2 receptor p55 (α chain), p75 (β chain) or γ chain, a subunit chain of an Fc receptor, especially Fcγ receptor III or CD protein. Alternatively, the transmembrane domain can be synthetic and can mainly include hydrophobic residues, such as leucine and valine. In some embodiments, the transmembrane domain is derived from a human CD8 α chain (e.g., NP_001139345.1).

[0177] In some embodiments, the transmembrane domain in the CAR of the present disclosure is a CD8α transmembrane domain.

[0178] In some embodiments, the transmembrane domain in the CAR of the present disclosure is a CD28 transmembrane domain.

[0179] Intracellular domain

[0180] The intracellular (cytoplasmic) domain of the CAR of the present disclosure can provide at least one activation of the normal effector function of the immune cell including the CAR. For example, the effector function of T cells can refer to cell lysis activity or helper cell activity, including the secretion of cytokines.

[0181] In some embodiments, the activating intracellular signaling domain for use in a CAR may be, for example, but not limited to, cytoplasmic sequences of T cell receptors and co-receptors that act coordinately to initiate signal transduction after antigen receptor binding, as well as any derivatives or variants of these sequences and any synthetic sequences with the same functional capability.

[0182] It is understood that suitable (e.g., activation) intracellular domains include, but are not limited to, signaling domains derived from (or corresponding to) CD28, OX-40, 4-1BB / CD137, CD2, CD7, CD27, CD30, CD40, programmed death-1 (PD-1), inducible T cell co-stimulatory molecule (ICOS), lymphocyte function-associated antigen-1 (LFA-1, CD1-1a / CD18), CD3γ, CD3δ, D3ε, CD247, CD276 (B7-H3), LIGHT, (TNFSF14), NKG2C, Igα (CD79a), DAP-10, Fcγ receptor, MHC Class 1 molecules, TNF receptor proteins, immunoglobulin proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activated NK cell receptors, BTLA, Toll ligand receptors, ICAM-1, B7-H3, CDS, ICAM-1, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL-2Rβ, IL-2Rγ, IL-7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1 1d, ITGAE, CD103, ITGAL, CD1 1a, LFA-1, ITGAM, CD1 1b, ITGAX, CD1 1c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, a ligand that specifically binds to CD83, or any combination thereof.

[0183] The intracellular domain of the CAR of the present disclosure may also be incorporated into a costimulatory signaling domain (interchangeably referred to herein as a costimulatory molecule) in addition to the above-mentioned activation domain to increase its effectiveness. The costimulatory domain may provide a signal other than the primary signal provided by the activation molecule as described herein.

[0184] It will be appreciated that suitable costimulatory domains within the scope of the present disclosure may be derived from (or correspond to) for example, CD28, OX40, 4-1BB / CD137, CD2, CD3 (α, β, δ, ε, γ, ζ), CD4, CD5, CD7, CD9, CD16, CD22, CD27, CD30, CD33, CD37, CD40, CD45, CD64, CD80, CD86, CD134, CD137, CD154, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1 (CD1 1a / CD18)), CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), NKG2C, Igα (CD79a), DAP-10, Fcγ receptor, MHC Class I molecules, TNFR, integrin, signaling lymphocyte activation molecules, BTLA, Toll ligand receptor, ICAM-1, B7-H3, CDS, ICAM-1, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL-2Rβ, IL-2Rγ, IL-7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD4 9D, ITGA6, VLA-6, CD49f, ITGAD, CD1-1d, ITGAE, CD103, ITGAL, CD1-1a, LFA-1, ITGAM, CD1-1b, ITGAX, CD1-1c, ITGB1, CD29, ITG B2, CD18, LFA-1, ITGB7, NKG2D, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, CD83 ligand, or a fragment or combination thereof. It should be understood that additional costimulatory molecules or fragments thereof not listed above are within the scope of the present disclosure.

[0185] In some embodiments, the intracellular / cytoplasmic domain of CAR can be designed to include the 4-1BB / CD137 domain itself or any other desired intracellular domain combination suitable for the situation of CAR of the present disclosure. The complete native amino acid sequence of 4-1BB / CD137 is described in NCBI reference sequence: NP_001552.2. The complete native 4-1BB / CD137 nucleic acid sequence is described in NCBI reference sequence: NM_001561.5.

[0186] In some embodiments, the intracellular / cytoplasmic domain of the CAR can be designed to include the CD28 domain itself or in combination with any other desired intracellular domain suitable for the context of the CAR of the present disclosure. The complete native amino acid sequence of CD28 is described in NCBI reference sequence: NP_006130.1. The complete native CD28 nucleic acid sequence is described in NCBI reference sequence: NM_006139.1.

[0187] In some embodiments, the intracellular / cytoplasmic domain of the CAR can be designed to include the CD3 zeta domain by itself or in combination with any other desired intracellular domain suitable for the context of the CAR of the present disclosure.

[0188] For example, the intracellular domain of CAR can include a portion of a CD3 ζ chain and a portion of a co-stimulatory signaling molecule. The intracellular signaling sequences within the intracellular signaling portion of the CAR disclosed herein can be connected to each other randomly or in a specified order. In some embodiments, the intracellular domain is designed to include an activation domain of CD3 ζ and a signaling domain of CD28. In some embodiments, the intracellular domain is designed to include an activation domain of CD3 ζ and a signaling domain of 4-1BB.

[0189] In some embodiments, the intracellular signaling domain of the CAR of the present disclosure includes the domain of a co-stimulatory molecule. In some embodiments, the intracellular signaling domain of the CAR of the present disclosure includes a portion of a co-stimulatory molecule selected from the group consisting of a fragment of 4-1BB (GenBank: AAA53133.) and CD28 (NP_006130.1).

[0190] Genetic modification of CAR T cells

[0191] Also provided herein are engineered immune cells and populations of engineered immune cells expressing CAR (e.g., CAR-T cells or CAR+ cells), both of which are depleted of cells expressing endogenous TCRs.

[0192] In some embodiments, the engineered immune cells include CAR T cells, each CAR T cell includes an extracellular antigen binding domain and the expression of endogenous TCR is reduced or eliminated. In some embodiments, the engineered immune cell population includes a CAR T cell population, each CAR T cell includes two or more different extracellular antigen binding domains and the expression of endogenous TCR is reduced or eliminated. In some embodiments, the immune cells include a CAR population, each CAR T cell includes the same extracellular antigen binding domain and the expression of endogenous TCR is reduced or eliminated.

[0193] In some embodiments, the engineered immune cells according to the present disclosure include a destroyed or inactivated gene selected from the group consisting of CD52, DLL3, GR, PD-1, CTLA-4, LAG3, TIM3, BTLA, BY55, TIGIT, B7H5, LAIR1, SIGLEC10, 2B4, HLA, TCRα and TCRβ, and / or express CAR, multi-chain CAR and / or pTα transgene. In some embodiments, the isolated cell includes a polynucleotide encoding a polypeptide including a multi-chain CAR. In some embodiments, the isolated cells according to the present disclosure comprise two disrupted or inactivated genes selected from the group consisting of CD52 and GR, CD52 and TCRα, CDR52 and TCRβ, DLL3 and CD52, DLL3 and TCRα, DLL3 and TCRβ, GR and TCRα, GR and TCRβ, TCRα and TCRβ, PD-1 and TCRα, PD-1 and TCRβ, CTLA-4 and TCRα, CTLA-4 and TCRβ, LAG3 and TCRα, LAG3 and TCRβ, TIM3 and TCRα, Tim3 and TCRβ, BTLA and TCRα, BTLA and TCRβ, BY55 and TCRα, BY55 and TCRβ, TIGIT and TCRα, TIGIT and TCRβ, B7H5 and TCRα, B7H5 and TCRβ, LAIR1 and TCRα, LAIR1 and TCRβ, SIGLEC10 and TCRα, SIGLEC10 and TCRβ, 2B4 and TCRα, 2B4 and TCRβ, and / or expression of CAR (comprising multi-chain CAR and / or pTα transgene). In some embodiments, the method comprises destroying or inactivating one or more genes by introducing into the cell an endonuclease that can selectively inactivate the gene by selective DNA cutting. In some embodiments, the endonuclease can be, for example, a zinc finger nuclease (ZFN), a modified homing endonuclease (e.g., a large range of nucleases), a megaTAL nuclease, a transcription activator-like effector nuclease (TALE-nuclease or ) or CRISPR (e.g., Cas9 or Cas12) endonucleases.

[0194] In some embodiments, the TCR is rendered non-functional in cells according to the present disclosure by destroying or inactivating the TCRα gene and / or the TCRβ gene. In some embodiments, a method for obtaining modified cells derived from an individual is provided, wherein the cells can proliferate independently of the major histocompatibility complex (MHC) signaling pathway. Modified cells that can proliferate independently of the MHC signaling pathway and are easily obtained by this method are included in the scope of the present disclosure. The modified cells disclosed herein can be used to treat host-versus-graft (HvG) rejection and graft-versus-host disease (GvHD) in patients in need; therefore, within the scope of the present disclosure is a method for treating host-versus-graft (HvG) rejection and graft-versus-host disease (GvHD) in patients in need, the method comprising treating the patient by administering to the patient an effective amount of modified cells, the modified cells comprising a destroyed or inactivated TCRα and / or TCRβ gene.

[0195] The present disclosure provides a method for determining the purity of an engineered immune cell colony lacking or having reduced endogenous TCR expression. In certain embodiments, engineered immune cells include less than 5.0%, less than 4.0%, less than 3.0% TCR+ cells, less than 2.0% TCR+ cells, less than 1.0% TCR+ cells, less than 0.9% TCR+ cells, less than 0.8% TCR+ cells, less than 0.7% TCR+ cells, less than 0.6% TCR+ cells, less than 0.5% TCR+ cells, less than 0.4% TCR+ cells, less than 0.3% TCR+ cells, less than 0.2% TCR+ cells or less than 0.1% TCR+ cells. This colony can be the product of the disclosed method.

[0196] In some embodiments, the engineered immune cells according to the present disclosure may include one or more destroyed or inactivated genes. In some embodiments, the genes of the target antigen (e.g., EGFRvIII, Flt3, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, BCMA, FLT3, CD70, DLL3 or CD34, CD70) may be To be knocked out to introduce a CAR targeting the same antigen (e.g., EGFRvIII, Flt3, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein-18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, BCMA, FLT3, CD70, DLL3 or CD34, CD70 CAR), thereby avoiding induction of CAR activation. As described herein, in some embodiments, the engineered immune cell according to the present disclosure includes a destroyed or inactivated gene, the gene is selected from the group consisting of: MHC1 (β2M), MHC2 (CIITA), EGFRvIII, Flt3, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, BCMA, FLT3, CD70, DLL3 or CD34, CD70, TCRα and TCRβ, and / or expresses CAR or multi-chain CAR. In some embodiments, the cell includes multi-chain CAR. In some embodiments, the isolated cells comprise two disrupted or inactivated genes selected from the group consisting of CD52 and TCRα, CDR52 and TCRβ, PD-1 and TCRα, PD-1 and TCRβ, MHC-1 and TCRα, MHC-1 and TCRβ, MHC2 and TCRα, MHC2 and TCRβ, and / or express CAR or multi-chain CAR.

[0197] The engineered immune cells can be allogeneic or autologous.

[0198] In some embodiments, engineered immune cells or engineered immune cell colonies include T cells (e.g., inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, helper T lymphocytes, tumor infiltrating lymphocytes (TIL)), NK cells, NK-T cells, TCR expressing cells, dendritic cells, killer dendritic cells, mast cells or B cells, and express CAR. In some embodiments, T cells can be derived from a group consisting of CD4+T lymphocytes, CD8+T lymphocytes or a group including a combination of CD4+ and CD8+T cells.

[0199] In some embodiments, the engineered immune cells or engineered immune cell populations produced using the disclosed methods can be derived from, for example, but not limited to, stem cells. The stem cells can be adult stem cells, non-human embryonic stem cells, more specifically non-human stem cells, umbilical cord blood stem cells, progenitor cells, bone marrow stem cells, induced pluripotent stem cells, totipotent stem cells, or hematopoietic stem cells.

[0200] In some embodiments, the engineered immune cells or immune cell colonies produced using the disclosed methods are obtained from peripheral blood or prepared therefrom. In some embodiments, the engineered immune cells are obtained from peripheral blood mononuclear cells (PBMC) or prepared therefrom. In some embodiments, the engineered immune cells are obtained from bone marrow or prepared therefrom. In some embodiments, the engineered immune cells are obtained from umbilical cord blood or prepared therefrom. In some embodiments, the cells are human cells. In some embodiments, cells are transfected or transduced by a nucleic acid vector using a method selected from the group consisting of the following: electroporation, sonoporation, biolistics (e.g., gene gun), lipofection, polymer transfection, nanoparticles, viral transfection (e.g., retrovirus, lentivirus, AAV) or polymer complex (polyplex).

[0201] In some embodiments, the engineered immune cells expressing antigen-specific CAR on the cell surface membrane include percentages greater than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of stem cell memory and central memory cells.

[0202] In some embodiments, the engineered immune cells expressing an antigen-specific CAR on the cell surface membrane include a percentage of about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 15% to about 50%, about 15% to about 40%, about 20% to about 60%, or about 20% to about 70% stem cell memory and central memory cells.

[0203] In some embodiments, engineered immune cells expressing antigen-specific CARs on their surface membranes are enriched for T cells. CM and / or T SCM cells, such that the engineered immune cells include at least about 60%, 65%, 70%, 75% or 80% of the combined T CM and T SCM In some embodiments, engineered immune cells expressing antigen-specific CARs at their cell surface membranes are enriched for T cells. CM Cells and / or T SCM cells, such that the engineered immune cells include at least about 70% of the combined T CM Cells and T SCM In some embodiments, engineered immune cells expressing antigen-specific CARs at their cell surface membranes are enriched for T cells. CM Cells and / or T SCM cells, such that the engineered immune cells include at least about 75% of the combined T CM Cells and / or T SCM cell.

[0204] In some embodiments, the engineered immune cells are inflammatory T lymphocytes expressing CAR. In some embodiments, the engineered immune cells are cytotoxic T lymphocytes expressing CAR. In some embodiments, the engineered immune cells are regulatory T lymphocytes expressing CAR. In some embodiments, the engineered immune cells are helper T lymphocytes expressing CAR.

[0205] In certain embodiments, immune cells are engineered to resist one or more chemotherapy drugs. The chemotherapy drug may be, for example, a purine nucleotide analog (PNA), so that immune cells are suitable for cancer treatment combined with adoptive immunotherapy and chemotherapy. Exemplary PNAs include, for example, clofarabine, fludarabine, cyclophosphamide, and cytarabine, in separate or combined forms. PNA is metabolized into single, two, and triphosphate PNAs by deoxycytidine kinase (dCK). Its triphosphate form competes with ATP for DNA synthesis, serves as a pro-apoptotic agent, and is an effective inhibitor of the ribonucleotide reductase (RNR) involved in the production of trinucleotides.

[0206] In some embodiments, the isolated cells or cell lines of the present disclosure may include pTalpha or a functional variant thereof. In some embodiments, the isolated cells or cell lines may be further genetically modified by disrupting or inactivating the TCRalpha gene.

[0207] The present disclosure also provides an engineered immune cell comprising any of the CAR polynucleotides described herein. In some embodiments, CAR can be introduced into immune cells as a transgene via a plasmid vector. In some embodiments, the plasmid vector may also contain, for example, a selection marker, which provides identification and / or selection of cells receiving the vector.

[0208] After the polynucleotide encoding the CAR polypeptide is introduced into the cell, the CAR polypeptide can be synthesized in situ in the cell. Alternatively, the CAR polypeptide can be produced extracellularly and then introduced into the cell. The method of introducing a polynucleotide construct into a cell is known in the art. In some embodiments, a stable transformation method (e.g., using a lentiviral vector) can be used to integrate a polynucleotide construct into the genome of the cell. In other embodiments, a transient transformation method can be used to transiently express a polynucleotide construct and a polynucleotide construct that is not integrated into the genome of the cell. In other embodiments, a viral-mediated method can be used. Polynucleotides can be introduced into cells by any suitable means, such as recombinant viral vectors (e.g., retroviruses, adenoviruses), liposomes, etc. Transient transformation methods include, for example, but not limited to microinjection, electroporation, or particle bombardment. The polynucleotide may be contained in a vector, such as a plasmid vector or a viral vector.

[0209] In some embodiments, an isolated nucleic acid is provided, comprising a promoter operably linked to a first polynucleotide encoding an antigen binding domain, at least one co-stimulatory molecule and an activation domain. In some embodiments, the nucleic acid construct is contained in a viral vector. In some embodiments, the viral vector is selected from the group consisting of: a retroviral vector, a murine leukemia virus vector, a SFG vector, an adenoviral vector, a lentiviral vector, an adeno-associated virus (AAV) vector, a herpes virus vector and a vaccinia virus vector. In some embodiments, the nucleic acid is contained in a plasmid.

[0210] In some embodiments, the isolated nucleic acid construct is contained in a viral vector and is introduced into the genome of an engineered immune cell by random integration (e.g., lentiviral or retroviral mediated random integration). In some embodiments, the isolated nucleic acid construct is contained in a viral vector or a non-viral vector and is introduced into the genome of an engineered immune cell by site-specific integration (e.g., adenovirus mediated site-specific integration).

[0211] Preparation of engineered immune cells

[0212] Many known techniques can be used to prepare polynucleotides, polypeptides, vectors, antigen binding domains, immune cells, compositions, etc. according to the present disclosure.

[0213] Prior to in vitro manipulation or genetic modification of the immune cells described herein, the cells can be obtained from a subject. Cells expressing CAR can be derived from allogeneic or autologous sources and can be knocked out of endogenous TCR as described herein.

[0214] Source Material

[0215] In some embodiments, the immune cells include T cells. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells (PBMC), bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from the site of infection, ascites, pleural effusion, spleen tissue and tumors. In some embodiments, any number of techniques known to the skilled person can be used, such as FICOLL TM Isolate and obtain T cells from a volume of blood collected from a subject.

[0216] Cells can be obtained from the circulating blood of an individual by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells, and platelets. In some embodiments, the cells collected by apheresis can be washed to remove the plasma fraction and then placed in an appropriate buffer or culture medium for subsequent processing.

[0217] In some embodiments, for example, using PERCOLL TM Centrifugation performed by gradient, by lysing red blood cells and exhausting monocytes, separates T cells from PBMC. Specific subpopulations of T cells, (such as CD28+, CD4+, CD45RA- and CD45RO+T cells or CD28+, CD4+, CDS+, CD45RA-, CD45RO+ and CD62L+T cells) can be further separated by positive or negative selection techniques known in the art. For example, the enrichment of T cell colonies by negative selection can be achieved with a combination of antibodies for surface markers unique to cells selected for negative selection. One of the methods used herein is to sort and / or select cells by negative magnetic immunoadhesion or flow cytometry, which uses a mixture of monoclonal antibodies for cell surface markers present on cells selected for negative selection. For example, in order to enrich for CD4+ cells by negative selection, a mixture of monoclonal antibodies generally includes antibodies for CD14, CD20, CD11b, CD16, HLA-DR and CD8. Flow cytometry and cell sorting can also be used to separate the cell colonies of interest for use in the present disclosure.

[0218] Using methods as described herein, PBMC can be directly used for the genetic modification of immune cells (such as CAR or TCR).In certain embodiments, after separating PBMC, T lymphocytes can be further separated, and cytotoxicity and helper T lymphocytes can be sorted as primary, memory and effector T cell subsets before or after genetic modification and / or amplification.In certain embodiments, CD8+ cells are further sorted as primary, stem cell memory, central memory and effector cells by identifying the cell surface antigens related to each of these CD8+ cell types.In certain embodiments, the expression of the phenotypic markers of central memory T cells includes CD27, CD45RA, CD45RO, CD62L, CCR7, CD28, CD3 and CD127 and is negative for granzyme B.In certain embodiments, stem cell memory T cells are CD45RO-, CD62L+, CD8+T cells.In certain embodiments, central memory T cells are CD45RO+, CD62L+, CD8+T cells. In some embodiments, effector T cells are negative for CD62L, CCR7, CD28, and CD127, and positive for granzyme B and perforin. In some embodiments, CD4+ T cells are further sorted into subpopulations. For example, CD4+ T helper cells can be sorted into primary, central memory, and effector cells by identifying cell populations with cell surface antigens.

[0219] Stem cell-derived immune cells

[0220] In some embodiments, immune cells may be derived from embryonic stem (ES) cells or induced pluripotent stem (iPS) cells. Suitable HSC, mesenchymal cells, iPS cells and other types of stem cells may be cultivated into immortalized cell lines or directly isolated from patients. Various methods for isolating, producing and / or cultivating stem cells are known in the art and can be used to practice the present disclosure.

[0221] In some embodiments, immune cells are induced pluripotent stem cells (iPSC) derived from reprogrammed T cells. In some embodiments, the source material can be an induced pluripotent stem cell (iPSC) derived from T cells or non-T cells. In some embodiments, the immune cells are T cells derived from iPSC. In some embodiments, the immune cells are NK cells derived from iPSC. The source material can be embryonic stem cells. The source material can be B cells, or any other cells from peripheral blood mononuclear cell isolates, hematopoietic progenitor cells, hematopoietic stem cells, mesenchymal stem cells, adipose stem cells or any other somatic cell types.

[0222] Genetic modification of isolated cells

[0223] Immune cells, such as T cells, can be genetically modified using known methods after separation, or immune cells can be activated and amplified (or differentiated in the case of progenitor cells) in vitro before being genetically modified. In some embodiments, the isolated immune cells are genetically modified to reduce or eliminate the expression of endogenous TCRα and / or CD52. In some embodiments, cells are genetically modified using gene editing techniques (e.g., CRISPR / Cas9, CRISPR / Cas12a, zinc finger nucleases (ZFNs), TALENs, MegaTAL nucleases, large-range nucleases) to reduce or eliminate the expression of endogenous proteins (e.g., TCRα and / or CD52). In another embodiment, immune cells (such as T cells) are genetically modified with a chimeric antigen receptor as described herein (e.g., transduced with a viral vector comprising one or more nucleotide sequences encoding CAR), and then activated and / or amplified in vitro.

[0224] Certain methods for making the constructs and engineered immune cells of the present disclosure are described in PCT Application No. PCT / US15 / 14520, the contents of which are incorporated herein by reference in their entirety.

[0225] It should be understood that PBMC may further include other cytotoxic lymphocytes, such as NK cells or NKT cells. Expression vectors carrying the coding sequence of chimeric receptors as disclosed herein may be introduced into populations of human donor T cells, NK cells or NKT cells. Flow cytometry can be used to sort T cells carrying successful transduction of expression vectors to separate CD3 positive T cells, and then further proliferate to increase the number of these CAR expression T cells except for cell activation using anti-CD3 antibodies and IL-2 or other methods known in the art as described elsewhere herein. Standard procedures are used to cryopreserve T cells expressing CAR, to store and / or prepare for human subjects. In one embodiment, in the absence of non-human animal derived products, such as fetal bovine serum (fetal calf serum / fetal bovine serum), T cells are transduced in vitro, cultured and / or amplified.

[0226] In order to clone a polynucleotide, a vector can be introduced into a host cell (isolated host cell) to allow replication of the vector itself, and thereby amplify copies of the polynucleotide contained therein. The cloning vector may contain sequence components, generally including but not limited to a replication origin, a promoter sequence, a transcription initiation sequence, an enhancer sequence, and a selectable marker. These elements may be selected as appropriate by a person of ordinary skill in the art. For example, a replication origin may be selected to promote autonomous replication of the vector in a host cell.

[0227] In certain embodiments, the disclosure provides a host cell containing the separation of the vector provided herein. The host cell containing the vector can be used for the expression or cloning of the polynucleotide contained in the vector. Suitable host cells can include but are not limited to prokaryotic cells, fungal cells, yeast cells or higher eukaryotic cells, such as mammalian cells, particularly human cells.

[0228] The vector can be introduced into the host cell using any suitable method known in the art, including but not limited to DEAE-dextran mediated delivery, calcium phosphate precipitation method, cationic lipid mediated delivery, liposome mediated transfection, electroporation, gene gun method, receptor mediated gene delivery, delivery mediated by polylysine, histone, chitosan and peptide. Standard methods for transfecting and transforming cells for expressing the vector of interest are well known in the art. In another embodiment, a mixture of different expression vectors can be used for a donor population of genetically modified immune effector cells, wherein each vector encodes a different CAR as disclosed herein. The resulting transduced immune effector cells form a mixed population of engineered cells, wherein a certain proportion of engineered cells express more than one different CAR.

[0229] In one embodiment, the present disclosure provides a method for storing genetically engineered cells expressing CAR or TCR. This involves cryopreservation of immune cells so that the cells remain viable after thawing. A portion of the immune cells expressing CAR can be cryopreserved by methods known in the art to provide a permanent source of such cells for future treatment of patients with malignant tumors. When necessary, cryopreserved transformed immune cells can be thawed, grown, and expanded to obtain more such cells.

[0230] In some embodiments, cells are formulated by first collecting the cells from their culture medium, and then washing and concentrating the cells in a culture medium and container system (a "pharmaceutically acceptable" carrier) suitable for administration in a therapeutically effective amount. Suitable infusion media can be any isotonic medium formulation, typically saline Normosol TM R (Abbott) or Plasma-Lyte TM A (Baxter), but 5% dextrose in water or Ringer's lactate may also be used. The infusion medium may be supplemented with human serum albumin.

[0231] Allogeneic CAR T cells

[0232] The process for preparing allogeneic CAR T therapy involves harvesting healthy, selected, screened and tested T cells from healthy donors. Then, the T cells are engineered to express CAR, which recognizes certain cell surface proteins expressed in blood or solid tumors. Allogeneic T cells are gene-edited to reduce the risk of graft-versus-host disease (GvHD) and prevent allogeneic rejection. T cell receptor genes (e.g., TCRα, TCRβ) are knocked out to avoid GvHD. The TCRα locus is located on chromosome 14, where inversion has been shown to occur, such as at 14q11 as described herein. The present disclosure provides a method that is particularly advantageous for analyzing allogeneic immune cells or immune cell colonies, wherein the allogeneic immune cells or immune cell colonies include engineered cells with any genetic modification on chromosome 14, such as targets of gene editing on chromosome 14. Specifically, the method allows determining the presence or absence of chromosome 14 inversion at TCR A / D (e.g., 14q11.2) in cells that have been engineered (e.g., gene editing) to inactivate or change the expression of one or more genes on chromosome 14 at the genomic level. In one embodiment, the cell has been engineered to knock out the expression of the TCRα gene on chromosome 14, such as by knocking out at least a portion of TCRα. In other embodiments, chromosome 14 inversions include centromere and telomeric inversion sites. In one other embodiment, the centromere inversion site is located at the T cell receptor connection gene TRAJ7. In one other embodiment, the telomeric inversion site of the chromosome 14 inversion is located at the IGHV3-69-1 pseudogene. In another embodiment, the chromosome 14 inversion (i) is located between TRAJ7 and IGHV3-69-1 and / or (ii) is a 14q11 inversion.

[0233] The CD52 gene can be knocked out to make the CAR T product resistant to anti-CD52 antibody treatment. Anti-CD52 antibody treatment can therefore be used to suppress the host immune system and allow the CAR T to remain implanted to achieve a full therapeutic effect. The engineered T cells are then subjected to a purification step and ultimately cryopreserved in vials for delivery to patients.

[0234] Autologous CAR T cells

[0235] Autologous chimeric antigen receptor (CAR) T cell therapy involves collecting the patient's own cells (e.g., white blood cells, including T cells) and genetically engineering the T cells to express CARs that recognize targets expressed on the cell surface of one or more specific cancer cells and kill cancer cells. The engineered cells are then cryopreserved and subsequently administered to the patient.

[0236] Pharmaceutical composition

[0237] In some embodiments, cells are formulated by first collecting the cells from their culture medium, and then washing and concentrating the cells in a culture medium and container system (a "pharmaceutically acceptable" carrier) suitable for administration in a therapeutically effective amount. Suitable infusion media can be any isotonic medium formulation, typically saline Normosol TM R (Abbott) or Plasma-Lyte TM A (Baxter), but 5% dextrose in water or Ringer's lactate may also be used. The infusion medium may be supplemented with human serum albumin.

[0238] In embodiments, the desired therapeutic amount of cells in the composition is typically at least 2 cells (e.g., at least 1 CD8+ central or stem cell memory T cell and at least 1 CD4+ helper T cell subset; or two or more CD8+ central or stem cell memory T cells; or two or more CD4+ helper T cell subsets) or more typically greater than 10 2 cells, and up to and including 10 6 cells, up to and including 10 7 , 10 8 or 10 9 cells, and can be more than 10 10 The number of cells will depend on the intended use of the composition and the type of cells contained therein. The desired cell density is generally greater than 10 6 cells / ml and usually greater than 10 7 cells / ml, usually 10 8 Clinically relevant numbers of immune cells can be assigned to cells that accumulate to or exceed 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 or 10 12 In some aspects of the present disclosure, particularly since all infused cells will be redirected to a specific target antigen, administration may be performed over a period of about 10 5 / kg or about 10 6 / kg (10 per patient 6 -10 11 ) range. CAR therapy can be administered multiple times at doses within these ranges. The cells can be autologous, allogeneic, or xenogeneic to the patient being treated.

[0239] The CAR expressing cell colony of the present disclosure can be administered alone or in the form of a pharmaceutical composition combined with a diluent and / or with other components (such as IL-2 or other cytokines or cell colonies). The pharmaceutical composition of the present disclosure may include CAR expression or TCR expression cell colonies, such as T cells described herein, combined with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose or dextran, mannitol; protein; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The present disclosure composition is preferably formulated for intravenous administration.

[0240] Pharmaceutical compositions (solutions, suspensions, etc.) may contain one or more of the following: sterile diluents, such as water for injection, saline solution (preferably physiological saline), Ringer's solution, isotonic sodium chloride; fixed oils, such as synthetic mono- or diglycerides that may serve as solvents or suspension media; polyethylene glycol, glycerol, propylene glycol or other solvents; antibacterial agents, such as benzyl alcohol or methyl paraben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates or phosphates and agents for adjusting tonicity, such as sodium chloride or dextrose. Parenteral formulations may be sealed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Injectable pharmaceutical compositions are preferably sterile.

[0241] Treatment

[0242] The present disclosure includes methods for treating or preventing a patient's disease (e.g., cancer), the methods comprising administering an effective amount of CAR T cells or engineered immune cells comprising a CAR disclosed herein to a patient in need thereof. In some embodiments, an effective amount of CAR T cells or engineered immune cells have been analyzed for various properties according to the methods described in the present disclosure. In some embodiments, various properties, such as efficacy or multifunctionality, have been analyzed for CAR T cell drug products for therapeutic use according to the methods described in the present disclosure. In some embodiments, the CAR T cells are TCR-CAR T cells, and various properties, such as the number or percentage of remaining TCR+CAR T cells and / or efficacy or multifunctionality, have been analyzed for CAR T drug products for therapeutic use according to the methods described in the present disclosure.

[0243] Provided is a method for treating a disease or disorder including cancer. In some embodiments, the present disclosure relates to generating a T cell-mediated immune response in a subject, comprising administering an effective amount of an engineered immune cell of the present application to the subject. In some embodiments, the T cell-mediated immune response is directed to a target cell or cell. In some embodiments, the engineered immune cell includes a chimeric antigen receptor (CAR). In some embodiments, the target cell is a tumor cell. In some aspects, the present disclosure includes a method for treating or preventing a malignant tumor, comprising administering an effective amount of at least one separated antigen binding domain described herein to a subject in need. In some aspects, the present disclosure includes a method for treating or preventing a malignant tumor, comprising administering an effective amount of at least one immune cell to a subject in need, wherein the immune cell includes at least one chimeric antigen receptor, a T cell receptor, and / or a separated antigen binding domain as described herein. The immune cells containing CAR disclosed herein can be used to treat malignant tumors involving abnormal expression of biomarkers. In some embodiments, the CAR-containing immune cells of the present disclosure can be used to treat small cell lung cancer, melanoma, low-grade glioma, glioblastoma, medullary thyroid carcinoma, carcinoid, scattered neuroendocrine tumors in the pancreas, bladder and prostate, testicular cancer, and lung adenocarcinoma with neuroendocrine features. In an exemplary embodiment, CAR-containing immune cells (e.g., CAR-T cells of the present disclosure) are used to treat small cell lung cancer.

[0244] Also provided are methods for reducing tumor size in a subject comprising administering to the subject an engineered cell of the disclosure, wherein the cell comprises a chimeric antigen receptor comprising an antigen binding domain and binds to an antigen on the tumor.

[0245] In some embodiments, the subject suffers from a solid tumor or a hematological malignancy, such as a lymphoma or a leukemia. In some embodiments, the engineered cells are delivered to a tumor bed. In some embodiments, the cancer is present in the subject's bone marrow. In some embodiments, the engineered cells are autologous immune cells, such as autologous T cells. In some embodiments, the engineered cells are allogeneic immune cells, such as allogeneic T cells. In some embodiments, the engineered cells of the present application are transfected or transduced in vivo. In other embodiments, the engineered cells are transfected or transduced ex vivo. As used herein, the term "in vitro cell" refers to any cell cultured ex vivo.

[0246] A therapeutic agent, for example, a "therapeutically effective amount", "effective dose", "effective amount", or "therapeutically effective dose" of an engineered CART cell is any amount that, when used alone or in combination with another therapeutic agent, protects the subject from the onset of disease or promotes disease regression, as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease-free periods, or the prevention of disorders or disabilities caused by disease pain. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to skilled practitioners, such as in human subjects during clinical trials, in animal model systems predicting efficacy in humans, or by analyzing the activity of an agent in an in vitro assay.

[0247] The terms "patient" and "subject" are used interchangeably and include human and non-human animal subjects, as well as those with a formally diagnosed condition, those without a formally recognized condition, those under medical observation, those at risk of developing the condition, and the like.

[0248] The terms "treat" and "treatment" encompass therapeutic treatment, prophylactic treatment, and applications in which a subject is subjected to a condition or other risk factor that is reduced. Treatment does not require a complete cure of the condition and encompasses embodiments in which symptoms or potential risk factors are reduced. The term "prevention" does not require 100% elimination of the likelihood of an event occurring. Rather, it means that the likelihood of an event occurring has been reduced in the presence of a compound or method.

[0249] The desired therapeutic amount of cells in the composition is generally at least 2 cells (e.g., at least 1 CD8+ central memory T cell and at least 1 CD4+ helper T cell subset), or more usually greater than 10 2 cells, and up to 10 6 , up to and including 10 8 or 10 9 cells, and can exceed 10 10 The number of cells will depend on the intended use of the composition and the type of cells contained therein. The desired cell density is generally greater than 10 6 cells / ml and usually greater than 10 7 cells / ml, usually 108 cells / ml or greater. Clinically relevant numbers of immune cells can be assigned to cells with a cumulative count equal to or greater than 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 or 10 12In some aspects of the present disclosure, particularly since all infused cells will be redirected to a specific target antigen, 10 6 / kg(10 6 -10 11 The CAR therapy can be administered multiple times at doses within these ranges. The cells can be autologous, allogeneic, or xenogeneic to the patient being treated.

[0250] In some embodiments, the therapeutically effective amount of CAR T cells is about 1×10 5 cells / kg, about 2X10 5 cells / kg, about 3X10 5 cells / kg, about 4X10 5 cells / kg, about 5X10 5 cells / kg, about 6X10 5 cells / kg, about 7X10 5 cells / kg, about 8X10 5 cells / kg, about 9X10 5 cells / kg, 2X10 6 cells / kg, about 3X10 6 cells / kg, about 4X10 6 cells / kg, about 5X10 6 cells / kg, about 6X10 6 cells / kg, about 7X10 6 cells / kg, about 8X10 6 cells / kg, about 9X10 6 cells / kg, about 1X10 7 cells / kg, about 2X10 7 cells / kg, about 3X10 7 cells / kg, about 4X10 7 cells / kg, about 5X10 7 cells / kg, about 6X10 7 cells / kg, about 7X10 7 cells / kg, about 8X10 7 cells / kg or about 9X10 7 cells / kg.

[0251] In some embodiments, the target dose of CAR+ / CAR-T+ / TCR+ cells is 1×10 6 -2×10 8 cells / kg, for example 2×10 6In some embodiments, the dosage of the present invention is within the range of 10 cells / kg. It should be understood that administration above and below this range may be suitable for certain subjects, and appropriate administration levels may be determined by a healthcare provider as needed. In addition, multiple doses of cells may be provided according to the present disclosure.

[0252] In some aspects, the disclosure includes pharmaceutical compositions comprising at least one antigen binding domain as described herein and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition further comprises an additional active agent.

[0253] The CAR expressing cell colony of the present disclosure can be administered alone or in the form of a pharmaceutical composition combined with a diluent and / or with other components (such as IL-2 or other cytokines or cell colonies). The pharmaceutical composition of the present disclosure may include CAR expression or TCR expression cell colonies, such as T cells described herein, combined with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose or dextran, mannitol; protein; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The present disclosure composition is preferably formulated for intravenous administration.

[0254] Pharmaceutical compositions (solutions, suspensions, etc.) may contain one or more of the following: sterile diluents, such as water for injection, saline solution (preferably physiological saline), Ringer's solution, isotonic sodium chloride; fixed oils, such as synthetic mono- or diglycerides that may serve as solvents or suspension media; polyethylene glycol, glycerol, propylene glycol or other solvents; antibacterial agents, such as benzyl alcohol or methyl paraben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates or phosphates and agents for adjusting tonicity, such as sodium chloride or dextrose. Parenteral formulations may be sealed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Injectable pharmaceutical compositions are preferably sterile.

[0255] In some embodiments, when applied to a patient, an engineered immune cell expressing any one of the antigen-specific CARs described herein on the cell surface can reduce, kill or lyse the patient's endogenous antigen-expressing cells. In one embodiment, the reduction or lysis percentage of the cell of the antigen-expressing endogenous cell or cell line of any one of the engineered immune cells expressing antigens described herein is at least about or greater than 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%. In one embodiment, the reduction or lysis percentage of the endogenous cells expressing antigen or the cell line expressing antigen produced by the engineered immune cells expressing antigen-specific CAR is about 5% to about 95%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 25% to about 75% or about 25% to about 60%. In one embodiment, the cell endogenously expressing antigen is a bone marrow cell endogenously expressing antigen.

[0256] In one embodiment, the reduction or percentage of target cells (e.g., antigen-expressing cell lines) generated by engineered immune cells expressing an antigen-specific CAR of the present disclosure on the cell surface membrane can be measured using the assays disclosed herein.

[0257] The method may also include administering one or more chemotherapeutic agents. In some embodiments, the chemotherapeutic agent is a lymphocyte depletion (preconditioning) chemotherapeutic agent. For example, a method for conditioning a patient in need of T cell therapy comprises administering to the patient a prescribed beneficial dose of cyclophosphamide (between 200 mg / m 2 / day and 2000mg / m 2 / day, about 100 mg / m 2 / day and about 2000mg / m 2 / day; for example, about 100 mg / m 2 / day, about 200mg / m 2 / day, about 300mg / m 2 / day, about 400mg / m 2 / day, about 500mg / m 2 / day, about 600mg / m 2 / day, about 700mg / m 2 / day, about 800mg / m 2 / day, about 900mg / m2 / day, about 1000mg / m 2 / day, about 1500mg / m 2 / day or about 2000mg / m 2 / day) and the specified dose of fludarabine (between 20 mg / m 2 / day and 900mg / m 2 / day, about 10mg / m 2 / day and about 900 mg / m 2 / day; for example, about 10 mg / m 2 / day, about 20mg / m 2 / day, about 30mg / m 2 / day, about 40mg / m 2 / day, about 40mg / m 2 / day, about 50mg / m 2 / day, about 60mg / m 2 / day, about 70mg / m 2 / day, about 80mg / m 2 / day, about 90mg / m 2 / day, about 100 mg / m 2 / day, about 500mg / m 2 / day or about 900 mg / m 2 A preferred dosing regimen involves treating a patient comprising administering to the patient about 300 mg / m daily prior to administering to the patient a therapeutically effective amount of engineered T cells. 2 / day of cyclophosphamide and about 30 mg / m 2 / day of fludarabine for three days.

[0258] In some embodiments, lymphocyte depletion further comprises administration of a CD52 antibody. In some embodiments, the CD52 antibody is alemtuzumab. In some embodiments, the CD52 antibody is administered intravenously at a dose of about 13 mg / day.

[0259] In other embodiments, the antigen binding domain, transduced (or otherwise engineered) cells, and chemotherapeutic agent are each administered in an amount effective to treat the disease or condition in the subject.

[0260] In some embodiments, the compositions comprising the CAR-expressing immune effector cells disclosed herein can be administered with any number of chemotherapeutic agents, which can be administered in any order. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide. TM); alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethyleneimines and methylmelamines, including hexamethylmelamine, triethylenemelamine, triethylenephosphamide, triethylenethiophosphamide, and trishydroxymethylmelamine; nitrogen mustards, such as chlorambucil, naphthyl mustard, chlorphosphamide, estramustine, ifosfamide, dichloromethane, dichloromethane oxide hydrochloride, melphalan, novemb ichin), cholesterol, phenylacetic acid mustard, prednisone mustard, trolofosamide, uracil mustard; nitrosoureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics, such as aclarubicin, actinomycin, ostralimycin, azaserine, bleomycin, actinomycin C, calicheamicin, carabicin, carminomycin, chromomycin, dactinomycin, daunomycin, detorubicin, 6-diaza-5-oxo-L-leuprocin ammonia, doxorubicin, epirubicin, esorubicin, idarucizumab, mexilomycin, mitomycin, mycophenolic acid, nogamycin, olivetomycin, peplomycin, sphaminomycin, puromycin, quinamycin, rodorubicin, streptozocin, streptozotocin, tuberculocidin, ubenimex, zinostatin, zorubicin; antimetabolites, such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs, such as dinotin, methotrexate, pteropterin, trimetrexate; purine analogs, such as fludarabine, Labine, 6-mercaptopurine, thiabendazole, thioguanine; pyrimidine analogs, such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-FU; androgens, such as captestosterone, drostanolone propionate, cyclothiodine, melastane, testolactone; antiadrenal agents, such as aminoglutethimide, mitotane, trilostane; folic acid supplements, such as folinic acid; acetoglucosalactone; aldophosphamide glycosides; aminolevulinic acid; amsacrine; bestabuc; bisantrene; idatrox; defuvalamide; colchicine; diazocone; efamixin; elinium acetate; etoglu; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguanidine; mitoxantrone; mopidarol; niteracrine;pentostatin; phenamet; pirarubicin; podophyllic acid; 2-acetylhydrazine; procarbazine; Razoxane; sizoran; spirogermanium; tricosporin; triazoline; 2,2',2"-trichlorotriethylamine; urethane; vindesine; dacarbazine; mannochloridone; dibromomannitol; dibromodulanol; piperobroman; metoclotrine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes, such as paclitaxel (TAXOL TM , Bristol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel ( Rhne-Poulenc Rorer, Antony, France; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; mitoxantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RF S2000; difluoromethylornithine (DMFO); retinoic acid derivatives such as Targretin TM (Beselotin), Panretin TM (Yali Cuitonin);ONTAK TM(denileukin); esperamicin; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are anti-hormonal agents used to regulate or inhibit the effects of hormones on tumors, such as anti-estrogens, including, for example, tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone and toremifene (Fareston); and anti-androgens, such as flutamide, nilutamide, bicalutamide, leuprolide and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Combinations of chemotherapeutic agents were also administered when appropriate, including but not limited to CHOP, cyclophosphamide Doxorubicin (hydroxydoxorubicin), vincristine and prednisone.

[0261] In some embodiments, the chemotherapeutic agent is administered simultaneously or within a week after the engineered cell, polypeptide or nucleic acid is administered. In other embodiments, the chemotherapeutic agent is administered 1 to 4 weeks, 1 week to 1 month, 1 week to 2 months, 1 week to 3 months, 1 week to 6 months, 1 week to 9 months or 1 week to 12 months after the engineered cell, polypeptide or nucleic acid is administered. In other embodiments, the chemotherapeutic agent is administered at least 1 month before the cell, polypeptide or nucleic acid is administered. In some embodiments, the method further comprises administering two or more chemotherapeutic agents.

[0262] A variety of additional therapeutic agents can be used in combination with the compositions described herein. For example, additional therapeutic agents that may be useful include PD-1 inhibitors, such as nivolumab. Pembrolizumab Pembrolizumab, pidilizumab, and atezolizumab

[0263] Additional therapeutic agents suitable for combination with the present disclosure include, but are not limited to: ibrutinib Ofatumumab Rituximab Bevacizumab Trastuzumab Trastuzumab emtansine Imatinib Cetuximab ( Panitumumab Catumaxomab, ibritumomab, ofatumumab, tositumomab, brentuximab, alemtuzumab, gemtuzumab, erlotinib, gefitinib, vandetanib, afatinib, lapatinib, neratinib, axitinib, masitinib ib), pazopanib, sunitinib, sorafenib, toceranib, lestaurtinib, axitinib, cediranib, lenvatinib, nintedanib, pazopanib, regorafenib, semaxanib, sorafenib, sunitinib, tivozanib, toceranib, vandetanib, entecavir entrectinib, cabozantinib, imatinib, dasatinib, nilotinib, ponatinib, radotinib, bosutinib, lestaurine, ruxolitinib, pacritinib, cobimetinib, selumetinib, trametinib, binimetinib nib), alectinib, ceritinib, crizotinib, aflibercept, adipotide, denileukin-toxin conjugates, mTOR inhibitors such as everolimus and temsirolimus, hedgehog inhibitors such as sonidegib and vismodegib, CDK inhibitors such as CDK inhibitors (palbociclib).

[0264] In some embodiments, the composition including the immune cells containing CAR can be administered together with the treatment regimen to prevent cytokine release syndrome (CRS) or neurotoxicity. The treatment regimen for preventing cytokine release syndrome (CRS) or neurotoxicity can include lenzilumab, tocilizumab, atrial natriuretic peptide (ANP), anakinra, iNOS inhibitors (eg, L-NIL or 1400W). In another embodiment, the composition including the immune cells containing CAR can be administered together with an anti-inflammatory agent. Anti-inflammatory agents or drugs include, but are not limited to, steroids and glucocorticoids (including betamethasone, budesonide, dexamethasone, hydrocortisone acetate, hydrocortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone); non-steroidal anti-inflammatory drugs (NSAIDS), including aspirin, ibuprofen, naproxen, methotrexate, sulfasalazine, leflunomide, anti-TNF agents, cyclophosphamide and mycophenolate. Exemplary NSAIDs include ibuprofen, naproxen, naproxen sodium, Cox-2 inhibitors, and sialates. Exemplary analgesics include acetaminophen, oxycodone, tramadol with propoxyphene hydrochloride. Exemplary glucocorticoids include cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, or prednisone. Exemplary biological response modifiers include molecules directed to cell surface markers (e.g., CD4, CD5, etc.), cytokine inhibitors such as TNF antagonists (e.g., etanercept, ), Adalimumab and infliximab Chemokine inhibitors and adhesion molecule inhibitors. Biological response modifiers include monoclonal antibodies as well as recombinant forms of molecules. Exemplary DMARDs include azathioprine, cyclophosphamide, cyclosporine, methotrexate, penicillamine, leflunomide, sulfasalazine, hydroxychloroquine, gold (oral (auranofin) and intramuscular) and minocycline.

[0265] In certain embodiments, the compositions described herein are administered in combination with cytokines. Examples of cytokines are lymphokines, monokines, and traditional polypeptide hormones. Among the cytokines are growth hormones, such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones, such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); liver growth factor (HGF); fibroblast growth factor (FGF); prolactin; placental lactogen; mullerian inhibitory substance; mouse gonadotropin-related peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factor (NGF), such as NGF-β; platelet growth factor; transforming growth factor (TGF), such as TGF-α and TGF-β; insulin-like growth factor-I and II; erythropoietin (EPO); osteoinductive factors; interferons, such as interferon-α, β and γ; colony stimulating factors (CSF), such as macrophage-CSF (M-CSF), granulocyte-macrophage-CSF (GM-CSF) and granulocyte-CSF (G-CSF); interleukins (IL), such as IL-1, IL-1α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-15, IL-21; tumor necrosis factor, such as TNF-α or TNF-β; and other polypeptide factors, including LIF and kit ligand (KL). As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture, as well as biologically active equivalents of native sequence cytokines.

[0266] Reagent test kit

[0267] In one aspect, the present disclosure provides a kit for assessing and / or detecting the presence of a genomic abnormality or variant (eg, an inversion) in a cell population.

[0268] In one embodiment, the kit includes a first primer molecule, a second primer molecule and a probe molecule. In one embodiment, the first primer molecule includes CCAGAGACAACGCCAAGAACTCA (SEQ ID NO: 1), the second primer molecule includes CCCCGCTCCCATGGAAATATGA (SEQ ID NO: 2), and the probe molecule includes CCACAGCCACCCCCATCCCT (SEQID NO: 3). In one embodiment, the first primer molecule, the second primer molecule and the probe molecule can be used to detect the first breakpoint of the inversion. In another embodiment, the first and second primer molecules correspond to the first breakpoint. In one embodiment, the first breakpoint is the breakpoint of the telomeric inversion.

[0269] In another embodiment, the kit may further include or may itself include the following: a third primer molecule, a fourth primer molecule, and a second probe molecule. In one embodiment, the third primer molecule includes AGCAGCCAAATCCTTCAGTC (SEQ ID NO: 4), the fourth primer molecule includes GCAGCAAGGTTTTTGTCTGG (SEQ ID NO: 5), and the second probe molecule includes ACTCACAGCTGGGGGATGCC (SEQ ID NO: 6). In one embodiment, the third primer molecule, the fourth primer molecule, and the second probe molecule can be used to detect the second breakpoint of the inversion. In another embodiment, the third and fourth primer molecules correspond to the second breakpoint. In one embodiment, the second breakpoint is a breakpoint of a centromere inversion. The probe molecule may include a detectable label or portion. In one embodiment, the probe molecule includes one or more probe sequences, which may include a detectable portion, such as a fluorophore or fluorescent portion.

[0270] On the one hand, the present disclosure provides a kind of test kit for assessing and / or detecting the presence of genome abnormality or variant (for example, translocation) in cell colony.In another embodiment, test kit may include the 5th primer molecule, the 6th primer molecule and the 3rd probe molecule for detecting the first district of translocation.In one embodiment, the 5th primer molecule includes AGGCCTGGCCGTGAA (SEQ ID NO:7), the 6th primer molecule includes CCCAGCCAGGGCCTTA (SEQ ID NO:8), and the 3rd probe molecule includes ACTTGCCAGCCCCACAGAGCCCC (SEQ ID NO:9).In another embodiment, test kit may include the 7th primer molecule, the 8th primer molecule and the 4th probe molecule for detecting the second district of translocation.In one embodiment, the 7th primer molecule includes AGCAGTGCAGCCCCA (SEQ ID NO:10), the 8th primer molecule includes CTCCAGGCCACAGCAC (SEQ ID NO:11), and the 4th probe molecule includes CCAGGCCCGCTGTGTCCCCAGTT (SEQ ID NO:12).

[0271] The following examples are for illustrative purposes only. Various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description.

[0272] Examples

[0273] Example 1 - Spontaneous Chromosome 14 Rearrangement Post-Infusion in Allogeneic CAR T Cells

[0274] Chromosome 14 inversions were found in patients with bone marrow aplasia after treatment with allogeneic chimeric antigen receptor (CAR) T cells, and the allogeneic CAR T cells contained gene editing performed with transcription activator-like effector nucleases (TALENs). Sequencing of patient samples revealed that the centromere breakpoints did not involve the TALEN editing site at the T cell receptor α constant (TRAC) locus on chromosome 14, but involved a site of about 10kb distal to the T cell receptor α connection 7 (TRAJ7) locus, and telomere breakpoints were found at the immunoglobulin heavy chain variable (IGHV) 3-69-1 locus. Recombination signal sequences (RSS) were found at the inverted sites, indicating activity mediated by recombination activation genes (RAGs). Although chromosome 14 inversions represent dominant clones, the chromosome 14 inversions were detected in the case of reducing absolute CAR T and total lymphocyte counts ( Figure 1D). No inversions were detected in the drug product administered to this patient or in any drug product used in this or related trials. No inversions were detected in this patient at an earlier time point, and no inversions were observed in any other patient enrolled in this or related trials. There were no clinical consequences associated with inversions. This situation suggests that spontaneous recombination events can occur in adoptive therapy studies, which may be mediated by RAG enzymes and are unrelated to gene editing.

[0275] Female patients with treatment-refractory transformed follicular lymphoma who had failed autologous CAR T-cell product generation were enrolled in an allogeneic CD19 CAR T-cell study (NCT04416984: ALPHA-2; Safety and Efficacy of ALLO-501A Anti-CD19 Allogeneic CAR T Cells in Adults with Relapsed / Refractory Large B-Cell Lymphoma). The CAR T cells were gene-edited at the TRAC locus on chromosome 14 to prevent T-cell receptor (TCR) expression and avoid graft-versus-host disease (GvHD), and at the CD52 locus on chromosome 1 to allow lymphodepletion with anti-CD52 antibodies. After lymphodepletion with fludarabine, cyclophosphamide, and anti-CD52 antibodies, the patient received a single CAR T-cell infusion from a male donor on day 0, which resulted in a partial response, and another dose of CAR T-cell infusion from a second male donor on day 36 (planned as part of a consolidation regimen) without additional lymphodepletion. Prior to the second infusion, the patient underwent a bone marrow biopsy on day 26 due to cytopenias, a common side effect observed with CAR T therapy (Nahas, GR et al. Incidence and risk factors associated with a syndrome of persistent cytopenias after CAR-T cell therapy (PCTT). LeukLymphoma 61, 940-943, doi:10.1080 / 10428194.2019.1697814 (2020); Rejeski, K. et al. CAR-HEMATOTOX: a model for CAR T-cell-related hematologic toxicity in relapsed / refractory large B-cell lymphoma. Lymphoma. Blood, 138, 2499-2513, doi:10.1182 / blood.2020010543(2021). In addition to male donor lymphocytes, a cellularity of 30% trilineage hematopoiesis and some normal female lymphocytes were observed in the biopsy. CAR T expansion was observed after the first infusion, peaking on day 36, followed by contraction, and then a subsequent and comparable peak was observed after the second dose of CAR T cells, as well as a subsequent secondary contraction ( Figure 1A). This profile is expected and typical of CAR T cell expansion / contraction observed in other patients treated with the same product.

[0276] Figure 1A Longitudinal measurements of a patient's CAR T cell VCN, ALC, and TCRβ clones are shown. The primary y-axis (left) captures CAR T cells measured by VCN [cyan line - labeled "VCN"], and the secondary y-axis (right) captures ALC levels [purple line - labeled "ALC"]. The bottom panel shows the 5 most abundant TCRβ clones at day 56. VCN increased after the first infusion on day 0, first peaking on day 36 and then again on day 43. Rearrangements were first detected on day 47 in the setting of declining VCN and ALC. As VCN continued to decline, the proportion of cells that were FISH rearrangement positive increased until day 69. Given that their abundance and trajectory are similar to events identified by FISH assays, it is assumed that the TCRβ clones detected at frequencies of 29% and 41% on days 50 and 56, respectively, are clones carrying inversions. Inversion junctions were measured by ddPCR relative to a control gene (for telomeric breakpoints or "breakpoint 2" - see Figure 2 ) to estimate the relative abundance of the total lymphocyte population and is presented in red (red line - labeled "ddPCR").

[0277] The patient developed HHV6 reactivation on day 30 and underwent antiviral therapy, likely contributing to the observed cytopenias. Repeat bone marrow evaluation on day 47 showed chromosome (14) (q11.2q32) inversion in all donor-derived T cells (19 of a total of 20 cells determined via karyotyping: data not shown). Cells carrying chromosome 14 inversions in peripheral blood were traced back to the first infused allogeneic drug product batch via human leukocyte antigen (HLA) and short tandem repeat (STR) multiplex genomic typing that uniquely identifies recipient and donor alleles. This indicated that 98% of the T cells were from the first donor infusion and the remaining 2% of cells present were from the host patient source, with no cells from the second donor infusion. Repeat karyotyping of the bone marrow was performed from day 62 onwards but failed due to insufficient mitotic activity (no metaphase cells to analyze). Peripheral blood analysis on day 69 yielded only 4 mitotic cells, which showed the presence of the inversion. The difficulty in obtaining metaphase cells at both time points suggests that the remaining cells had a low proliferation index.

[0278] Results of a TCR A / D break apart fluorescence in situ hybridization (FISH) assay for cells that do not actively divide (Vysis TRA / D Break Apart FISH Probe Kit - Acute Lymphoblastic Leukemia (ALL) - using the SpectrumOrange probe that spans approximately 659 kb centromere of the T cell receptor alpha / delta locus and the SpectrumGreen probe that spans approximately 714 kb telomeric of the T cell receptor alpha / delta locus. – Figure 1C ) showed that in 200 cells sampled at different time points, rearrangements at the TCR A / D locus ranged between 32% and 41% (Table 1A).

[0279] Table 1A

[0280]

[0281] Detection time point

[0282] ND = not detected; grey boxes indicate that ddPCR, FISH or karyology were not assessed.

[0283] 1 = Patient had a 6 day delay in the second infusion. Visit date was calculated based on this 6 day delay.

[0284] 2 = Fresh bone marrow and peripheral blood samples were analyzed at a clinical site (Medical College of Wisconsin) using the 14q11 TCRA / DFISH assay.

[0285] 3 = Karyotype = number of dividing cells, males with chromosome 14 inversion / male dividing cells out of 20.

[0286] 4 = no metaphase cells detected.

[0287] At all time points, karyotype and FISH analysis results decreased in CAR T cells, as measured by vector copy number (VCN) analysis ( Figure 1A ), and low peripheral blood counts, with the absolute lymphocyte count (ALC) reaching 2.07 x 10 3 cells / μl peaked at 1.08 x 10 cells / μl on the 44th day. 3 cells / μl and decreased to 0.3 x 10 3Cells / μl. Although chromosome (14)(q11.2q32) inversion is a characteristic of T-cell prolymphocytic leukemia (T-PLL), the absence of all other diagnostic criteria, including the expression of other genetic abnormalities and the presence of high T cell counts, organ involvement, or expression of T-cell leukemia / lymphoma protein (TCL1), excludes the diagnosis of T-PLL (Staber, PB et al. Consensus criteria for diagnosis, staging, and treatment response assessment of T-cell prolymphocytic leukemia. Blood 134, 1132-1143, doi: 10.1182 / blood.2019000402 (2019)). In addition, the rare lymphocytes observed in the bone marrow are consistent with CAR T cells in morphology and immunophenotype and do not have blast morphology.

[0288] Clonality analysis using TCRβ sequencing revealed clones with 29% and 41% abundance on days 50 and 56, respectively ( Figure 1A ). This clone was not detected at the previous sampling point on day 26. A total of 8 clones with lower abundance in the range of 1% to 3% were identified on day 56, and all other clones were present at less than 1% abundance. Given the similarity in abundance of the dominant TCRβ clone to that of the 14q11 disruption by FISH, it was hypothesized that this clone was the one containing the inversion. This dominant TCRβ clone could not be detected in the drug product above the detection level of the assay ( Figure 1B ).

[0289] Figure 1BConfirm that the dominant clone from the patient is not detected in the ALLO-501A drug product.Show the TCRβ sequencing results of the peripheral blood (y-axis) and drug product (x-axis) of the 56th day patient.When all the points are aligned on the axis, it indicates that the two repertoires are different, and when the points are aligned on the diagonal, it indicates that the repertoire is highly similar.The points falling on the axis are not detected in another sample, such as the points along the y-axis of the patient are not detected in the infusion product.The dominant clone (41%) in the patient is observed to be the upper left point on the y-axis, indicating that the dominant clone is not detected in the infusion product.The shadow of the point represents the statistical significance of the frequency shift of the clone.Compared with the GMP infusion product batch, the clone marked as "Pt" has a significantly higher frequency (the significance assessed by the binomial distribution framework) in the patient's peripheral blood sample, and the clone marked as "batch" represents a significantly higher frequency in the infusion product batch compared with the patient's sample. Two gray shades indicate that no statistical difference was detected between the two frequencies (dark gray circles) or that it was not tested (or excluded, light gray circles within the dashed quarter circle). Finally, the black circle around the outside of the point indicates that the clone is in the infusion product (all clones not along the y-axis are circled). TCRβ sequencing is used to track the top clones from the patient's peripheral blood (PB) and infusion drug product batches over time. The top 20 clones were analyzed to determine the proportion or frequency of each clone in the total repertoire of the following samples: patient PB on day 56 (left), drug product batch 1, and drug product batch 2 (data not shown). Dominant clones from patient samples were observed on days 50 and 56, but not in any other samples, including two drug product batches (data not shown).

[0290] like Figure 1D As shown, detection of inversion junctions by ddPCR coincided with the emergence of the dominant TCRβ clone. No inversions were detected by ddPCR in patients prior to Day 47, in any other patient in this or any other allogeneic trial, in any other drug product, or in any donor source.

[0291] Next-generation sequencing (NGS) was used to perform short and long read whole genome sequencing of peripheral blood samples on day 61 to examine the precise breakpoints of the inversion and determine whether the inversion was likely the result of TALEN editing. Sequencing confirmed the presence of the chromosome 14 inversion and identified the inversion breakpoint site ( Figure 2The centromeric (14q11.2) inversion site occurs within the TCR A / D locus at the beginning of the T cell receptor junction gene TRAJ7 (chr14:22537626; hg38 reference genome version). The telomeric (14q32) inversion site occurs at the IGHV3-69-1 pseudogene (chr14:106728167; hg38 reference genome version) within the IGH variable region.

[0292] Figure 2 Figures of chromosome 14 inversions detected and characterized from peripheral blood samples of patients at day 61 by short and long read whole genome sequencing are shown. Two breakpoints were identified at TRAJ7 and IGHV3-69-1. The relative position and approximate distance from the TRACTALEN cleavage site are shown. As inferred from the RSS sequence, at each of the two breakpoints, the predicted RAG cleavage site is also marked. Other genes are added as positioning markers to show the effects of inversions and deletions.

[0293] The TRAJ7 site of the inversion within the TCR A / D locus is approximately 10 kb from the TRAC locus where TALEN gene editing occurs, indicating that the inversion was not generated by on-target cleavage from the TALEN. Large deletions have been reported to occur during the gene editing process (Adikusuma et al. (2018). Large deletions induced by Cas9 cleavage. Nature 560:E8-E9; Kosicki et al. (2018). Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements. Nat Biotechnol 36:765-771; Park et al. (2022). Comprehensive analysis and accurate quantification of unintended large gene modifications induced by CRISPR-Cas9 gene editing. Sci Advances Adv)》8:eabo7676) and may affect the formation of abnormal structural variants. However, short reads and long reads whole genome sequencing only show the expected 49bp deletion at the target site of TRAC TALEN, and there is no evidence of large deletion at the locus. In addition, the presence of RSS sites at the inversion junction indicates that RAG-mediated recombination and large deletions at the TRAC TALEN site are possible causes of inversion. The sequences within 500bp of the two breakpoints of chromosome 14 inversion (q11.2q32) were analyzed to identify possible off-target TALEN binding sites that may be involved. The results show that there is no potential TRAC or CD52 homodimer or heterodimer TALEN binding site indicating that this inversion is also unrelated to TALEN off-target gene editing. Between two 15bp monomer DNA binding sites, no potential TALEN binding site was found at a level less than or equal to 7 cumulative mismatches. No lentiviral vector integration site was detected at or near the site of the inversion.

[0294] A common RSS was observed at both sites of the inversion. The RSS typically contains a conserved heptamer (common 5'-CACAGTG-3') and nonamer (common 5'-ACAAAAACC-3') sequence separated by 12 (RSS-12) or 23 (RSS-23) nucleotides of variable sequence. The presence of the RSS supports the hypothesis that the inversion is the result of RAG-mediated V(D)J recombination between the two distal sites. That is, the centromeric TRAJ7 carries an adjacent RSS-12 sequence (chr14:22,537,594-22,537,621; hg38 reference genome version), and the telomeric IGHV3-69-1 contains an adjacent RSS-23 sequence (chr14:106,728,124-106,728,162; hg38 reference genome version), both of which conform to the 12 / 23 rule (van Gent et al. RAG1 and RAG2 proteins establish the 12 / 23 rule in V(D)J recombination, Cell 85(1), 107-113, 10.1016 / s0092-8674(00)81086-7 (1996)). It is also observed that the deletion after the break and before the connection at TRAV38-2DV8 and TRAJ7 and IGHV3-42 and IGHV3-69-1. It has been observed that the insertion of the signal end fragment produced by the RAG protein almost always produces the deletion or other rearrangement of the target DNA (Chatterji, M., Tsai, CL and Schatz, DG mobilize the signal end produced by RAG by transposition and insertion in vivo. "Molecular and Cell Biology" 26, 1558-1568, doi: 10.1128 / MCB.26.4.1558-1568.2006 (2006)). Short read sequencing is used to identify the two breakpoints of the inversion, and subsequent long read sequencing is used to identify the deletion at each of the two breakpoints.

[0295] Sequence information from short-read NGS analysis was used to design primer pairs to detect both ends of the inversion in order to quantitatively assess the levels of inversions present in patient samples prior to TALEN editing as well as in clinical batches and their corresponding PBMCs ( Figure 3AThe lower limit of detection of the assay was 1 / 1,000, which is consistent with reported estimates of the sensitivity of digital droplet polymerase chain reaction (ddPCR) (Dong, L., Wang, S., Fu, B., and Wang, J. Evaluation of droplet digital PCR and nextgeneration sequencing for characterizing DNA reference material for KRAS mutation detection. Sci Rep 8, 9650, doi:10.1038 / s41598-018-27368-3 (2018)).

[0296] Figure 3A-3B A method for developing a telomeric inversion junction ddPCR assay is described. As part of the initial method development, primers and probes for the ddPCR assay were designed and optimized. Inversion junctions and amplified copies of RPP30 were measured by a ddPCR droplet reader to analyze the inversion percentage. Each ddPCR plate consisted of a negative control (NEG CTRL: TaqMan TM control genomic DNA), positive control (POS CTRL: synthetic template added to TaqMan TM The inversion frequency was measured as a percentage of the total genomic copies of the reference gene (RPP30). The synthetic template was titrated to 35 ng of human genomic DNA corresponding to approximately 10,000 human genome copies and analyzed for specificity and sensitivity to the inversion sequence. Figure 3A In is the raw data of ddPCR from Quantasoft software, which indicates the droplets observed for telomere breakpoints (blue-top panel) and reference genes (green-bottom panel). The ddPCR assay was found to detect signals from synthetic templates at a sensitivity level as low as approximately 0.1%, as shown by quantification of the reported copy number (Table 1B) (Dong, L. et al. 2018).

[0297] Table 1B: Detection limits of ddPCR using synthetic templates for telomeric inversion breakpoints.

[0298]

[0299]

[0300] *Using 35 ng of human genomic DNA; ND = not detected; inversion % < LOD (0.1%); R1, R2, and R3 refer to three replicates for each sample; **Expected copy of RPP30

[0301] At time points during the period from before cell administration through up to day 61, ddPCR assays were performed to analyze the inverted telomeric ends ( Figure 4 ) of available cryopreserved peripheral blood samples from this patient, patients of all other administered drug products, and donor materials.

[0302] Figure 4 Shows longitudinal detection of telomere breakpoint junctions in patient peripheral blood samples by ddPCR. The x-axis represents patient samples (in triplicate), and the y-axis represents the amplitude of the signal. Each point represents an independent droplet measurement event. The upper inset shows detection of the telomere breakpoint, and the lower inset shows detection of the reference signal. The lower signal amplitude on day 61 may be due to the presence of lower-quality DNA in this sample.

[0303] The earliest time point at which an inversion was detected was 47 days after CAR T cell infusion. Compared to the reference gene ribonuclease P / MRP subunit P30 (RPP30), the frequency of inversion was measured as a relative percentage and ranged from 3% to 19% between days 47 and 61 in peripheral blood ( Figure 4 and Table 1A). Centromeric inversion junctions of longitudinal patient samples were also assayed by ddPCR and detected at the same time points (data not shown). The time course of inversion detection was consistent with detection by cytogenetics, FISH, and related clones emerging from TCRβ sequencing. By day 60, it decreased in concert with VCN and ALC (Figure 1 and Table 1A). In all cases, samples from other patients were tested at 2 time points spanning administration and ranged from day 7 of lymphodepletion to 9 months, and chromosome 14 inversions were below the limit of detection. In all trials using the gene editing manufacturing platform, no other drug products or healthy donor starting materials for drug products were tested positive.

[0304] Chromosome 14 inversions were first described in T-cell tumor lines (Baere et al. (1985). Fusion of an immunoglobulin variable gene and a T cell receptor constant gene in the chromosome 14 inversion associated with T cell tumors. Cell 43:705-713; Baer et al. (1987). The mechanism of chromosome 14 inversion in a human T cell lymphoma. Cell 50:97-105; Baer et al. (1987). The breakpoint of an inversion of chromosome 14 in a T-cell leukemia: sequences downstream of the immunoglobulin heavy chain locus are implicated in tumorigenesis). tumorigenesis.). Proc. Natl. Acad. Sci. USA 84:9069-9073; Denny et al. (1986). A chromosome 14 inversion in a T-cell lymphoma is caused by site-specific recombination between immunoglobulin and T-cell receptor loci. Nature 320:549-551); however, it was later shown that the chromosome 14 inversion is present in normal T cells from healthy individuals.Chromosome 14 inversions have been detected in post-thymic mature T cells of normal individuals and are believed to be mediated by V(D)J recombination mechanisms (Callen, E. et al. Chimeric IgH-TCRα / δ translocation in T lymphocytes mediated by RAG. Cell Cycle 8, 2408-2412, doi: 10.4161 / cc.8.15.9085 (2009); Machado, HE et al. Genome-wide mutational signatures of immunological diversification in normal lymphocytes. Biopreprint, 2021.2004.2029.441939, doi: 10.1101 / 2021.04.29.441939 (2021)). In one report, in three healthy donors studied by karyotyping (>1,000 cells analyzed per donor), an average of 0.15% of the lymphocytes analyzed in all donors had inversions (Aurias, A. et al. Inversion (14)(q12qter) or (q11.2q32.3): the most frequently acquired rearrangements in lymphocytes. Human Genetics 71, 19-21, doi:10.1007 / BF00295660 (1985)). In another study of 2,595 healthy individuals (20-40 cells per individual analyzed), 49 chromosomal breakpoints involving 14q11 or 14q32 were detected. Six of these infrequently rearranged lymphocytes out of a total of 53,580 cells analyzed showed chromosome 14q11:q32 inversion (Hecht, F. et al. Fragile sites restricted to lymphocytes: molecular recombination and malignancy. Cancer Genetics and Cytogenetics 26, 95-104, doi:10.1016 / 0165-4608(87)90137-3(1987)). Studies examining chromosomal integrity in normal cultured lymphocytes have revealed four frequent sites of chromosomal breakage: 7p13 (near the location of the TCRγ chain), 7q35 (location of the TCRβ chain), 14q11 (location of the TCRα chain), and 14q32 (location of the IGH chain), and suggested that these frequent sites act specifically as fragile sites in normal lymphocytes, as defined by the non-random frequency of chromosomal translocations or inversions associated therewith (Hecht, F. (1987); Welch, JP et al. Non-random occurrence of 7-14 translocations in human lymphocyte cultures. Nature 255, 241-245, doi: 10.1038 / 255241a0 (1975)).

[0305] In summary, TALEN gene editing does not involve chromosomal inversion events, because sequencing indicates that inversion does not occur at the TALEN site. Although the source of the chromosome structural variant is the infused donor cells, the variant is only detected after the product is infused, and the site of the inversion does not involve TALEN-mediated gene editing. Similarly, lentiviral vector integration does not lead to the generation of chromosome 14 inversions. Inversions are associated with RSS, indicating that they are the result of V (D) J recombination. In addition to RAG-mediated gene rearrangements during T cell development, reactivation of RAG after the thymus has been demonstrated in preclinical studies, a process called TCR correction. (Mostoslavsky, R. and Alt, Receptor revision in FWT cells: an open question? (Receptor revision in T cells: an open question?) "Trends Immunol" 25, 276-279, doi: 10.1016 / j.it.2004.04.001 (2004)). This has been postulated to increase the T cell repertoire in the context of a dominant T cell response and may play a role in peripheral tolerance.

[0306] The clonal populations containing inversions emerged in the context of an overall contraction of all donor cells in the patient, as seen in other CAR T cell trials (Nobles, CL et al. CD19-targeting CAR T cell immunotherapy outcomes correlate with genomic modification by vector integration. J Clin Invest 130, 673-685, doi: 10.1172 / JCI130144 (2020); Sheih, A. et al. Clonal kinetics and single-cell transcriptional profiling of CAR-T cells in patients undergoing CD19 CAR-T immunotherapy. Nat Commun. Commun)》11,219,doi:10.1038 / s41467-019-13880-1(2020)). The fact that no T cells were detected from the second infusion was unexpected, but may be explained by an adverse bone marrow condition leading to aplasia, in which the first infusion product still declined and the second infusion product did not adequately engraft. No inversions were detected in the donor or clinical batches used to treat the patient, or from any other clinical batches or patient samples, leading to the conclusion that this event occurred after the infusion and was limited to this particular patient. Although the role of inversions in clonal expansion is uncertain, there is no evidence that the expansion is a result of inversions; similarly, since CD3-positive transplanted cells did not expand, TCR-driven expansion is not supported. Importantly, there is no evidence of clinically significant sequelae associated with the inversion, and specifically no evidence of malignant transformation. Following CAR T-cell therapy, the patient underwent an allogeneic transplant on day 76 due to prolonged pancytopenia and showed immune reconstitution before experiencing disease relapse and initiating new therapy on day 134. However, as the patient died of disease progression, it was not possible to monitor any long-term consequences of the inversion.

[0307] With the advent of adoptive cell therapy, industry and / or academic-led clinical programs using gene-edited or engineered cell products have rapidly expanded, both of which carry the risk of genetic alterations such as off-site gene editing, chromosomal structural changes (large deletions, inversions or translocations), or insertional mutagenesis. This report illustrates that structural variants also exist naturally in human lymphocytes in vivo and can be expected to be observed in the clinic in the future. In a recent publication, 1,037 structural variants were observed in 635 normal human lymphocytes. Of these structural variants, 85% involved Ig or TCR regions. In addition, the publication further showed that an estimated 12% of non-Ig-TCR and 84% of IG-TCR structural variants were RAG-mediated due to the presence of RSS motifs or heptamers near the breakpoints (Machado et al. (2022). Diverse mutational landscapes in human lymphocytes. Nature 608:724-732).

[0308] method

[0309] Patient treatment history. The patient was a 57-year-old female with stage IV transformed follicular lymphoma (tFL) with a t(8;14) chromosomal translocation involving cMyc rearrangement. The patient was refractory to all previous therapies and had undergone radiation to the mesenteric lymph nodes and was also unable to undergo autologous CAR T-cell therapy because autologous CAR T cells did not expand during manufacturing. The patient received cyclophosphamide 500 mg / m on days 5, 4, and 3. 2 / day, fludarabine 30mg / m 2 / day × 3 days and ALLO-647 (anti-CD52 antibody, Allogene Therapeutics, South San Francisco, CA) 20 mg / day × 3 days on days 2, 1, and 0, and 120 × 10 6 CAR +ALLO-501A of cells was administered. Due to recent grade 3 HHV-6 reactivation and subsequent pancytopenia, on day 36, a second dose of ALLO-501A called consolidation was administered from a spare batch without pretreatment. Both cell infusions were from T cells derived from a separate male donor. Although refractory to all previous therapies, the patient achieved a partial response on day 28, which was confirmed on day 56. The patient received an allogeneic transplant due to prolonged pancytopenia on day 76, and showed immune reconstruction before experiencing disease relapse and starting additional therapy on day 134.

[0310] Karyotyping and FISH. Standard karyotyping was performed locally on tissue from fresh peripheral blood and bone marrow samples at the Medical College of Wisconsin (Milwaukee, WI). The 14q11.2 region was further interrogated by fluorescence in situ hybridization (FISH) using a TRA / D dual-color break-apart probe ( Figure 1C ; Abbott Molecular, Abbot Park, IL) with Spectrum Orange probe: chr14:20895431-21554322 and Green probe: chr14:22531141-23244993 (hg38 reference genome version). The break-apart probe set was applied to the sample, hybridized, and washed according to the standard Medical College of Wisconsin interphase FISH protocol. All cells present in the specimen were assayed until a complete 20-cell study was obtained (if possible); karyotyping (chromosome cleavage and pairing) was performed in approximately 3 cells in each cell line. A total of 200 interphase cells were scored to determine TCRA / D rearrangements.

[0311] HLA and STR typing. Human leukocyte antigen (HLA) and chimerism testing was performed on the ALLO 501A drug product (i.e., CAR T cells) and patient genomic DNA by Versiti (Milwaukee, Wisconsin). Eleven HLA class I and class II sequences were amplified and sequenced with high-resolution next-generation sequencing (NGS). In addition, multiple PCR amplification was performed on 8 total short tandem repeat (STR) loci. Amplification products from CAR T cells and patient baseline DNA were used to uniquely identify the recipient and donor alleles, and the fluorescence of the recipient and donor alleles was used to calculate the percentage of chimerism. Using the most appropriate identified markers, the average percentage derived from the recipient and donor is reported.

[0312] TCRβ clonality data. Sequencing of the TCRβ CDR3 region in genomic DNA extracted from whole blood or ALLO-501A drug product was performed by Adaptive Biotechnologies (Seattle, WA). The clonal frequency of each sample was calculated as the number of reads representing unique CDR3 sequences divided by the total number of reads for the sample. Scatter plots were used to compare clonal frequencies between 2 samples. The sensitivity of the assay was <7, 95% CI (0, 6.7 × 10 -6 )( Figure 1B ). The statistical significance of a shift in clone frequency in one sample relative to another was calculated using a binomial distribution framework.

[0313] VCN analysis. Vector copy number analysis was performed and analyzed by Navigate Biosciences (Carlsbad, CA) using a validated qPCR assay. Genomic DNA was extracted from patient peripheral blood and bone marrow aspirates collected in K2EDTA tubes using the QIAMP Blood DNA Midi Kit (QIAGEN, Germantown, MD) and quantified using a Qubit fluorometer. The patient DNA input range for each reaction was 20-200 ng, and the ALLO-501A drug product, 2X Gene Expression Master Mix (ThermoFisher Scientific, Waltham, MA) and molecular-grade water, ultrapure distilled water, DNase-free, and RNase-free water (ThermoFisher Scientific) were used with specific validated primer-probe sets. Analyses were performed on the Applied Bioscience ViiA7 qPCR System in conjunction with ViiA7 Applied Biosystems Software 1.2.4 or later (ThermoFisher Scientific).

[0314] Off-target TALEN evaluation. The flanking sequences (approximately 500 bp) on each side of the breakpoint were screened for potential TRAC and CD52 TALEN binding off-target sites (4 sequences, 2 per pair) using publicly available tools (Juillerat, A. et al., et al., (2014). Comprehensive analysis of the specificity of transcription activator-like effector nucleases. Nucleic Acids Res. 42, 5390–5402). Sequence analysis was performed using 3 methods: (1) NCBI BLASTn suite optimized for more dissimilar sequences, (2) Fuzzy Search DNA, which accepts a DNA sequence along with a query sequence and returns sites that are identical or similar to the query, and (3) TALENoffer, which scans the input sequence for off-targets of a given TALEN recognition sequence. Using the above method, no potential TALEN binding sites with a level of less than or equal to 7 cumulative mismatches were found on both 15 bp monomer DNA binding sites, which essentially ruled out the possibility of off-target editing events in the breakpoint region.

[0315] Whole genome sequencing and alignment. Peripheral blood was drawn from patients into K2EDTA tubes on the 61st day after infusion. Genomic DNA was purified from blood samples using the QIAamp DNA blood kit (Qiagen, Germantown, Maryland). Genomic DNA of the ALLO-501A drug product (i.e., CAR T cells) was purified using the AllPrep DNA kit (mini) (Qiagen, Germantown, Maryland). Libraries were prepared using the Illumina DNA preparation kit (Illumina, San Diego, CA, San Diego, CA). Separate DNA libraries were sequenced using the Illumina NovaSeq6000 platform (Illumina) at SP-500 cycles, 2×250 bp paired-end reads (Tarasov, A. et al., Sambamba: fast processing of NGS alignment formats. Bioinformatics 31, 2032-2034, doi: 10.1093 / bioinformatics / btv098 (2015)). Sequencing was performed at a depth of 100X to ensure that any variants with a frequency as low as 1% were detected. Paired-end sequencing tags and sequences both ends of the DNA fragments in the library, providing the ability to identify inconsistent alignments of paired reads to the genome to identify possible structural variants.

[0316] The alignment pipeline consisted of a series of steps that first assessed the read quality of FastQ files using the FastQC online tool (version 0.11.8; Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data (2010)). Next, reads were trimmed using Trim Galore 0.6.0 software (Babraham Institute Bioinformatics—Trim Galore) to remove sequencing adapters and low-quality sequences. Paired-end reads >80 bp after trimming were aligned using the BWA software package (version 0.7.17; Li, H. and Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler Transformation). transform). Bioinformatics 25, 1754-1760, doi: 10.1093 / bioinformatics / btp324 (2009)) and then use SAMtools to sort and index the resulting alignment files (version 1.9; Danecek, P. et al. Twelve years of SAMtools and BCFtools. Gigascience 10, doi: 10.1093 / gigascience / giab008 (2021)). Finally, Picard (version 2.20.3; Broad Institute) was used to generate alignment statistics, and MultiQC v1.8 (Ewels, P. et al. MultiQC: summarize analysis results for multiple tools and samples in a single report) was used. report). Bioinformatics 32, 3047-3048, doi:10.1093 / bioinformatics / btw354(2016)) to generate the final QC report.

[0317] The alignment files generated during the whole genome sequencing (WGS) process were used as input for identifying genomic structural variations. Repeated reads, split reads (end sequences of >20bp that do not match the reference sequence), and inconsistent reads that did not produce the expected alignment using SAMBLASTER (version 0.1.25; Faust, GG and Hall, IMSAMBLASTER: fast duplicate marking and structural variant read extraction. Bioinformatics 30, 2503-2505, doi: 10.1093 / bioinformatics / btu314 (2014)) and Sambamba (version 0.7.1; Tarasov, A., 2015) were deleted. The resulting file was used by two structural variation algorithms, LUMPY (version 0.2.13; Layer, RM et al., LUMPY: a probabilistic framework for structural variant discovery. Genome Biol 15, R84, doi: 10.1186 / gb-2014-15-6-r84 (2014)) and Manta (version 1.6.0; Chen, X. et al. Manta: rapid detection of structural variants and indels for germline and cancer sequencing applications. Bioinformatics 32, 1220-1222, doi: 10.1093 / bioinformatics / btv710 (2016)), to identify potential structural variation events with a minimum of 5 supporting sequencing reads. Results from both algorithms were combined and filtered to identify events affecting chromosome 14 where the breakpoints were close to 2 FISH probes suggesting the presence of an inversion. The Integrative Genomics Viewer (IGV version 2.6.1; Broad Institute) was used to verify possible structural variants and to examine the locations of potential inversion-associated breakpoints.

[0318] Validation of breakpoint sequences. High coverage, long read nanopore sequencing was used to validate the breakpoint sites, flanking sequences, and structures of the chromosome 14 inversion. Structural variants (SVs) were detected relative to the GRCh38 reference genome assembly using the NGMLR pipeline. Reads spanning the chromosome 14q11.2 and q32 regions were found. Two breakpoints (BPs) were identified at 22,537,626 and 106,728,167, respectively, thereby matching the two BPs previously identified in WGS with Illumina short read sequencing. In addition, although the junction of one of the inversions was intact, two deletions of approximately 255 kb each were identified at the junction of the other inversion. The molecular sequence of the junction region matched the expected reference genome region, but there were some small deletions, insertions, and SNPs, which were mainly due to base call errors in nanopore sequencing. Finally, amplicons spanning the breakpoints were generated and sequenced to confirm the breakpoints and flanking sequences.

[0319] Lentiviral Insertion Site Analysis. Integration site analysis (ISA) was performed at the Viral / Molecular High Density Sequencing Core at the University of Pennsylvania (Philadelphia, PA). This analysis was performed using the INSPIIRED pipeline (Berry, CC et al. INSPIIRED: Quantification and Visualization Tools for Analyzing Integration Site Distributions. Mol Ther Methods Clin Dev 4, 17-26, doi: 10.1016 / j.omtm.2016.11.003 (2017); Sherman, E. et al. INSPIIRED: A Pipeline for Quantitative Analysis of Sites of New DNA Integration in Cellular Genomes. Mol Ther Methods Clin Dev 4, 39-49, doi: 10.1016 / j.omtm.2016.11.002 (2017)). Integrated lentiviral sequences and ALLO-501ADP genomic DNA from patients were analyzed by nested PCR amplification and subsequent sequencing on the Illumina MiSeq or HiSeq platform. A novel blocking locked nucleic acid primer was used to reduce sequencing of undesired internal long terminal repeat sequences, and the integration site frequency was determined using the SonicaAbundance method.

[0320] PCR method development. Based on the NGS sequence information from the patient, the linear double-stranded DNA template (gBlock TM ) designed as synthetic templates and positive controls for method development at centromeric and telomeric sites of inversion (see Figure 3B ).

[0321] A specific TRAJ7 / IGHV3-69-1 junction was developed for identification in patients at breakpoint 2 (BP2) (see Figure 2 ) ddPCR assay. Similar considerations can be applied to the analysis of other types of inversions or other chromosomal abnormalities. Primers and probes capable of detecting the specific TRAJ7 / IGHV3-69-1 junction at BP2 were designed, and a ddPCR assay specific for this inversion was developed to quantitatively assess the level of the inversion (1) in patient samples and other patients treated with related drug product (DP) batches, (2) in clinical DP batches, and (3) in their corresponding PBMCs before TALEN editing. As further described herein, primers were optimized using synthetic templates derived from NGS sequence information.

[0322] The primers and probe for telomere BP2 are shown in Table 1C below. The expected PCR product size is 232 bp.

[0323] Table 1C

[0324]

[0325] *5'FAM, 3'ZEN / Iowa Black FQ Quencher.

[0326] In addition, a ddPCR assay specific for junctions within the TRCA / D locus at the beginning of the T cell receptor junction gene TRAJ7 identified as breakpoint 1 (BP1) in patients was developed (see Figure 2 ). Primers and probes capable of detecting specific linkage at BP1 were designed, and a ddPCR assay specific for this inversion was developed to quantitatively assess the level of the inversion (1) in patient samples and other patients treated with related drug product (DP) batches, (2) in clinical DP batches, and (3) in their corresponding PBMCs before TALEN editing. As further described herein, primers were optimized using synthetic templates derived from NGS sequence information. Primers and probes for centromere BP1 are shown in Table 1D below. The expected PCR product size is 131 bp.

[0327] Table 1D

[0328]

[0329] *5' FAM, 3' ZEN / Iowa Black FQ Quencher

[0330] As part of the initial method development, primers and probes for ddPCR assays were designed and optimized. Synthetic templates were titrated into human genomic DNA without inversion and the specificity and sensitivity to the inverted sequences were analyzed. The sensitivity level of the ddPCR assay to detect signals from synthetic templates was found to be as low as approximately 0.1% (Table 1B above; Dong et al. 2018). Inversions were also tested on increasing amounts of input DNA from drug products and related peripheral blood mononuclear cells (PBMCs) (Table 1E).

[0331] Table 1E: Telomere Inversion ddPCR Analysis of Drug Product Batches and Related PBMC Materials

[0332]

[0333]

[0334] ND = Not Detected, Inversion % < LOD (0.1%), R1, R2, and R3 refer to three replicates of each sample

[0335] Based on this data, 50 ng of human genomic DNA corresponding to approximately 15,000 human genomic copies was used as the input for each reaction. Some patient samples produced DNA of lower quality and / or concentration and the input DNA amount was adjusted accordingly. The amplification copies of the inverted junction and RPP30 were measured by a ddPCR droplet reader. Each ddPCR plate consisted of a negative control (NEG CTRL: TaqMan TM control genomic DNA), a positive control (POS CTRL: synthetic template spiked into TaqMan TM control genomic DNA), and a no-template control (NTC: water). The frequency of inversion was measured as a percentage of the total genomic copies of the reference gene (RPP30). ddPCR was performed using a Bio-Rad QX200 Droplet Digital PCR System (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer's instructions.

[0336] Inversion percentage = (BP copy number / RPP30 copy number) * 100

[0337] Example 2 - Assay Development for Detecting and Quantifying Chromosomal Translocations

[0338] Because ALLO-501A performs gene editing at both the TRAC locus (chromosome 14) and the CD52 locus (chromosome 1), the chromosomal translocation t(1;14)(p36;q11.2) is likely caused by known cleavage at the target TALEN CD52 and TRAC binding sites.

[0339] A sensitive ddPCR method was developed to quantify this expected but low-incidence translocation that can occur as a result of TALEN-mediated on-target gene editing of CD52 on chromosome 1 at p36 and TRAC on chromosome 14 at q11.2. When end-to-end ligation occurs between the edited sites, this can result in 2 major and balanced chromosomal translocations termed T1 and T4 (see Figure 5 ). T4 is caused by a translocation of the CD52 gene editing site from chromosome 1 to the break of chromosome 14, retaining the chromosome 1 centromere, and T1 is a reciprocal translocation of the TRAC gene editing site break retaining the chromosome 14 centromere. This balanced reciprocal translocation was detected as a clonal chromosome variant by G-banding karyotyping. The translocation was also detected by FISH as a chromosomal rearrangement of the TCRA / D TRAC locus (14q11.2). Each GMP batch was also tested in the development ddPCR assay. GMP drug product (DP) batches and matched starting material PBMCs were tested with a prequalified development assay. The RPP30 gene primer-probe set capable of detecting endogenous human RPP30 gene sequences was also included in each T4 and T1 t (1; 14) (p36; q11.2) translocation ddPCR test sample as an internal reference to express the translocation frequency relative to the percentage of the RPP30 gene copy number. The LOQ for each assay was determined using CD52 and TRAC TALEN edited control samples and was determined to be 0.20% for T1 and 0.21% for T4 (or 2 out of 1000 copies of RPP30).

[0340] Additionally, each t(1;14)(p36;q11.2) translocation ddPCR assay contains the following test controls to ensure appropriate performance and reliability of reported results:

[0341] Positive control (PC): ALLO-501A development batch cells were collected on day 8 (2 days after electroporation of TALEN mRNA).

[0342] Negative control (NC): ALLO-501A development batch cells harvested on day 6 (before electroporation of TALEN mRNA)

[0343] Non-template control

[0344] The primers and probes for T1 and T4 are shown below.

[0345] T1 forward primer: AGGCCTGGCCGTGAA (SEQ ID NO: 7)

[0346] T1 reverse primer: CCCAGCCAGGGCCTTA (SEQ ID NO: 8)

[0347] T1 probe: ACTTGCCAGCCCCACAGAGCCCC (SEQ ID NO: 9) 5' FAM, 3' ZEN / Iowa Black FQ quencher.

[0348] T4 forward primer: AGCAGTGCAGCCCCA (SEQ ID NO: 10)

[0349] T4 reverse primer: CTCCAGGCCACAGCAC (SEQ ID NO: 11)

[0350] T4 probe: CCAGGCCCGCTGTGTCCCCAGTT (SEQ ID NO: 12) 5' FAM, 3' ZEN / Iowa Black FQ Quencher.

[0351] Genomic DNA was extracted from the cells using a DNA extraction kit as described in Example 1. The results showed that low levels of the expected reciprocal T4 and T1 translocations could be detected in each GMP batch.

[0352] In summary, the expected translocation t(1;14)(p36;q11.2) is a result of on-target gene editing by CD52 and TRAC TALENs. Implementation of ddPCR assays for the T4 and T1 t(1;14)(p36;q11.2) translocations can provide a more sensitive and precise estimate of this event than G-banded karyotyping, and thus provide an alternative assessment of batch-to-batch consistency of the TALEN gene editing process steps. Sensitive development ddPCR assays have been established for T4 and T1 (prequalified LOQs of 0.21% and 0.20%, respectively).

[0353] Example 3 - Methods for detecting additional properties of engineered cells

[0354] An IL-2 independent proliferation assay designed to detect abnormal proliferation of CAR T cells (sensitivity of 1 abnormal cell in 100,000 cells) was used to evaluate test samples, wherein the CAR T cells may be present in the drug product (DP) due to genetic manipulation, cell activation and / or propagation during the manufacturing process. In the absence of target activation and the addition of IL-2, CAR T cells did not proliferate (Table 3A).

[0355] Positive controls are included in the assay to control the cell culture conditions of the test samples and to determine the validity of the test run. In this assay, 2 × 10 6 ALLO-501A test sample cells for at least 18 days (up to 28 days). The number of live cells on day 0, day 18, or day 28 was counted using NC200 NucleoCounter, a small, compact instrument with dual fluorescence channels designed to detect signals from total cells and dead cells stained with acridine orange and diamidino-2-phenylindole (DAPI), respectively. The total number of live cells at different time points was compared with day 0, and the expansion multiple was calculated. If the cell count is within the approved counting assay range of the NC200 NucleoCounter for CAR T cells (i.e., 1×105-2×106 cells / mL), the expansion multiple is reported as a number. When the cell count on day 18 is below the approved cell counting assay range, the expansion multiple is <0.5. The result is reported as “no abnormal proliferation was detected on day 18” and meets the product specification when the proliferation multiple is less than 0.5. The result is reported as "abnormal proliferation was detected on day 18", and if the proliferation fold is equal to or higher than 0.5, it does not meet the product specification. ALLO-501ACAR T cells were also cultured in the presence of CD19-positive target cells (irradiated Daudi cells) and in the presence of IL-2 at a concentration of 20 ng / mL as a test sample positive control. This assay group confirmed that DP was amplified as expected when stimulated by target cells and IL-2. Cell proliferation was monitored for at least 18 days (or up to 28 days). The total number of viable cells at different time points was compared with day 0, and the expansion fold was calculated. The expansion fold of the test sample cultured in the presence of target cells and IL-2 must be >2.0 times as the test sample suitability criterion.

[0356] System suitability for each assay run was assessed by monitoring the proliferation of approved control CAR T cell samples. Specifically, positive control CAR T samples must have a <0.5-fold expansion in the absence of target cells and IL-2, but must have a >2.0-fold expansion in the presence of target cells and IL-2.

[0357] The key reagents used in this method, including fetal bovine serum (FBS), irradiated Daudi cells (target cells), ALLO-501A positive control batch, and IL-2, were used in accordance with the internal procedures for key reagents. The method has been certified as a limit test. During the certification, the 2×10 6The detection limit of 20 abnormal cells (CCRF-CEM cell line, human T lymphoblastoid cell line [ATCC CCL-119], referred to as CEM cells) in 10 test sample cells was demonstrated. The method was demonstrated to meet the repeatability accuracy and intermediate accuracy acceptance criteria for unspiked test samples (multiplication fold <0.5) and test samples spiked with 20 abnormal cells (multiplication fold ≥0.5). Specificity was confirmed from unspiked and spiked test samples with abnormal cells, indicating that proliferation was only observed in the spiked test samples. Based on the demonstration of 20×10 6 Method validation with a detection limit of 20 abnormal cells in 10 test sample cells, CEM spike controls are not routinely included in the run, and the method is confirmed to be suitable for its intended use.

[0358] In the absence of IL-2, the test samples of the ALLO-501AGMP batches (batches 1 and 2) infused into the patient were evaluated for longer (e.g., 28 days) proliferation. As a control, the 18-day group was performed according to a qualified release method. In addition, for each batch, 20 abnormal cells (CEM cells) were included in the 18-day duration group to serve as a positive control, wherein the sensitivity of detection was 1 / 100,000 cells. For 28 days, 5 and 10 CEM cells were added to reach the corresponding sensitivity of 1 / 400,000 cells and 1 / 200,000 cells. All samples (including test samples in the presence of irradiated Daudi target cells (TC) and IL-2 and test samples with CEM cells added) from each group and each ALLO-501A batch within the range of the study were collected on the 18th and 28th days and cells were counted. Compared with the cell count at the 0th day, the proliferation multiple value was calculated based on the cell number at the corresponding end of the operation.

[0359] As shown in Table 3A, in the presence of 20 CEM cells, for both batches and both runs, the test samples showed detectable CEM proliferation on day 18, consistent with the validation of the method, but no abnormal proliferation was detected in the test sample-only group tested, confirming the absence of detectable (less than 1 / 100,000) abnormally growing cells in the test samples from either DP batch.

[0360] For the day 28 analysis, both the 5 and 10 cell CEM spike conditions showed detectable proliferation, confirming the assay sensitivity of 1 / 400,000 and 1 / 200,000, respectively. Importantly, even at this extended culture duration, no abnormal cell growth was detected in batches 1 and 2. In all cases, when stimulated with irradiated Daudi cells and IL-2, the test samples were able to proliferate as expected based on the established mechanism of action.

[0361] The Inversion ddPCR assay was used to test for the presence of chromosome 14 inversions, as it has been shown to be sensitive, specific, and requires smaller amounts of DNA than sequencing (which is impractical for these low cell density and viability samples). DNA isolated from samples from two DP batches at days 18 and 28 was tested in this assay, and importantly, chromosome 14 inversions could not be detected even at an extended culture duration of 28 days (Table 3A).

[0362] Table 3A - Multiplication folds and ddPCR results for chromosome 14 inversion

[0363]

[0364]

[0365] TS = test sample; TC = target cells (irradiated Daudi target cells)

Claims

1. A method for detecting genomic abnormalities in an engineered cell population, the method comprising: a) providing genomic deoxyribonucleic acid (gDNA) molecules from an engineered cell population, wherein the engineered cell population (i) is suspected of comprising a chromosome 14 inversion characterized by a centromeric inversion site at the T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at an immunoglobulin heavy chain (IGH) variable region, and (ii) comprises an edited genomic region; b) subjecting the gDNA molecule to conditions sufficient to produce a nucleic acid extension product, wherein the nucleic acid extension product comprises a sequence corresponding to the chromosome 14 inversion or its complement; as well as c) detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the engineered cell population.

2. The method of claim 1, wherein the centromeric inversion site is present at a first genomic region.

3. The method of claim 1 or 2, wherein the telomeric inversion site is present at a second genomic region.

4. The method of claim 2 or 3, wherein the edited genomic region is present at a third genomic region.

5. The method of claim 4, wherein the third genomic region is different from the first genomic region or the second genomic region.

6. The method of claim 4, wherein the third genomic region is different from the first genomic region and the second genomic region.

7. The method of claim 1, wherein the centromeric inversion site is located at the T cell receptor junction gene TRAJ7.

8. The method of claim 1, wherein the TCR A / D locus is located at 14q11.

2.

9. The method of claim 1, wherein the telomeric inversion site is located at the IGHV3-69-1 pseudogene.

10. The method of claim 1, wherein the IGH variable region is located at 14q32.

11. The method of claim 1, wherein the chromosome 14 inversion is located between TRAJ7 and IGHV3-69-1.

12. The method of claim 1, wherein the chromosome 14 inversion is a 14q11 inversion.

13. The method of claim 1, wherein the chromosome 14 inversion occurs independently of a gene editing process.

14. The method of claim 13, wherein the gene editing process is an in vitro or in vivo gene editing process.

15. The method of claim 1, wherein the chromosome 14 inversion occurs spontaneously.

16. The method of claim 1, further comprising subjecting the gDNA to conditions sufficient to produce a control nucleic acid extension product.

17. The method of claim 16, further comprising detecting the control nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product.

18. The method of claim 1, further comprising providing additional gDNA molecules from an additional engineered cell population, wherein the additional engineered cell population (i) does not include the chromosome 14 inversion, and (ii) includes the edited genomic region.

19. The method of claim 18, further comprising subjecting additional gDNA molecules to conditions sufficient to produce (i) additional nucleic acid extension products and (ii) additional control nucleic acid extension products, wherein the additional nucleic acid extension products include a sequence corresponding to the chromosome 14 inversion or its complement.

20. The method of claim 19, further comprising detecting the additional control nucleic acid extension product and not detecting the additional nucleic acid extension product as an indicator of the absence of the chromosome 14 inversion in the additional engineered cell population.

21. The method of claim 19, further comprising detecting the additional control nucleic acid extension product without detecting the additional nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product.

22. The method of claim 16, wherein the control nucleic acid extension product comprises a sequence corresponding to an endogenous gene sequence.

23. The method according to claim 22, wherein the endogenous gene sequence is a human ribonuclease P protein subunit p30 (RPP30) gene sequence.

24. The method of any one of claims 4 to 6, wherein the first genomic region and / or the second genomic region is separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb.

25. The method of claim 1, further comprising extracting gDNA from the cell population prior to step a).

26. The method of claim 25, further comprising fragmenting the gDNA to provide the gDNA molecules.

27. The method of any one of claims 1 to 26, wherein the engineered cell population is an engineered immune cell population.

28. The method of claim 27, wherein the engineered immune cell population comprises a chimeric antigen receptor (CAR) nucleic acid sequence.

29. The method of claim 28, wherein the CAR nucleic acid sequence expresses a CAR that binds to BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, Claudin-18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34.

30. A method for detecting genomic abnormalities in an engineered cell population, the method comprising: a) providing gDNA molecules from an engineered cell population, wherein the engineered cell population (i) is suspected of comprising a chromosome 14 inversion characterized by a centromeric inversion site at the T cell receptor α / δ locus (TCR A / D) and a telomeric inversion site at the immunoglobulin heavy chain (IGH) variable region, and (ii) comprises an edited genomic region; b) generating a plurality of partitions, wherein the partitions comprise gDNA molecules and primer molecules complementary to the genomic region corresponding to the chromosome 14 inversion; c) generating an amplicon from the gDNA molecule in the partition using the primer molecule, wherein the amplicon includes a sequence corresponding to the chromosome 14 inversion; and d) detecting said amplicons in said partitions.

31. The method of claim 30, wherein the primer molecule comprises a pair of primer molecules.

32. The method of claim 30, further comprising counting the amplicons in the partitions, thereby quantifying the number of chromosome 14 inversions in the genome of the engineered cell population.

33. The method of claim 30, wherein the additional partitions comprise additional gDNA molecules and additional primer molecules, the additional primer molecules being complementary to the genomic region corresponding to the chromosome 14 inversion.

34. The method of claim 33, further comprising subjecting the additional gDNA molecules to conditions sufficient to produce (i) additional amplicons and (ii) control nucleic acid extension products, wherein the additional amplicons include a sequence corresponding to the chromosome 14 inversion or its complement.

35. The method of claim 34, further comprising producing and detecting the additional amplicons in the additional partitions.

36. The method of claim 34, further comprising generating and detecting the control nucleic acid extension product without generating and detecting the additional amplicons in the additional partitions.

37. The method of claim 36, wherein detection of the control nucleic acid extension product without detection of the additional amplicon is an indicator that the conditions are sufficient to produce the control nucleic acid extension product.

38. The method of claim 35, wherein the additional primer molecules comprise an additional pair of primer molecules.

39. The method of claim 32, further comprising counting the number of partitions comprising amplicons, thereby quantifying the number of chromosome 14 inversions.

40. The method of claim 30, wherein a subset of the plurality of partitions comprises no more than one gDNA molecule per partition.

41. The method of claim 30, wherein substantially all of the plurality of partitions comprise no more than one gDNA molecule.

42. The method of claim 30, further comprising extracting gDNA from the engineered cells prior to step a).

43. The method of claim 42, further comprising fragmenting the gDNA to provide the gDNA molecules.

44. The method of claim 30, wherein the centromeric inversion site is present at a first genomic region.

45. The method of claim 30 or 44, wherein the telomeric inversion site is present at a second genomic region.

46. ​​The method of claim 44 or 45, wherein the edited genomic region is present at a third genomic region.

47. The method of claim 46, wherein the third genomic region is different from the first genomic region or the second genomic region.

48. The method of claim 46, wherein the third genomic region is different from the first genomic region and the second genomic region.

49. The method of claim 30, wherein the centromeric inversion site is located at the T cell receptor junction gene TRAJ7.

50. The method of claim 30, wherein the TCR A / D locus is located at 14q11.

2.

51. The method of claim 30, wherein the telomeric inversion site is located at the IGHV3-69-1 pseudogene.

52. The method of claim 30, wherein the IGH variable region is located at 14q32.

53. The method of claim 30, wherein the chromosome 14 inversion is located between TRAJ7 and IGHV3-69-1.

54. The method of claim 30, wherein the chromosome 14 inversion is a 14q11 inversion.

55. The method of claim 30, wherein the chromosome 14 inversion occurs independently of a gene editing process.

56. The method of claim 55, wherein the gene editing process is an in vitro or in vivo gene editing process.

57. The method of claim 30, wherein the chromosome 14 inversion occurs spontaneously.

58. The method of claim 30, wherein the engineered cell population comprises a chimeric antigen receptor (CAR) nucleic acid sequence.

59. The method of claim 58, wherein the CAR nucleic acid sequence expresses a CAR that binds to BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34.

60. An in vitro method for detecting genomic abnormalities in a patient cell population, the method comprising: a) providing genomic deoxyribonucleic acid (gDNA) molecules from a patient cell population, wherein the patient cell population includes immune cells that (i) are suspected of including a chromosome 14 inversion characterized by a centromeric inversion site at the T cell receptor alpha / delta locus (TCR A / D) and a telomeric inversion site at an immunoglobulin heavy chain (IGH) variable region, and (ii) include an edited genomic region; b) subjecting the gDNA molecule to conditions sufficient to produce a nucleic acid extension product, wherein the nucleic acid extension product comprises a sequence corresponding to the chromosome 14 inversion or its complement; as well as c) detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the immune cell.

61. The method of claim 60, wherein the patient cell population is derived from a patient treated with an engineered immune cell population.

62. The method of claim 61, wherein the chromosome 14 inversion is present in the engineered immune cell population.

63. The method of claim 61, wherein the chromosome 14 inversion is not present in the engineered immune cell population.

64. The method of claim 63, wherein the chromosome 14 inversion occurs in the immune cells following treatment with the engineered immune cell population.

65. The method of claim 60, wherein the centromeric inversion site is present at a first genomic region.

66. The method of claim 60 or 65, wherein the telomeric inversion site is present at a second genomic region.

67. The method of claim 65 or 66, wherein the edited genomic region is present at a third genomic region.

68. The method of claim 67, wherein the third genomic region is different from the first genomic region or the second genomic region.

69. The method of claim 67, wherein the third genomic region is different from the first genomic region and the second genomic region.

70. The method of claim 60, wherein the centromeric inversion site is located at the T cell receptor junction gene TRAJ7.

71. The method of claim 60, wherein the TCR A / D locus is located at 14q11.

2.

72. The method of claim 60, wherein the telomeric inversion site is located at the IGHV3-69-1 pseudogene.

73. The method of claim 60, wherein the IGH variable region is located at 14q32.

74. The method of claim 60, wherein the chromosome 14 inversion is located between TRAJ7 and IGHV3-69-1.

75. The method of claim 60, wherein the chromosome 14 inversion is a 14q11 inversion.

76. The method of claim 60, wherein the chromosome 14 inversion occurs independent of a gene editing process.

77. The method of claim 76, wherein the gene editing process is an in vitro or in vivo gene editing process.

78. The method of claim 60, wherein the chromosome 14 inversion occurs spontaneously.

79. The method of any one of claims 65 to 67, wherein the first genomic region and / or the second genomic region is separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, or about 15 kb.

80. A drug product release assay for an allogeneic immune cell drug product, wherein the release assay comprises: a) providing an allogeneic immune cell pharmaceutical product comprising an engineered immune cell comprising an edited genomic region; b) extracting gDNA molecules from the engineered immune cells; c) subjecting the gDNA molecule to conditions sufficient to produce a nucleic acid extension product comprising a sequence corresponding to a chromosome 14 inversion characterized by a centromeric inversion site at the T cell receptor alpha / delta locus (TCR A / D) and a telomeric inversion site at an immunoglobulin heavy chain (IGH) variable region, or its complement; as well as d) detecting the nucleic acid extension product as an indicator of the presence of the chromosome 14 inversion in the engineered immune cell.

81. The release assay of claim 80, wherein the centromeric inversion site is present at a first genomic region.

82. A release assay according to claim 80 or 81, wherein the telomeric inversion site is present at a second genomic region.

83. A release assay according to claim 81 or 82, wherein the edited genomic region is present at a third genomic region.

84. The release assay of claim 83, wherein the third genomic region is different from the first genomic region or the second genomic region.

85. The release assay of claim 83, wherein the third genomic region is different from the first genomic region and the second genomic region.

86. The release assay of claim 80, wherein the centromeric inversion site is located at the T cell receptor engaging gene TRAJ7.

87. The release assay of claim 80, wherein the TCR A / D locus is located at 14q11.

2.

88. The release assay of claim 80, wherein the telomeric inversion site is located at the IGHV3-69-1 pseudogene.

89. The release assay of claim 80, wherein the IGH variable region is located at 14q32.

90. The release assay of claim 80, wherein the chromosome 14 inversion is located between TRAJ7 and IGHV3-69-1.

91. The release assay of claim 80, wherein the chromosome 14 inversion is a 14q11 inversion.

92. The release assay of claim 80, wherein the chromosome 14 inversion occurs independent of a gene editing process.

93. The release assay of claim 92, wherein the gene editing process is an in vitro or in vivo gene editing process.

94. The release assay of claim 80, wherein the chromosome 14 inversion occurs spontaneously.

95. The release assay of claim 80, further comprising subjecting the gDNA to conditions sufficient to produce a control nucleic acid extension product.

96. The release assay of claim 95, further comprising detecting the control nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product.

97. The release assay of claim 80, further comprising extracting additional gDNA molecules from additional engineered immune cells, wherein the additional engineered immune cells (i) do not comprise the chromosome 14 inversion, and (ii) comprise the edited genomic region.

98. The release assay of claim 97, further comprising subjecting additional gDNA molecules to conditions sufficient to produce (i) additional nucleic acid extension products and (ii) additional control nucleic acid extension products, wherein the additional nucleic acid extension products include a sequence corresponding to the chromosome 14 inversion or its complement.

99. The release assay of claim 98, further comprising detecting the additional control nucleic acid extension product without detecting the additional nucleic acid extension product as an indicator of the absence of the chromosome 14 inversion in the additional engineered immune cell.

100. The release assay of claim 99, further comprising detecting the additional control nucleic acid extension product without detecting the additional nucleic acid extension product as an indicator that the conditions are sufficient to produce the control nucleic acid extension product.

101. A release assay according to any one of claims 83 to 85, wherein the first genomic region and / or the second genomic region is separated from the third genomic region by at least about 5 kilobases (kb), about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb or about 15 kb.

102. The release assay of claim 80, wherein the extracting step comprises fragmenting the gDNA to provide the gDNA molecules.

103. The release assay of claim 80, wherein the engineered immune cells comprise a chimeric antigen receptor (CAR) nucleic acid sequence.

104. A release assay according to claim 103, wherein the CAR nucleic acid sequence expresses a CAR that binds to BCMA, EGFRvIII, WT-1, CD20, CD23, CD30, CD38, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKGD2D, CS1, CD44v6, ROR1, tight junction protein -18.2, Muc17, FAPα, Ly6G6D, c6orf23, G6D, MEGT1, NG25, CD19, FLT3, CD70, DLL3, CD52 or CD34.

Images