Zmfs2 gene and its application in corn disease control

Abstract

The application discloses a ZmFS2 gene and application thereof in corn disease prevention and belongs to the technical field of crop disease prevention and control.The nucleotide sequence of the cDNA of the ZmFS2 gene provided in the application is shown as SEQ ID No.1, and the expression of the gene can be inhibited to significantly enhance the resistance of corn to various diseases, including small spot disease, large spot disease, southern rust, anthracnose, stem rot and seed rot, and the like, and the application provides a new gene, a new material and a new method for corn disease-resistant breeding, and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of crop disease prevention and treatment, and particularly relates to a ZmFS2 gene and application thereof in corn disease prevention and treatment. BACKGROUND

[0002] The information disclosed in the background of the present application is only intended to increase the understanding of the overall background of the present application and should not necessarily be regarded as acknowledging or implicitly suggesting that this information constitutes prior art known to those of ordinary skill in the art.

[0003] In recent years, with the continuous change of the environment, the area of corn infected by pathogenic bacteria gradually increases, which not only affects the yield and quality of corn, but also accumulates harmful toxins, which is harmful to the safety of consumers. Common diseases in corn include small spot disease, large spot disease, southern rust and stem rot disease. Due to the complexity of growth conditions, corn is usually infected by multiple pathogenic bacteria during growth. In order to obtain better corn germplasm, screening and breeding need to be continuously carried out. Through molecular breeding to improve the resistance of corn, the use of pesticides is reduced and the environment is protected, which has a positive effect. It is necessary to provide an application for improving the disease resistance of corn by reducing the expression of corn disease susceptible genes.

[0004] Secondary metabolites exist widely in plants. The biological activities of secondary metabolites flavonoids include antibacterial, antiviral and antioxidant, and have an impact on plant growth and are involved in plant disease resistance. Flavonoids can be divided into flavanones, flavanols, flavonols, anthocyanins, isoflavones and flavones. Studies have shown that flavone synthase I belongs to 2-ketoglutarate-dependent dioxygenase and can directly catalyze the generation of double bonds between carbon 2 and carbon 3 of flavanone compounds, which is a key enzyme for the synthesis of plant flavonoids. Flavone synthase I can catalyze flavanones (such as naringenin and eriodictyol) to generate flavones (such as apigenin and luteolin). Corn is rich in flavonoids, but the function of corn flavone synthase ZmFS2 in corn disease resistance has not been reported. Therefore, it is of great significance to mine and identify the function of ZmFS2 and study its role in corn broad-spectrum disease resistance for corn disease resistance breeding. SUMMARY

[0005] Therefore, the present application provides a ZmFS2 gene and application thereof in corn disease prevention and treatment. The application reduces the expression of the ZmFS2 gene to improve the broad-spectrum disease resistance of corn, which is of great significance in corn disease resistance breeding.

[0006] In a first aspect, the present application provides a ZmFS2 gene, and the nucleotide sequence of the cDNA of the ZmFS2 gene is shown in SEQ ID No. 1.

[0007] In a second aspect, the present application provides application of the ZmFS2 gene in corn disease prevention and treatment, wherein the corn diseases include small spot disease, large spot disease, southern rust disease, anthracnose disease, stalk rot disease and seed rot disease.

[0008] Preferably, the application is to inhibit the expression of the ZmFS2 gene in corn, thereby improving the disease resistance of crops to corn diseases.

[0009] Further, the method for inhibiting the expression of the ZmFS2 gene in corn includes one or more of transposon insertion, gene editing, gene silencing or ethyl methanesulfonate (EMS) mutagenesis.

[0010] Further, the site of the transposon insertion is located at the 3'UTR region of SEQ ID No. 1 at positions 68 and 424, respectively.

[0011] Or,

[0012] The gene editing uses a CRISPR / CAS9 constructed editing vector, wherein the target sequence of the cloning region of the editing vector is gRNA1 and gRNA2, the nucleotide sequence of the gRNA1 is shown in SEQ ID No. 10, corresponding to the nucleotides at positions 333-352 in SEQ ID No. 1; the nucleotide sequence of the gRNA2 is shown in SEQ ID No. 11, corresponding to the nucleotides at positions 642-661 in SEQ ID No. 1.

[0013] In a third aspect, the present application provides application of biological materials related to the ZmFS2 gene in corn disease prevention and treatment, wherein the corn diseases include small spot disease, large spot disease, southern rust disease, anthracnose disease, stalk rot disease and seed rot disease.

[0014] Preferably, the biological material is any one of the following (1) to (4):

[0015] (1) a protein encoded by the ZmFS2 gene, wherein the amino acid sequence of the protein is shown in SEQ ID No. 2;

[0016] (2) a recombinant vector containing the ZmFS2 gene;

[0017] (3) a recombinant microorganism containing the ZmFS2 gene;

[0018] (4) a transgenic plant cell line containing the ZmFS2 gene.

[0019] Further, the vector is a plasmid, cosmid, bacteriophage or viral vector; and the microorganism can be yeast, bacteria, algae or fungi.

[0020] In a fourth aspect, the present application provides a method for preventing and treating corn diseases by inhibiting the expression amount of the ZmFS2 gene in corn, wherein the corn diseases include small spot disease, large spot disease, southern rust disease, anthracnose disease, stalk rot disease and seed rot disease.

[0021] In a fifth aspect, the present application provides a corn breeding method, comprising the following steps: inhibiting the expression amount of the ZmFS2 gene in corn, so that the corn is resistant to small spot disease, large spot disease, southern rust disease, anthracnose disease, stalk rot disease and seed rot disease.

[0022] Compared with the prior art, the present application has the following beneficial effects:

[0023] The present application finds, through gene function test and verification, that the ZmFS2 transgenic overexpression positive strain shows a disease-sensitive phenotype to multiple corn diseases such as small spot disease, large spot disease and stalk rot disease; the disease resistance identification of two transposon insertion ZmFS2 mutant strains ZmFS2-1 and ZmFS2-2 finds that the two mutants show broad-spectrum disease resistance to multiple corn fungal diseases such as small spot disease, large spot disease, southern rust disease and stalk rot disease; the ZmFS2 gene edited mutant strain is inoculated with anthracnose bacteria in vitro, and it is found that it is more resistant to anthracnose. It can be seen that the ZmFS2 gene provided by the present application is a broad-spectrum disease resistance gene, which can significantly enhance the resistance of corn to multiple diseases, and the present application provides a new gene, new material and new method for corn disease resistance breeding, which has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0024] The drawings accompanying the specification of the present application serve to provide a further understanding of the present application, and the illustrative embodiments of the present application and their descriptions serve to explain the present application, and do not constitute an improper limitation on the present application. Obviously, for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0025] Figure 1 It is a CDS sequence electrophoretogram of the PCR cloned corn type I flavone synthase gene ZmFS2 in the embodiment 1 of the present application;

[0026] Figure 2 It is a Western blot identification diagram of the transgenic overexpression positive strain in the embodiment 2 of the present application; wherein, the ZmFS2 transgenic material is identified by Western Blot using a GFP antibody, and the numbers of two transgenic strain positive (pos) and corresponding negative (neg) plants are above the lanes; 1, 2, 3, 4, 5 and 6 are from different six plants;

[0027] Figure 3Identification of the resistance of ZmFS2 transgenic overexpression lines to anthracnose and leaf spot in the seedling stage in Example 2 of the present application; wherein A is the phenotype of ZmFS2 positive overexpression lines and their corresponding negative lines after inoculation with Colletotrichum graminicola; B is the lesion area after inoculation measured by Image J; C is the resistance phenotype of ZmFS2 positive overexpression lines and their corresponding negative lines to leaf spot; D is the lesion area after inoculation with leaf spot fungus measured by Image J (*p<0.05, **p<0.01, Student's t-test);

[0028] Figure 4 Identification of the resistance of ZmFS2 transgenic overexpression lines to leaf spot and large spot in the adult stage in the field in Example 2 of the present application; wherein A is the resistance phenotype of ZmFS2 positive overexpression lines and their corresponding negative lines to leaf spot; B is the lesion grade of ZmFS2 positive overexpression lines and their corresponding wild type after infection with leaf spot; C is the resistance phenotype of ZmFS2 positive overexpression lines and their corresponding negative lines to large spot; D is the lesion grade of ZmFS2 positive overexpression lines and their corresponding negative lines after infection with large spot (*p<0.05, ***p<0.001, Student's t-test);

[0029] Figure 5 Identification of the resistance of ZmFS2 transgenic overexpression lines to stem rot and seed rot in Example 2 of the present application; wherein A is the resistance phenotype of ZmFS2 positive overexpression lines and their corresponding negative lines to stem rot; B is the lesion grade of ZmFS2 positive overexpression lines and their corresponding negative lines after inoculation with Fusarium verticillioides; C is the resistance phenotype of ZmFS2 positive overexpression lines and their corresponding negative lines to seed rot; D is the spore concentration of ZmFS2 positive overexpression lines and their corresponding negative lines after inoculation with Fusarium verticillioides (*p<0.05, **p<0.01, ***p<0.001, Student's t-test);

[0030] Figure 6 Identification of ZmFS2 mutant lines in Example 3 of the present application; wherein A is a schematic diagram of the structure of ZmFS2 gene and the position of UFMu transposon insertion site; B is the PCR identification result of ZmFS2 mutant; C is the transcription level of ZmFS2 in ZmFS2 mutant detected by qRT-PCR (*P<0.05, **p<0.01, Student's t-test);

[0031] Figure 7ZmFS2 mutant and its wild type against small spot disease in the field; B is the lesion grade of ZmFS2 mutant and its wild type after being infected with small spot disease; C is the field phenotype of ZmFS2 mutant and its wild type against large spot disease; D is the lesion grade of ZmFS2 mutant and its wild type after being infected with large spot disease (**p<0.01; ***p<0.001, Student's t-test);

[0032] Figure 8 ZmFS2 mutant and its wild type against small spot disease in the field; B is the lesion grade of ZmFS2 mutant and its wild type after being infected with small spot disease; C is the field phenotype of ZmFS2 mutant and its wild type against large spot disease; D is the lesion grade of ZmFS2 mutant and its wild type after being infected with large spot disease (**p<0.01; ***p<0.001, Student's t-test);

[0033] Figure 9 ZmFS2 mutant and its wild type against small spot disease in the field; B is the lesion grade of ZmFS2 mutant and its wild type after being infected with small spot disease; C is the field phenotype of ZmFS2 mutant and its wild type against large spot disease; D is the lesion grade of ZmFS2 mutant and its wild type after being infected with large spot disease (**p<0.01; ***p<0.001, Student's t-test);

[0034] Figure 10 ZmFS2 mutant and its wild type against small spot disease in the field; B is the lesion grade of ZmFS2 mutant and its wild type after being infected with small spot disease; C is the field phenotype of ZmFS2 mutant and its wild type against large spot disease; D is the lesion grade of ZmFS2 mutant and its wild type after being infected with large spot disease (**p<0.01; ***p<0.001, Student's t-test);

[0035] Figure 11 ZmFS2 mutant and its wild type against small spot disease in the field; B is the lesion grade of ZmFS2 mutant and its wild type after being infected with small spot disease; C is the field phenotype of ZmFS2 mutant and its wild type against large spot disease; D is the lesion grade of ZmFS2 mutant and its wild type after being infected with large spot disease (**p<0.01; ***p<0.001, Student's t-test); DETAILED DESCRIPTION

[0036] In the following examples, the techniques and procedures used are those well known in the art. Unless specific details are given, procedures are carried out according to standard protocols

[0037] Sambrook and Russell, 2001). Other conventional techniques and reagents can be used by those skilled in the art following the examples of the present application without being limited to the specific examples of the present application. The examples of the present application are only the preferred embodiments of the present application. The following description is only to explain the present application, and is not to limit the present application in any form. Any simple modification of the specific embodiments according to the technical essence of the present application is within the scope of the technical solution of the present application. The materials, reagents and the like used in the examples are commercially available unless otherwise specified.

[0038] The technical solution of the present application is further described below in combination with specific examples.

[0039] Example 1 Cloning of ZmFS2

[0040] 1. Extraction of total RNA from maize inbred line B73

[0041] (1) The maize B73 leaves were quickly frozen in liquid nitrogen and ground into powder in a mortar sterilized by high temperature, and then transferred into a centrifuge tube. 500 μl of RNA-easy extraction solution was immediately added.

[0042] (2) 500 μl of RNase-free ddH2O was added, and mixed well by inverting up and down. It was left to stand at room temperature for 5 min.

[0043] (3) 12,000 g centrifugation for 15 min, and the supernatant was transferred to a new centrifuge tube. An equal volume of isopropanol was added, and mixed well. It was left to stand at room temperature for 10 min.

[0044] (4) 12,000 g centrifugation for 10 min, and the supernatant was discarded. The precipitate was washed with 500 μl of 75% ethanol, and the tube was tapped to allow the precipitate to fully contact with the liquid. 8,000 g centrifugation for 3 min. The supernatant was discarded, and the above steps were repeated for the second time.

[0045] (5) It was dried in a clean bench for about 3 min, and then dissolved with RNase-Free water.

[0046] (6) The OD value and concentration of the RNA sample were measured by ultramicro spectrophotometer. The A 260 / A 280 was preferably 1.8-2.0. The quality of the RNA was detected by agarose gel electrophoresis.

[0047] 2. Reverse transcription of RNA into cDNA

[0048] (1) Add the reagents in Table 1 into a centrifuge tube in turn (20 μl reaction system):

[0049] Table 1 Reaction reagents and addition amount

[0050]

[0051] (2) After mixing, 42℃, 2min;

[0052] (3) Add 4 μl 5x HiScript III qRT SuperMix into the centrifuge tube;

[0053] (4) After mixing, 25℃ 5min, 50℃ 15min, 85℃ 5min, then store at -20℃ for standby.

[0054] 3. ZmFS2 gene cloning

[0055] The primer sequence used is:

[0056] ZmFS2-F1: 5'-TAGAGCGGCGGCGGCGGGC-3' (SEQ ID NO. 3);

[0057] ZmFS2-R1: 5'-GAGAAGCATCCAAAATACTC-3' (SEQ ID NO. 4).

[0058] The reaction system for amplification using high-fidelity enzyme KOD is shown in Table 2 (20 μl system).

[0059] Table 2 Reaction system

[0060]

[0061] The amplification conditions are as follows:

[0062] (1) 5℃, 2min;

[0063] (2) 98℃, 10s;

[0064] (3) 60℃, 30s;

[0065] (4) 68℃, 45s;

[0066] (5) Cycle steps (2)-(4) 34 times;

[0067] (6) 68℃, 7min;

[0068] (7) 15℃, save.

[0069] After the end, electrophoresis detection is performed, such as Figure 1The length of the amplified ZmFS2 gene CDS sequence is 1110 bp. The cloned fragment was recovered by gel.

[0070] 4. Ligation of the target gene and the entry vector

[0071] The reaction system is shown as follows:

[0072] DNA recovery fragment: 7 μl;

[0073] Entry vector pENTR-T: 1 μl;

[0074] T4 Ligase: 1 μl;

[0075] T4 Buffer: 1 μl.

[0076] 16°C, overnight ligation.

[0077] 5. Transformation of E. coli competent cells with plasmid or DNA ligation product

[0078] (1) 10 ul of the ligation product was added to 50 μl of competent cells DH5a, mixed, and then placed on ice for 30 min;

[0079] (2) 42°C, heat shock for 1 min, 2 min on ice, add 800 μl of LB medium, 37°C, 220 rpm shaking for 1 h;

[0080] (3) Room temperature, 5000 rpm, centrifugation for 2 min, discard the supernatant, leave a small amount of supernatant to suspend the bacteria, and then plate on LB plates containing the corresponding antibiotic, 37°C, inverted culture overnight;

[0081] (4) Single colonies were picked for colony PCR identification, and positive clones were selected for sequencing. The clones with correct sequencing results were named ZmFS2. The nucleotide sequence of the cDNA of the gene is shown as SEQ ID No. 1, and the encoded amino acid sequence is shown as SEQ ID No. 2.

[0082] Example 2, construction of ZmFS2 overexpression vector and verification of disease resistance function of transgenic lines

[0083] 1. Construction of maize ZmFS2 overexpression vector

[0084] (1) Add BamH1 and Xma1 restriction sites at both ends of the gene ZmFS2, and perform double digestion of the maize overexpression vector pCAMBIA3301 and the ZmFS2 fragment;

[0085] (2) After gel recovery, ligation was performed by T4 DNA ligase;

[0086] (4) Transform the E. coli competent DH5a, and send the positive clones identified by colony PCR to the company for sequencing. The plasmid vector with correct sequencing is named pCAMBIA3301::ZmFS2.

[0087] 2. Transformation of Agrobacterium with plasmid

[0088] (1) Add 1 pg of pCAMBIA3301::ZmFS2 plasmid vector to 50 pl of Agrobacterium competent EHA105, mix well, and ice bath for 30 min;

[0089] (2) Freeze in liquid nitrogen for 1 min; 37°C for 3 min, add 800 pl of LB liquid medium, 28°C, 220 rpm shaking for 3 h;

[0090] (3) Room temperature, 5,000 rpm, centrifuge for 2 min, discard the supernatant;

[0091] (4) Leave a small amount of supernatant to suspend the bacteria, then plate on LB culture plates containing the corresponding antibiotics, 28°C, inverted culture for 48 h, pick single colonies for colony PCR identification, and positive clones are stored in a -80°C refrigerator.

[0092] 3. Genetic transformation of maize

[0093] Send Agrobacterium EHA105 containing pCAMBIA3301::ZmFS2 plasmid vector to the biological company to transform maize inbred line B104, and obtain transgenic lines.

[0094] 4. Western blot detection of ZmFS2 transgenic maize plants

[0095] (1) Preparation of SDS-PAGE concentrated gel and separation gel:

[0096] First, prepare 10% separation gel. After preparing the separation gel, add water to seal the layer until a clear boundary line is formed, then the separation gel solidifies, and the upper liquid is removed. Prepare 5% concentrated gel. After preparing the concentrated gel, insert the comb and stand for 0.5 h until the concentrated gel solidifies. The formula of 10% separation gel is shown in Table 3.

[0097] Table 3 Formula of 10% separation gel

[0098]

[0099] The formula of 5% concentrated gel is shown in Table 4.

[0100] Table 4 Formula of 5% concentrated gel

[0101]

[0102] (2) Preparation of samples:

[0103] Take 200 mg of leaf material into a 2 ml centrifuge tube, add ceramic beads, freeze in liquid nitrogen, and then use a sampler (40 Hz, 30 s) to sample into powder. Add 200 μl of protein extraction buffer, mix thoroughly, and then incubate on ice for 30 min.

[0104] The protein extraction buffer formulation is shown in Table 5.

[0105] Table 5 Protein Extraction Buffer Formulation

[0106]

[0107]

[0108] (3) Centrifuge at 4℃ and 12000rpm for 15min, take 15μl of supernatant and mix with 15μl of 2×laemmlli (containing 5% mercaptoethanol) to prepare for sample loading.

[0109] (4) Place the SDS-PAGE gel into the electrophoresis tank, pour in 1×Running buffer, vertically remove the comb, take 15μl of sample and spot it, 80V, 20min, 150V, 1h.

[0110] The formulation of the 10×Running buffer is shown in Table 6.

[0111] Table 6 10×Running buffer formulation

[0112]

[0113] (5) Transfer membrane

[0114] a. After the gel electrophoresis is completed, remove the top layer of stacking gel, place the separating gel in a glass dish containing ddH2O for cleaning, and place the cut NC membrane (5.8×8.5cm) and filter paper (8×10cm) in 1× transfer buffer for cleaning and use.

[0115] b. With the black side of the transfer clamp facing down, place the sponge, filter paper, separating gel, NC membrane, filter paper, and sponge in sequence. After each placement, remove any excess air bubbles. Once fixed, place the membrane in the transfer tank with ice packs and add pre-cooled 1× transfer buffer.

[0116] c. Place the electrophoresis tank in an ice-water mixture for membrane transfer, 45V, 2.5h, with the current maintained at 160-200mA.

[0117] The formulation of 10× transfer buffer is shown in Table 7.

[0118] Table 7 10× Transfer Buffer Formulation

[0119]

[0120] (6) Blocking

[0121] After the end of the transfer, put into the blocking solution (4% skim milk powder) for 1.5h.

[0122] (7) Primary antibody

[0123] Remove the blocking solution, transfer the NC membrane to the primary antibody solution (1:5000), and incubate for 2h at room temperature on a horizontal shaker.

[0124] (8) Secondary antibody

[0125] Pour out the primary antibody, wash the membrane with 1xPBST for 3 times, 10min / time, add the secondary antibody (1:4000), and incubate for 1.5h at room temperature on a horizontal shaker.

[0126] (9) Pour out the secondary antibody, wash the membrane with 1xPBST for 2 times, and 1xPBS for 1 time, 10min / time.

[0127] (10) Use the ECL kit, mix the color developing solution A and B equally, take an appropriate amount of the mixed solution and evenly spread it on the front side of the NC membrane, and finally use the chemiluminescence instrument for development. The results of Western blot identification of ZmFS2 transgenic overexpression plants are shown in Figure 2 .

[0128] 5. Identification of in vitro inoculation of maize leaf with small spot and anthracnose

[0129] (1) Grow the maize small spot and anthracnose causing Helminthosporium turcicum and Colletotrichum graminicola on V8 medium, and cultivate in a 28℃ incubator in the dark;

[0130] (2) Preparation of spore elution solution: agar powder 0.5g / L, Tween-20 0.5ml / L, ddH2O to 1L, and autoclave;

[0131] (3) Add an appropriate amount of spore elution solution to the plate, scrape the plate, filter with filter paper, count under a microscope using a cell counting plate, and dilute the bacterial solution to 1x10 6 / ml;

[0132] (4) Place two layers of filter paper in a black tray, paste the corn leaves on the filter paper, punch holes on the leaves, add an appropriate amount of sterile water in the tray, and drop 10μl of bacterial solution on the holes;

[0133] (5) Seal the tray with plastic wrap to keep it moist and avoid light for two days. Take photos to observe the lesion phenotype and use Image J for statistics. It was found that ZmFS2 overexpression lines (Y12-21 pos, Y12-25 pos) were more susceptible to anthracnose than their corresponding negative lines (Y12-21 neg, Y12-25 neg), and the identification results are shown as A and B in FIG. 6. Figure 3 Figure 3

[0134] 6. Disease resistance identification of field Cercospora leaf spot and large spot

[0135] In mid-May, corn materials were planted in Qingdao, and the phenotype of Cercospora leaf spot after flowering was counted in the field. According to the severity of the disease, a grading identification was made, with a total of 9 grades (1-9), and the larger the disease area, the lower the grade. ZmFS2 overexpression lines were more susceptible to field Cercospora leaf spot than their corresponding negative lines, and the identification results are shown as A and B in FIG. 5. Figure 4

[0136] In late April, corn was planted in Changchun, Jilin, and the phenotype of large spot after flowering was counted in the field. According to the severity of the disease, a grading identification was made, with a total of 9 grades (1-9), and the larger the disease area, the higher the grade. ZmFS2 overexpression lines were more susceptible to field large spot than their corresponding negative lines, and the identification results are shown as C and D in FIG. 4. Figure 4

[0137] 7. Disease resistance identification of corn stalk rot and seed rot

[0138] (1) The Fusarium verticillioides was cultured in PDA medium, and the mycelium was grown in the middle of PDA, and cultured in a 28°C incubator in the dark;

[0139] (2) The Fusarium verticillioides was picked up in mung bean medium, cultured at 28°C on a shaker for 2 days, filtered with four layers of gauze, centrifuged at 1000g for 5 min, discarded the supernatant, added appropriate amount of sterilized ddH2O, completely dissolved the bacterial mass, counted with a hemocytometer, and diluted to 1×10 6 cells / ml;

[0140] ​​​​(3) Stalk rot: 500 μl spore suspension was injected into the third internode of the maize plant using a 1 ml syringe. The inoculation site was covered with plastic wrap. Two weeks later, the third internode was cut in half and the lesion size was scored. There were five grades (1-5) and the larger the lesion size, the higher the grade. ZmFS2 overexpression lines (Y12-21 pos, Y12-25 pos) were more susceptible to stalk rot than their corresponding negative lines (Y12-21 neg, Y12-25 neg). The results are shown in Table 3 as A and B. Figure 5

[0141] (4) Seed rot: The seeds were washed with 70% ethanol for 5 min, sterile water for 1 min, 2.5% sodium hypochlorite for 10 min, and finally sterile water for 5 min three times. The seeds were dried and a knife blade was used to make a wound on the embryo side. Four seeds were placed in a 20 ml bottle and 200 μl spore suspension was inoculated. The bottle was vortexed to evenly coat the seeds with the spore suspension. The bottle was placed in a plastic container to create a humidity chamber. The seeds were incubated at 28°C for 3-7 days. ZmFS2 overexpression lines (Y12-25 pos) were more susceptible to seed rot than their corresponding negative lines (Y12-25 neg). The results are shown in Table 4 as C and D. Figure 5

[0142] Example 3 Identification and disease resistance verification of ZmFS2 mutants

[0143] 1. CTAB method for extracting maize DNA

[0144] The ZmFS2 gene mutants 37429 (ZmFS2-1) and 43908 (ZmFS2-2) were screened from the UniformMu maize mutant library and purchased. The seeds of ZmFS2-1 and ZmFS2-2 mutants were sown in the field.

[0145] The link of the UniformMu maize mutant library is as follows:

[0146] http: / / www.maizegdb.org / documentation / uniformmu / index.php.

[0147] (1) The maize leaves were placed in a 96-well DNA extraction plate and frozen in liquid nitrogen, then ground into powder. 250 μl CTAB extraction solution was added and mixed well. The mixture was incubated at 65°C for 30 min, and mixed every 10 min.

[0148] (2) An equal amount of chloroform was added and the mixture was allowed to separate at room temperature for several minutes. The mixture was centrifuged at 4000 rpm for 30 min. 100 μl of supernatant was transferred to a 96-well plate, and an equal amount of isopropanol was added. The mixture was mixed well and incubated at -20°C overnight. ​​

[0149] (3)4000rpm centrifuge 30min, discard supernatant, 100μl 75% ethanol, centrifuge 15min, repeat this step once.

[0150] (4)Discard supernatant, blow dry the precipitate, add appropriate amount of ddH2O to dissolve, store at 4℃ for standby use.

[0151] The CTAB extraction solution formula is shown in Table 8.

[0152] Table 8 CTAB extraction solution formula

[0153]

[0154]

[0155] 2. Identification of ZmFS2 mutants

[0156] The ZmFS2 transposon insertion sites are located at the 68th position (Zmfs2-1) and the 424th position (Zmfs2-2) of the 3'UTR region of the ZmFS2 sequence. According to the insertion site of ZmFS2-1 and ZmFS2-2 mutants, primers are designed for identification. The positions of the identification primers in the ZmFS2 gene are shown in A of Figure 6

[0157] F1: AGTAGGATTTCGCTCCCTT (SEQ ID NO. 5);

[0158] R1: CATTATTCCCACCCTCTCA (SEQ ID NO. 6);

[0159] F2: AGCACGGTAATACAAGAAGTGTT (SEQ ID NO. 7);

[0160] R2: ACATCAAGGAGGCGCTGGG (SEQ ID NO. 8);

[0161] TIR8: CGCCTCCATTTCGTCGAATCCCCTS (SEQ ID NO. 9);

[0162] The reaction conditions are shown in Table 9.

[0163] Table 9 Reaction conditions

[0164]

[0165] The amplification conditions are as follows:

[0166] (1) 95℃, 2min;

[0167] (2) 98℃, 10s;​

[0168] (3) 58°C, 30 s;

[0169] (4) 68°C, 1 min;

[0170] (5) Step (2)-(4), cycle 30 times;

[0171] (6) 68°C, 5 min;

[0172] (7) 15°C, storage.

[0173] After PCR stop, agarose gel electrophoresis detection and identification were performed. No band was observed for FR, and bands were observed for F+TIR8 and R+TIR8, which were homozygous. Bands were observed for FR, and no band was observed for F+TIR8 and R+TIR8, which were wild type. The identification results are shown in B of Figure 6 .

[0174] After ZmFS2-1 and ZmFS2-2 and their corresponding wild types were identified, the transcription level of ZmFS2 in the ZmFS2-1 and ZmFS2-2 mutants was determined by quantitative PCR. The content of ZmFS2 in the ZmFS2-1 and ZmFS2-2 mutants was reduced, and the results are shown in C of Figure 6 .

[0175] 3. Disease resistance identification of field small spot and large spot

[0176] In mid-May, corn materials were planted in Qingdao, and the phenotype of small spot after flowering was counted in the field. Grading identification was performed according to the severity of the disease, and there were 9 grades (1-9). The larger the disease area, the lower the grade. The ZmFS2 mutant strain (homo) was more resistant to field small spot than the corresponding wild type (WT), and the identification results are shown in A and B of Figure 7 .

[0177] In late April, corn was planted in Changchun, Jilin, and the phenotype of large spot after flowering was counted in the field. Grading identification was performed according to the severity of the disease, and there were 9 grades (1-9). The larger the disease area, the higher the grade. The ZmFS2 mutant strain was more resistant to field large spot than the corresponding wild type, and the identification results are shown in C and D of Figure 8 .

[0178] 4. Disease resistance identification of corn stalk rot and seed rot

[0179] (1) The mycelial of Fusarium verticillioides was cultured in PDA medium, and the mycelium grew in the middle of PDA, and was cultured in a 28°C incubator in the dark;

[0180] (2) In the mung bean medium, the Fusarium verticillioides colony was picked and cultured at 28°C on a shaker for 2 days. The bacterial solution was filtered with four layers of gauze, centrifuged at 1000g for 5 min, and the supernatant was discarded. An appropriate amount of sterilized ddH2O was added to completely dissolve the colony, and the bacterial solution was counted with a hemocytometer and diluted to 1x10 6 copies / ml;

[0181] (3) Stalk rot: 500ul of bacterial solution was taken with a 1ml syringe and injected into the third internode of the corn. The inoculation site was sealed, and after two weeks, the third node was cut in half to count the lesion grade. There were five grades (1-5), and the larger the lesion area, the higher the grade. The ZmFS2 mutant strain was more resistant to stalk rot than the corresponding wild type strain, and the identification results are shown as A and B in Figure 8 .

[0182] (4) Seed rot: The seeds were washed with 70% ethanol for 5 min, washed with sterile water for 1 min, washed with 2.5% sodium hypochlorite for 10 min, and finally washed with sterile water for 5 min*3 times. The seeds were dried and the blade was cut into a wound on the embryo side. Four seeds were placed in a 20ml bottle, inoculated with 200ul of spore suspension, and vortexed to evenly coat the seeds with the suspension. The cap was slightly loosened and placed in a plastic container to create a humidity chamber. Cultured at 28°C for 3-7 days, the ZmFS2 mutant strain was more resistant to seed rot than the corresponding wild type strain, and the identification results are shown as C and D in Figure 8 .

[0183] 5. Disease resistance identification of corn southern rust

[0184] In November, corn was planted in Hainan, and the phenotype of southern rust after flowering was counted in the field. According to the severity of the disease, a grading identification was made, with a total of 9 grades (1-9), and the larger the lesion area, the higher the grade. The identification results are shown in Figure 9 , which shows that the ZmFS2 mutant strain is more resistant to southern rust than the corresponding wild type.

[0185] Example 4 Construction of ZmFS2 gene editing vector and verification of disease resistance function of edited strain

[0186] 1. Construction of corn ZmFS2 gene editing vector

[0187] ZmFS2 designed two target gRNAs, gRNA1 and gRNA2, the nucleotide sequences of which are shown in SEQ ID No. 10 and SEQ ID No. 11, respectively, corresponding to nucleotides 333-352 and 642-661 of SEQ ID No. 1. gRNA1 is a F primer and gRNA2 is a R primer, and a BsaI restriction site is introduced at the 5' end of the FR. The gRNA1-sgRNA-gRNA2 fragment is amplified and the fragment and the CRISPR / CAS9 vector are digested with BsaI. The ligation is performed with T4 Ligase, and the correct clone is sequenced to obtain CRISPR-ZmFS2.

[0188] 2. Genetic transformation of maize

[0189] The plasmid of CRISPR-ZmFS2 is transformed into Agrobacterium EHA105 competent cells, and the B104 maize inbred line is transformed by the company to obtain transgenic lines.

[0190] 3. Identification of ZmFS2 gene edited maize lines

[0191] The primer sequences used are as follows:

[0192] ZmFS2-gDNA1-F1: TCTAGAGCTAGAGCGG (SEQ ID No. 12);

[0193] ZmFS2-gDNA1-R1: AGGAAAGGAAACGATCTGAGGC (SEQ ID No. 13);

[0194] ZmFS2-gDNA2-F1: TACTGCAAGGAGGTCCGGG (SEQ ID No. 14);

[0195] ZmFS2-gDNA2-R1: CCCC AACGCGCTCACCATCCTGC (SEQ ID No. 15);

[0196] Cas9-F: GTGGCCTATTCTGTGCTGGT (SEQ ID No. 16);

[0197] Cas9-R: ATCCCGGTGCTTGTTGTAGG (SEQ ID No. 17).

[0198] To detect whether Cas9 is contained, the reaction system is as shown in Table 10.

[0199] Table 10 Reaction system

[0200]

[0201] PCR amplification was performed on corn material without Cas9, and the reaction conditions are shown in Table 11.

[0202] Table 11 Reaction conditions

[0203]

[0204] After PCR termination, agarose gel electrophoresis was performed for detection, and the correct band was sent to a sequencing company for sequencing with ZmFS2-gDNA1-F1 and ZmFS2-gDNA2-F1 primers.

[0205] After sequencing identification, a mutant strain without CAS9 but with a successfully edited ZmFS2 gene was obtained, named Y2-1, and its nucleotide sequence is shown as SEQ ID No. 18. The sequence changes after editing of the edited mutant strain are shown as A, B and C in Figure 10 .

[0206] 4. In vitro inoculation and identification of corn leaf anthracnose

[0207] (1) The corn anthracnose causing Colletotrichum graminicola was grown on PDA medium, and cultured in a 28°C incubator in the dark;

[0208] (2) After preparing the spore eluate, the bacterial solution was collected; the bacterial solution was filtered into a new 50ml centrifuge tube, and the bacterial solution was adjusted to 5x10 5 / ml;

[0209] (3) The leaves were evenly spread on filter paper, and a syringe needle was used to punch holes on the leaves; the bacterial solution was added above the punched holes on the leaves, and after moisturizing, the leaves were treated in the dark; the third day, the lesion phenotype was observed by taking pictures, and the lesion area was counted by Image J software. The ZmFS2 gene edited strain was more resistant to anthracnose than the corresponding wild type strain, and the identification results are shown as A and B in Figure 11 .

[0210] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A kind of inhibition ZmFS2 The application of gene expression in the control of maize leaf spot, large leaf spot, southern rust, anthracnose, stalk rot, and seed rot is characterized by, The ZmFS2 The nucleotide sequence of the gene's cDNA is shown in SEQ ID No.

1.

2. The application as described in claim 1, characterized in that, The inhibition ZmFS2 Methods for gene expression in maize include one or more of gene editing and gene silencing.

3. The application as described in claim 2, characterized in that, The gene editing was performed using a CRISPR / CAS9-constructed editing vector. The target sequences of the cloning region of the editing vector were gRNA1 and gRNA2. The nucleotide sequence of gRNA1 is shown in SEQ ID No. 10, corresponding to nucleotides 333-352 in SEQ ID No. 1; the nucleotide sequence of gRNA2 is shown in SEQ ID No. 11, corresponding to nucleotides 642-661 in SEQ ID No.

1.

4. A kind of inhibition ZmFS2 The application of gene-expressing biomaterials in the preparation of formulations or products for the control of maize leaf spot, large leaf spot, southern rust, anthracnose, stalk rot, and seed rot, characterized in that, The biomaterial is any one of (1) to (3) below: (1) Inhibition ZmFS2 Recombinant vectors for gene expression; (2) Inhibition ZmFS2 Recombinant microorganisms expressing genes; (3) Inhibition ZmFS2 Transgenic plant cell lines expressing genes; The ZmFS2 The nucleotide sequence of the gene's cDNA is shown in SEQ ID No.

1.

5. The application as described in claim 4, characterized in that, The vector is a plasmid or a viral vector; the microorganism is a bacterium.

6. A method for controlling maize leaf spot, large leaf spot, southern rust, anthracnose, stalk rot, and seed rot, characterized in that, By inhibiting corn ZmFS2 Gene expression is achieved; The ZmFS2 The nucleotide sequence of the gene's cDNA is shown in SEQ ID No.

1.

7. A method for breeding maize, characterized in that, The steps include: inhibiting the growth of certain substances in corn. ZmFS2 Gene expression enables maize to resist small leaf spot, large leaf spot, southern rust, anthracnose, stalk rot and seed rot; The ZmFS2 The nucleotide sequence of the gene's cDNA is shown in SEQ ID No. 1.

Images