Method for promoting transient overexpression of exogenous genes in fish body based on PEI40000 and application thereof in enhancing protection rate of fish hemorrhagic disease virus DNA vaccine

By using PEI40000 reagent to encapsulate exogenous plasmids and injecting them into fish, transient overexpression of TBK1 and IRF5 genes was achieved, solving the problem of low protection rate of fish virus vaccines and significantly improving the immune efficiency and survival rate of fish.

CN119351467BActive Publication Date: 2026-06-12HUNAN INST OF FISHERY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUNAN INST OF FISHERY SCI
Filing Date
2024-11-22
Publication Date
2026-06-12

Smart Images

  • Figure CN119351467B_ABST
    Figure CN119351467B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biological medicine, and provides a method for promoting transient overexpression of exogenous genes in fish based on PEI40000 and application of PEI40000 in enhancing protection rate of fish hemorrhagic disease virus DNA vaccine. The PEI40000 reagent provided by the application is convenient to store and stable in property; preparation and application operation are simple; the reagent can be directly added into a culture medium containing serum; the cost performance is high, and the reagent is suitable for large-scale transfection experiments; the application verifies that the method significantly promotes expression of an exogenous plasmid in fish, and makes the expression time effect have a higher overexpression level within 1-10 days; and it is also clear that the application significantly enhances the protection effect of the fish hemorrhagic disease virus DNA vaccine, and significantly improves the survival rate of diseased fish, and the effect is more significant than that of the common adjuvant in the prior art, and the application can become an effective adjuvant for various DNA vaccines, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to a method for promoting transient overexpression of exogenous genes in fish based on PEI40000, and also relates to the application of PEI40000 in enhancing the protection rate of fish hemorrhagic septicemia virus DNA vaccines. Background Technology

[0002] With the rapid development of aquaculture, the corresponding viral and bacterial diseases have become increasingly serious. It is well known that vaccines are the best means of controlling bacteria and viruses. However, the development of fish vaccines has lagged far behind that of mammalian vaccines, and highly effective, safe, and economical fish vaccines are relatively rare in production and application. DNA vaccines are a novel type of vaccine that directly injects genes encoding pathogen antigen proteins into the host, utilizing the host cell's expression system to produce the antigen proteins, thereby stimulating an immune response. Compared with traditional vaccines, DNA vaccines have advantages such as low production cost, good stability, ease of storage and transportation, and long-lasting immune effects. The main challenge for DNA vaccines lies in improving their immunogenicity, as the expression level of naked DNA in vivo may be low. In practical applications, the immune response can be enhanced by improving DNA transfection efficiency or by combining it with molecular adjuvants (such as CpG ODNs). Research on DNA vaccines is constantly progressing, including optimizing antigen gene expression, using different delivery systems (such as nanoparticles and microspheres), and developing new molecular adjuvants.

[0003] SVCV (Carp Spring Viremia Virus) is a virus that poses a serious threat to cyprinid fish, causing an acute, highly lethal infectious disease that results in significant economic losses to the aquaculture industry. This virus is widespread in Europe, the Americas, and Asia and has been listed as a disease requiring mandatory reporting by the World Organisation for Animal Health (OIE). Fish infected with SVCV exhibit hemorrhage, organ damage, and high mortality rates. Transmission routes include water, food, and direct contact with fish. The virus genome is approximately 11,000 bp in length and contains five major open reading frames (ORFs), encoding five structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA polymerase (L). Grass carp hemorrhagic disease is a serious viral infectious disease affecting freshwater fish such as grass carp (Ctenopharyngodonidellus) and black carp (Mylopharyngodonpiceus). Clinically, it is characterized by one or more symptoms, including red fins, red gills, red intestines, and / or red muscle. Grass carp reovirus (GCRV) has been identified as the pathogen causing hemorrhagic disease in grass carp, causing significant damage to aquaculture in southern my country. Currently, at least 26 GCRV strains have been isolated from different regions of China and divided into three groups based on their genomic and biological characteristics.

[0004] As is well known, vaccines are a common and highly effective means of controlling viral diseases. In recent years, to address the severe economic losses caused by viruses to aquaculture, scholars both domestically and internationally have developed many vaccines for the prevention and control of fish viral diseases. Among these, some progress has been made in the development of vaccines for fish hemorrhagic virus (SVCV). For example, the G protein of SVCV has been successfully expressed using a prokaryotic expression system, and specific monoclonal antibodies have been prepared. These monoclonal antibodies are characterized by high specificity and sensitivity, and can be used to develop various diagnostic reagents, providing tools for establishing novel immunological diagnostic methods for SVCV. GCRV inactivated vaccines have also been put into use. However, despite the development of these vaccines against fish hemorrhagic viruses, they have not been widely accepted and used due to issues such as protection rates and safety.

[0005] Polyethyleneimine (PEI) can be used as a non-viral synthetic polymer carrier for the in vivo delivery of therapeutic nucleic acids. Linear PEI transfection reagents have been validated for wide applicability to various cell lines, including HEK-293, HEK293T, CHO-K1, COS-1, COS-7, NIH / 3T3, Sf9, HepG2, and HeLa cells, with transfection efficiencies reaching 80%-90%. Linear polyethyleneimine 40000 (PEI40000) is a highly charged cationic polymer with a molecular weight of 40,000, which readily binds to negatively charged nucleic acid molecules to form a complex, enabling this complex to enter the cell. Compared to the commonly used PEI25000, PEI40000 has many advantages, including: PEI40000 is more soluble and can dissolve directly in water, while PEI25000 requires the water to be adjusted to a weakly acidic state to aid dissolution, and then the pH is adjusted to neutral with NaOH; PEI40000 is simpler to handle and easier to use, and its transfection effect is better than PEI25000; PEI25000 contains 4-11% propionyl residue, which can prevent the polymer backbone from binding to DNA; compared to PEI25000, PEI40000 is a completely detachable structure, so its performance remains consistently high. However, there is currently very little research on its application in vaccine development, especially its use in DNA vaccine research for fish viruses.

[0006] Improving the immunogenicity of DNA vaccines is crucial for their development. This can be achieved through continuous screening of DNA sequences to maximize their immunogenicity; enhancing vaccine delivery capabilities; and using vaccine adjuvants to improve protection rates. Cytokines such as interleukins (IL-2, IL-4, IL-5, IL-7, IL-12), interferon (IFN), and granulocyte-macrophage colony-stimulating factor (GM-CSF) have immunoadjuvant effects; selecting appropriate cytokines as adjuvants for nucleic acid vaccines can effectively improve immunization. Liposome adjuvants and nano-adjuvants have also been shown to significantly enhance the immunogenicity of DNA vaccines. Here, we discover for the first time that PEI40000 can be used as an additive to significantly improve the protective efficiency of viral vaccines. Summary of the Invention

[0007] The first objective of this invention is to provide a method for promoting transient overexpression of exogenous genes in fish based on PEI40000.

[0008] To achieve the above objectives, the present invention employs the following technical solution: exogenous plasmids are encapsulated using PEI40000 reagent and injected into fish to achieve transient overexpression; the specific steps are as follows:

[0009] 1) Prepare PEI40000 stock solution

[0010] Dissolve PEI40000 in ultrapure water at room temperature. Adjust the pH of the resulting PEI40000 aqueous solution to 6.5-7.0 with sodium hydroxide solution. After filtration, bring the volume up to a PEI40000 stock solution with a concentration of 0.5-1.2 mg / mL. After aliquoting, store at 2-6℃.

[0011] 2) Prepare PEI40000 reagent

[0012] Take 1-6 μL of the PEI40000 stock solution obtained in step 1) and dilute it to 50 μL with PBS solution with pH 7.2-7.4 to obtain PEI40000 reagent with a concentration of 0.006-0.042 μg / μL;

[0013] 3) Preparation of exogenous plasmid reagents

[0014] One or more exogenous target genes are mixed with PBS solution at pH 7.2-7.4 to obtain exogenous plasmid reagent;

[0015] 4) Promote expression

[0016] Mix the PEI40000 reagent from step 2) with the exogenous plasmid reagent prepared in step 3), and inject the mixture into the fish via intraperitoneal or intramuscular injection. Feeding should begin 12 hours after injection. Significant overexpression promotion was observed 1-10 days after injection.

[0017] As a preferred embodiment of the present invention, the exogenous target gene includes TBK1 (TANK-binding kinase 1) and / or IRF5 (interferon regulatory factor 5).

[0018] Preferably, the injection method includes intraperitoneal injection and intramuscular injection.

[0019] Preferably, the pH of the PEI40000 aqueous solution is adjusted to 6.8 using a sodium hydroxide (0.5-2 mol / L) solution.

[0020] Preferably, the PEI40000 aqueous solution is filtered using a 0.1-0.45μm syringe filter.

[0021] Preferably, the PEI40000 aqueous solution with a concentration of 0.5-1.2 mg / mL is stored at 2-6°C.

[0022] Preferably, the ratio of fish body to exogenous plasmid reagent is 1g:0.5μg~1μg.

[0023] Preferably, the ratio of exogenous plasmid reagent to PEI40000 is 1 μg: 1 μg to 3 μg.

[0024] Another object of the present invention is to provide the application of PEI40000 in enhancing the protection rate of fish hemorrhagic septicemia virus DNA vaccines; comprising the following steps:

[0025] 1) Prepare PEI40000 stock solution

[0026] PEI40000 was dissolved in ultrapure water at room temperature. The pH of the resulting PEI40000 aqueous solution was adjusted to 6.8 with sodium hydroxide solution. After filtration through a 0.1-0.45μm syringe filter, the solution was brought to a final volume of 1 mg / mL to obtain a PEI40000 stock solution. The solution was then aliquoted and stored at 2-6℃.

[0027] 2) Prepare PEI40000 reagent

[0028] Take 1-6 μL of the PEI40000 stock solution obtained in step 1 and dilute it to 50 μL with PBS solution with pH 7.2-7.4 to obtain PEI40000 reagent with a concentration of 0.006-0.042 μg / μL;

[0029] 3) Mixing vaccines and reagents

[0030] The PEI40000 reagent obtained in step 2) was diluted with PBS solution with a pH of 7.2-7.4 and then mixed with the fish hemorrhagic disease virus DNA vaccine to obtain a mixed reagent; the ratio of the fish hemorrhagic disease virus DNA vaccine to the PEI40000 reagent was 2.1 μg: 2 μg.

[0031] 4) Processing the fish

[0032] The mixed reagent obtained in step 3) is injected into the fish via intraperitoneal or intramuscular injection. One day after injection, 10 μL containing 3*10 5 Fish hemorrhagic disease virus (FHDV) was administered via PFU, and mortality was observed and recorded starting 24 hours after virus injection. The ratio of fish body to FHDV DNA vaccine was 0.3 g: 0.2 μg.

[0033] Preferably, the fish hemorrhagic disease virus DNA vaccine comprises a G protein DNA vaccine of SVCV.

[0034] Preferably, the pH of the PEI40000 aqueous solution is adjusted to 6.8 using a sodium hydroxide (0.5-2 mol / L) solution.

[0035] Preferably, the PEI40000 aqueous solution is filtered using a 0.1-0.45μm syringe filter.

[0036] Preferably, the PEI40000 aqueous solution with a concentration of 0.5-1.2 mg / mL is stored at 2-6°C.

[0037] Compared with the prior art, the present invention has the following advantages and effects:

[0038] The raw material PEI40000 used in this invention is inexpensive, readily available, safe, and non-toxic. At a cell density of 70%-80%, the transfection efficiency can reach over 80%, making it suitable for both transient and stable transfection. It is widely applicable to various cell lines, exhibiting low toxicity and high expression. Furthermore, PEI40000 transfected cells show good morphology, can express large amounts of the target protein, and has low cytotoxicity. The reagent containing PEI40000 provided in this application is easy to store, stable, and simple to prepare: solutions can be directly prepared with distilled water and added directly to serum-containing culture media, making it simple and cost-effective. The research process in this application verified that the PEI40000 reagent significantly promotes the expression of exogenous plasmids in fish. Different doses of PEI40000 can significantly enhance the expression of pcDNA5-Flag plasmid in grass carp, and its expression duration is consistently high within 1-10 days. It has been confirmed that the PEI40000 reagent significantly enhances the protective effect of fish hemorrhagic septicemia virus DNA vaccine and significantly improves the survival rate of diseased fish. Its effect is more significant than that of commonly used adjuvants in existing technologies. It may become an effective adjuvant for a variety of DNA vaccines and has broad application prospects. Attached Figure Description

[0039] Figure 1 The values ​​represent the mRNA expression levels of TBK1 in the spleen, liver, and kidney in the presence and absence of PEI40000 in Example 3. E represents the primer for detecting the exogenous expression vector, and D represents the primer for detecting total TBK1.

[0040] Figure 2 This shows the protein expression levels of the exogenous TBK1 plasmid carrying the Flag tag in fish in Example 3. TBK1 was detected using the Flag antibody, and β-actin was used as an internal reference gene.

[0041] Figure 3 This is a spleen tissue section after GCRV-II infection following overexpression of the exogenous gene mediated by PEI40000 in fish in Example 4.

[0042] Figure 4 The survival rate of grass carp infected with GCRV-II after the PEI40000-mediated expression of the exogenous gene in fish in Example 4 is shown.

[0043] Figure 5 These are typical symptoms observed in zebrafish infected with SVCV in Example 5.

[0044] Figure 6 The survival rate of the PEI40000-mediated DNA vaccine expressed in fish in Example 5 is shown.

[0045] Figure 7The protective rate of PEI40000 and maleimide against DNA vaccines in Example 6. Detailed Implementation

[0046] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0047] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0048] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0049] The testing methods used in the embodiments of this invention are as follows:

[0050] Construction of recombinant plasmids:

[0051] mRNA was extracted using a virus-specific RNA extraction kit (FOREGENE, China), and cDNA template was obtained after reverse transcription. PCR was then performed using this template, firstly through high-temperature denaturation: the reaction mixture was heated to 93-98℃ and maintained for a certain time to dissociate the DNA double strand into single strands, facilitating primer binding. Next, low-temperature annealing: the temperature was lowered to 50-65℃, allowing the primers to pair with complementary sequences of the template DNA single strands. Finally, medium-temperature extension: at a suitable temperature (generally 72℃), DNA polymerase used dNTPs to synthesize new DNA strands, forming double-stranded DNA. This process was repeated multiple times: the above three steps were repeated, doubling the amount of the target fragment each cycle. Typically, 25-35 cycles were used to amplify the target fragment (the sequence of the G protein of carp spring hemorrhagic virus). Enzyme digestion is used to change the vector from circular to linear. The linear vector is then homologously recombined with the target gene, which has a homologous arm. This means that the target gene is ligated into the expression vector FRT / TO-pcDNA5, and the vector has been inserted with the expression flag tag sequence, thus completing the construction of the recombinant vector with the flag tag (G-vector).

[0052] qPCR detection

[0053] Clean the mortar, tweezers, and scissors one day in advance, wrap them in aluminum foil, and sterilize them at 180℃ for 4 hours. Grind the tissue in a fume hood: Add 1 mL of Trizol to the mortar, grind the tissue block with liquid nitrogen until liquid, then transfer to an EP tube. (Keep the liquid nitrogen supply sufficient at all times.) Add 200 μL of chloroform to the EP tube, vortex for 30 seconds, and incubate on ice for 10 minutes to separate the layers. After separation, centrifuge at 12000g for 10 minutes, resulting in three layers (upper layer: aqueous phase; middle layer: DNA; lower layer: protein). Transfer the supernatant to a new EP tube (avoid aspirating the middle layer). Add an equal volume of isopropanol to the EP tube, invert to mix, incubate on ice for 10 minutes, and then centrifuge at 12000g for 10 minutes. Discard the supernatant, retaining the precipitate. (Use a pipette to remove as much supernatant as possible). Add 1 mL of 75% ethanol to the EP tube, centrifuge at 12000g for 5 minutes, discard the supernatant, and aspirate thoroughly. Add 1 mL of 100% ethanol to an EP tube, centrifuge at 12000g for 5 min, discard the supernatant, and aspirate thoroughly. Open the EP tube, wait 3 min for the ethanol to evaporate, and aspirate thoroughly again. Add 25–50 μL of DEPC water to dissolve the RNA. Measure the concentration using a microplate reader (tip should be RNAse-free). Run nucleic acid electrophoresis to check for RNA degradation. (Two relatively large bands, 28S and 18S, will appear; for testing, a new electrophoresis buffer must be used, and the tip must be RNAse-free). Store at -80℃ after detection. Obtain the cDNA template using the Tiangen Reverse Transcription Kit. Perform qPCR detection according to the specific qPCR procedure described in the examples.

[0054] Protein extraction:

[0055] Remove the prepared RIPA lysis buffer (Sangon Biotech, C500005-0100) from -20℃, place it on ice to thaw, mix well, and centrifuge briefly; prepare RIPA lysis buffer containing protease inhibitors. Weigh the tissue, cut it into small pieces, and place them in tubes. Rinse the tissue pieces 3-5 times with pre-chilled PBS to remove surface blood. Add pre-chilled RIPA lysis buffer containing protease inhibitors, adding 1 mL of RIPA lysis buffer containing protease inhibitors to 250 mg of tissue pieces. Homogenize using a glass homogenizer at low speed for 30 seconds each time, with a 1-minute interval on ice between homogenizations, until the tissue is completely lysed. Place on ice for 30 minutes, shaking every 10 minutes for 1 minute each time. After complete lysis, centrifuge at 14000 rpm for 15 minutes at 4℃, and immediately transfer the supernatant to a new centrifuge tube and store at -80℃.

[0056] Immunoblotting assay:

[0057] a. Sample preparation: After cooling the extracted protein sample to room temperature on ice, add 20 μL of 5X SDS protein loading buffer (Yaxin, LT101S), heat in a 100℃ metal bath for 15 min, let stand, cool to room temperature, and then centrifuge.

[0058] b. Electrophoresis: Place the pre-prepared 10% SDS-PAGE gel in the electrophoresis tank and add an appropriate amount of electrophoresis buffer. Take 30 μL of sample and load it onto the gel. Start electrophoresis at a constant current of 20 mA per gel and stop electrophoresis when the protein markers are clearly separated and can be easily separated for subsequent experiments.

[0059] c. Transfer: After electrophoresis, remove the gel from the slot, pry open the glass plate, and firmly attach the gel to the PVDF membrane. Then place it in the wet transfer instrument, making sure that the gel is on the negative side of the power supply and the PVDF membrane is on the positive side. After adding the transfer buffer, the transfer operation parameters are 280V, 90min, and ice bath cooling is used during the process.

[0060] d. Antibody incubation: After the PVDF membrane was transferred, it was washed with TBS and blocked with protein-free rapid blocking buffer at room temperature for 15 min. Mouse anti-Flag-Tag monoclonal antibody was diluted with antibody dilution buffer at a ratio of 1:5000 and incubated with PVDF membrane at room temperature for 1 h. Then it was washed with TBS and then incubated with goat anti-mouse monoclonal and secondary antibody diluted 1:30000 at room temperature for 1 h. After that, it was washed three times with TBST buffer (50 mM Tris-Cl, 150 mM NaCl, 0.1% Tween-20, pH 7.5) and once with TBS buffer (50 mM Tris-Cl, 150 mM NaCl, pH 7.5). Each wash was performed by shaking on a decolorizing shaker for 15 min.

[0061] e. Color development: Dilute the BCIP / NBT colorimetric kit (Solarbio, China, PR1100) according to the specified ratio and incubate it with the PVDF membrane in the dark. When a clear target band appears on the PVDF membrane, terminate the colorimetric reaction with water.

[0062] Tissue sections and staining:

[0063] Spleens were isolated and fixed with 4% paraformaldehyde. The samples were then dehydrated using ethanol and other dehydrating agents of increasing concentrations, followed by clearing with xylene and other clearing agents. The cleared tissue samples were then immersed in a paraffin-xylene solution for paraffin embedding. The paraffin-embedded tissue samples were placed in paper boats, which were then placed in cold water to accelerate the cooling process to 26°C, resulting in paraffin blocks for embedding the samples. The paraffin blocks were adhered to a microtome, and the microtome was adjusted to cut continuous paraffin strips. These strips were then segmented to obtain paraffin slides. The paraffin slides were spread in 45°C warm water, then retrieved using a glass slide, and positioned centrally. They were then allowed to air dry. After air drying, the paraffin was removed by immersing the slides in pure xylene solution, followed by alcoholic treatment with ethanol solutions of varying concentrations. Finally, the alcohol-treated slides were stained with hematoxylin and eosin and observed and photographed under a microscope.

[0064] PBS solution (Ginobio, catalog number: GMN20012-5)

[0065] Example 1: Safe dosage of PEI40000 in fish

[0066] 1.1 Preparation method of PEI40000 mother liquor

[0067] PEI40000 (Yeasen, 40815ES) was dissolved in ultrapure water at room temperature. The resulting PEI40000 aqueous solution was adjusted to pH 6.8 with sodium hydroxide (1 mol / L) solution, filtered through a 0.1 μm syringe filter, and then diluted to a PEI40000 stock solution with a concentration of 1 mg / mL. The solution was then aliquoted and stored.

[0068] 1.2 Method for preserving PEI40000 mother liquor

[0069] 1 mL of the PEI40000 stock solution was stored at 4℃, -20℃, and -80℃, respectively, and used to transfect EGFP-N1 plasmids in EPC cells and HEK-293T cells after being stored at these three temperatures for one week. Forty-eight hours after transfection, fluorescence microscopy was used to photograph and quantify the fluorescence signal. The results are shown in Table 1. At the stated concentrations, the ability of the PEI40000 stock solution to transfect exogenous plasmids into cells was weakened after cryopreservation. The optimal storage condition for this reagent is 4℃.

[0070] Table 1

[0071] cell 4℃ -20℃ -80℃ EPC 48.88% 33.63% 31.82% HEK-293T 90.73% 74.65% 72.94%

[0072] Note: The values ​​in the figure represent transfection efficiency.

[0073] 1.3 Toxicity analysis of PEI40000 in vivo

[0074] Seven different volumes of 1 mg / mL PEI40000 stock solution were diluted to 50 μL with PBS solution (Sangon Biotech, E607008) at pH 7.2-7.4, so that the final dosage of PEI40000 in each stock solution was 0.3, 0.6, 0.9, 1.2, 1.5, 1.8, and 2.1 μg, respectively. A blank control group, seven stock solution injection concentration groups, and a stock solution injection concentration group were also set up, and the groups were named 1, 2-8, and 9, respectively. See Table 2 for details.

[0075] Healthy grass carp weighing 3g ± 0.2g were selected, with 10 fish per group. The diluted solution was injected intraperitoneally using a syringe (see Table 2). Feeding began 12 hours after injection and continued every 12 hours thereafter, with a feed amount of 1% of the fish's body weight. Uneaten feed was collected after each feeding, dried, weighed, and the uneaten feed rate was calculated. This process was repeated for seven consecutive days. The results showed that no deaths occurred in any group during the 7-day feeding period, the weight gain was generally consistent across groups, and the average uneaten feed rate did not change significantly over seven days. Therefore, at this concentration, PEI40000 did not harm the grass carp.

[0076] Table 2

[0077] Grouping Dosage (μg) Volume (μL) Total weight (g) Quantity (tails) 1 0.0 50 30.23 10 2 0.3 50 30.12 10 3 0.6 50 30.05 10 4 0.9 50 30.25 10 5 1.2 50 29.98 10 6 1.5 50 30.14 10 7 1.8 50 30.20 10 8 2.1 50 30.02 10 9 50 50 30.16 10

[0078] Table 3

[0079]

[0080] Example 2: Efficiency of PEI40000 in promoting the expression of exogenous plasmids

[0081] In Example 1, it was demonstrated that intraperitoneal injection of 1-21 μg PEI40000 per gram of fish did not affect the health of the fish. However, it is unclear which concentration and ratio within this range would maximize the expression of the exogenous plasmid in the fish, and the duration for which the method described in this invention would enable sustained expression of the exogenous plasmid in the fish at the optimal concentration and ratio is also unknown. Therefore, in this example, different dilutions of PEI40000 stock solution prepared in the same manner as in Example 1 were used to conduct orthogonal experiments with different masses of the exogenous plasmid pcDNA5-Flag.

[0082] The operation method is as follows:

[0083] In the verification process of this invention, orthogonal experiments were conducted using PEI40000 stock solution with a large dilution range and the exogenous plasmid pcDNA5-Flag. Four groups (0, 0.3, 1.5, and 2.1 μg) were selected and combined with 0.5, 1, 2, and 3 μg of the exogenous plasmid pcDNA5-Flag (expression vector), respectively. Twelve fish (3g ± 0.2g) were injected intraperitoneally into each group, and feeding began 12 hours post-injection. Subsequently, on days 1, 4, 7, and 10 post-injection, three fish from each group were collected, and their viscera mixtures were used for RNA extraction. The RNA was then reverse transcribed and used for qPCR to identify the expression level of the exogenous plasmid. The primers used for qPCR detection were:

[0084] bcβ-actin-QF (SEQ ID NO.1): TGGGCACCGCTGCTTCCT

[0085] bcβ-actin-QR (SEQ ID NO.2): TGTCCGTCAGGCAGCTCAT

[0086] pcDNA5-QF(SEQ ID NO.3):GGTAGGCGTGTACGGTGG

[0087] pcDNA5-QR(SEQ ID NO.4):TAGAAGGCACAGTCGAGG

[0088] qPCR reaction system: 2.0 μL (10 pmol / μL) upstream primer (bcβ-actin-QF / pcDNA5-QF), 2.0 μL (10 pmol / μL) downstream primer (bcβ-actin-QR / pcDNA5-QR), 5 μL sample DNA, 0.6 μL Taq DNA polymerase (5 U / μL), 12.5 μL real-time fluorescent PCR buffer (2×) (prepared with a mixture of 2.5 μL 10× buffer from Takara, 2 μL 10 mM dNTP, 0.0025 μL 10000× SYBR green I, and 8 μL DEPC water), and sterile water added to a final volume of 25 μL. The PCR reaction conditions were as follows: first, prevent contamination at 37℃ for 5 min; then, pre-denaturation at 95℃ for 3 min; finally, amplification at 95℃ for 10 sec and 60℃ for 40 sec, for a total of 40 cycles. Fluorescence signal was detected at the end of the extension phase of each cycle. The CT value of pcDNA5 was balanced using the CT value of β-actin.

[0089] The results (Table 4) showed that without PEI40000, the overexpression effect ΔCT value in grass carp via intraperitoneal injection was less than 1. However, the addition of different doses of PEI40000 significantly enhanced the expression of the pcDNA5-Flag plasmid in grass carp, and the overexpression duration was high within 1-10 days. In grass carp weighing approximately 3g, after intraperitoneal injection, the expression of the exogenous plasmid pcDNA5-Flag promoted by PEI40000 was basically consistent when using 2-3 μg of plasmid pcDNA5-Flag and 1.5-2.1 μg of PEI40000 in a volume of 50 μL. The optimal expression combination was 2 μg plasmid + 2.1 μg PEI40000, i.e., the optimal ratio was live body weight (g): plasmid mass (μg): PEI40000 mass (μg) = 3:2:2.1.

[0090] Table 4. Effect of overexpression in fish (ΔCT values)

[0091]

[0092] Note: The values ​​in the table are ΔCT after pcDNA5-β-actin regulates the CT value.

[0093] Example 3: PEI40000 promoted the expression of TBK1 (TANK-binding kinase 1) in grass carp.

[0094] In Example 2, the optimal ratio of PEI40000 was determined. The TBK1 plasmid from grass carp was ligated into the FRT / TO-pcDNA5 vector and transformed into *E. coli*. The correct FRT / TO-pcDNA5-TBK1 plasmid was obtained after screening by colony PCR. Using the above ratio (2 μg plasmid + 2.1 μg PEI40000), the expression ratio after intraperitoneal injection in grass carp was determined.

[0095] Healthy grass carp weighing approximately 3g were divided into two groups of six. Each group was injected with 50μL of the following solution:

[0096] A: PEI40000(2.1μg)+TBK1(2μg)

[0097] B: TBK1 (2μg)

[0098] All reagents were diluted to 50 μL with PBS and administered via intraperitoneal injection. Four days post-injection, spleen, liver, and kidneys were harvested from three grass carp. Part of the kidneys were used for Western blotting (WB) to detect the protein expression level of the exogenous plasmid; the rest were used for qPCR. To detect the overexpression efficiency of TBK1, we designed two pairs of primers for TBK1 detection. The first pair, named the endogenous D primer pair, can detect both exogenously overexpressed TBK1 and endogenous TBK1 expression. The second pair, named the exogenous E primer pair, can only detect exogenously expressed TBK1 because its 5' end primer is designed on the exogenous vector. Primer information is as follows:

[0099] D primer pair:

[0100] bcTBK1-qF(SEQ ID NO.5):AAGTACAGCCACGCTACGAC

[0101] bcTBK1-qR (SEQ ID NO.6): TGAGATACGCCTGCGGTTTG

[0102] E primer pair

[0103] pcDNA5-qF(SEQ ID NO.7):GGTAGGCGTGTACGGTGG

[0104] pcDNA5-TBK1-qR (SEQ ID NO.8):CGTCCAGCGGACGCAGGAAGCT

[0105] Internal reference primer pair

[0106] bcβ-actin-QF (SEQ ID NO.9): TGGGCACCGCTGCTTCCT

[0107] bcβ-actin-QR (SEQ ID NO.10): TGTCCGTCAGGCAGCTCAT

[0108] qPCR reaction system: 2.0 μL upstream primer (10 pmol / μL), 2.0 μL downstream primer (10 pmol / μL), 5 μL sample DNA, 0.6 μL Taq DNA polymerase (5 U / μL), 12.5 μL real-time fluorescent PCR buffer (2×) (prepared with a mixture of 2.5 μL 10× buffer (purchased from Takara), 2 μL 10 mM dNTPs, 0.0025 μL 10000× SYBR green I, and 8 μL LEPC water), and sterile water to a final volume of 25 μL. Results showed that... Figure 1The PEI40000 group significantly enhanced the mRNA expression level of TBK1 in grass carp, with the highest mRNA level detected in the spleen, showing relative fold increases of 38.76 and 44.2 times using exogenous and endogenous primer pairs, respectively. Good expression was also observed in the liver, with relative fold increases of 29.3 and 33.3 times using exogenous and endogenous primer pairs, respectively. These results demonstrate that PEI40000 can significantly enhance the expression of exogenous plasmids in grass carp.

[0109] After extracting the spleen and liver of grass carp and grinding them, proteins were extracted using RAPI lysis buffer, with protease inhibitors and phosphatase inhibitors added during the extraction process. Subsequently, Western blotting was performed, and TBK1 expression was detected using an anti-Flag monoclonal antibody. The results showed ( Figure 2 The protein level was also significantly increased because TBK1 overexpression was clearly detected in group A.

[0110] Example 4: PEI40000 promotes the overexpression of TBK1 (TANK-binding kinase 1) and IRF5 (interferon regulatory factor 5) to enhance the body's resistance to grass carp reovirus (GCRV).

[0111] Healthy grass carp weighing approximately 3g were divided into 5 groups, with 13 fish in each group. One group received no treatment (MOCK group), while the other four groups were injected intraperitoneally with PBS diluted to 50μL, containing the following components and concentrations:

[0112] A: MOCK

[0113] B: pcDNA5(2μg)+PEI40000(2.1μg)

[0114] C: TBK1(1μg)+pcDNA5(1μg)+PEI40000(2.1μg)

[0115] D: IRF5(1μg)+pcDNA5(1μg)+PEI40000(2.1μg)

[0116] E: TBK1(1μg)+IRF5(1μg)+PEI40000(2.1μg)

[0117] One day after plasmid injection, grass carp were gavaged with GCRV-II (GD108, Guangdong). Example 3 verified that TBK1 injected after treatment using this method was strongly expressed in the spleen and liver. Therefore, four days after gavage, spleens were collected from three grass carp in each group, and tissue samples were fixed, prepared, stained, and processed to obtain... Figure 3The results are shown in the description of the "Tissue Sectioning and Staining" section of the aforementioned method. Overexpression of TBK1 and IRF5 led to increased intercellular spaces in the spleen cells after GCRV-II infection.

[0118] Subsequently, in this embodiment, the mortality rate of the grass carp after GCRV-II gavage was observed and recorded every 12 hours. Figure 4 The results showed that PEI40000-mediated overexpression of TBK1 and IRF5 in grass carp maintained the survival rate of grass carp infected with GCRV-II at 44.4%, indicating that the co-overexpression of TBK1 and IRF5 treated by this method can significantly inhibit the mortality rate of grass carp infected with GCRV-II.

[0119] Example 5: PEI40000 improved the protection rate of SVCV virus DNA vaccine.

[0120] This invention uses a DNA vaccine constructed from a glycoprotein expression vector of SVCV virus as an example, and uses the zebrafish model organism as the implementation object to illustrate whether this invention can enhance the protective efficacy and protection rate of viral DNA vaccines.

[0121] The PEI40000 reagent used in this example is the same as in Example 1; the G protein DNA vaccine used is a self-made recombinant vector in which the DNA sequence expressing the G protein is ligated into the FRT / TO-pcDNA5 vector. The preparation method is described in the specific implementation method under the recombinant plasmid construction section. The SVCV strain used is SVCV741, and the titer of the SVCV strain used in this instance is 3*10. 8 pfu / mL, administered via intraperitoneal injection, with a dosage of 3 x 10^3 zebras per 0.3g zebra. 5 PFU was injected in a total volume of 10 μL (diluted with PBS). Two days after injection, zebrafish developed obvious petechial hemorrhages and subsequently died one after another. Figure 5 .

[0122] According to the proportions of Example 2, zebrafish weighing 0.3g were intraperitoneally injected with the following solution diluted to 10uL with PBS, containing the following components and amounts:

[0123] A: PEI40000 (0.21μg)

[0124] B: G-vector (0.2μg)

[0125] C: G-vector(0.2μg)+PEI40000(0.21μg)

[0126] One day after injection, 10 μL contains 3*10 5SVCV of pfu was observed and mortality was recorded 24 hours after viral injection. Results were as follows: Figure 6 As shown, the G-vector vaccine treated with PEI40000 resulted in a 45.45% survival rate in zebrafish infected with SVCV 132 hours later, compared to 11.15% in the group treated with only the G-vector vaccine. The survival rates in the PEI40000-treated and untreated groups were both 0%. These findings demonstrate that the G-vector vaccine against SVCV in zebrafish exhibits significant protective efficacy, and PEI40000 can enhance the protective efficacy of the SVCV G-vector vaccine.

[0127] Example 6: PEI40000 is a stronger adjuvant for SVCV G protein DNA vaccines than maleimide.

[0128] Maleimide is a common DNA vaccine adjuvant. To clarify whether PEI40000 described in this invention can serve as a highly effective DNA vaccine adjuvant, maleimide and PEI40000 were used for comparison in this example. Following the proportions of Example 2, zebrafish weighing 0.3g per unit weight were intraperitoneally injected with a solution diluted to 10µL with PBS containing the following components and amounts:

[0129] A: PBS

[0130] B: G-vector(0.2μg)+PEI40000(0.21μg)

[0131] C: G-vector (0.2 μg) + maleimide (0.21 μg)

[0132] One day after injection, 10 μL contains 3*10 5 SVCV of PFU was detected, and the number of deaths was observed and counted 24 hours after viral injection. The vaccine protection rate was calculated as follows: Vaccine protection rate = (Incidence rate in control group - Incidence rate in vaccinated group) / Incidence rate in control group * 100%, where the control group was group A as described above. The results are as follows. Figure 7 As shown, the G protein DNA vaccine treated with PEI40000 exhibited a protection rate of 54.21%, while the G protein DNA vaccine treated with maleimide showed a protection rate of 33.03%. Therefore, PEI40000 is significantly more effective than maleimide as an adjuvant for SVCV G protein DNA vaccines. This invention uses PEI40000 to promote the expression of exogenous plasmids in fish, which is expected to contribute to the study of antiviral mechanisms. Furthermore, PEI40000 can enhance the protective efficiency of SVCV G protein DNA vaccines, which is expected to promote the development of SVCV DNA vaccines. In summary, this invention provides a novel use for PEI40000 to promote the expression of exogenous DNA in live fish.

[0133] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. The application of PEI40000 in the preparation of reagents for promoting transient overexpression of in vitro genes in fish, characterized in that, Includes the following steps: 1) Preparation of PEI40000 stock solution Dissolve PEI40000 in ultrapure water, adjust the pH to 6.5-7.0, filter, and then bring the volume up to a PEI40000 stock solution with a concentration of 0.5-1.2 mg / mL. After dispensing, store at 2-6℃. 2) Prepare PEI40000 reagent Dilute the PEI40000 stock solution obtained in step 1) with PBS solution to obtain PEI40000 reagent with a concentration of 0.006~0.042µg / µL; 3) Preparation of exogenous plasmids The exogenous plasmid reagent is obtained by mixing one or more exogenous target genes with PBS solution. 4) Promote expression Mix the PEI40000 reagent prepared in step 2) with the exogenous plasmid reagent prepared in step 3), and inject the fish into the peritoneal or intramuscular injection. Feeding begins 12 hours after injection, and the effect of promoting the overexpression of exogenous genes in fish is produced within 10 days after injection. The pH of the PBS solution is 7.2-7.4; in step 4), when the fish is injected intraperitoneally or intramuscularly, the ratio of the fish to the exogenous plasmid reagent is 1g:0.5μg~1μg; the ratio of the exogenous plasmid reagent to the PEI40000 reagent is 2μg:2.1μg.

2. The application of PEI40000 in the preparation of reagents that enhance the protective rate of fish hemorrhagic septicemia virus DNA vaccines, characterized in that, Includes the following steps: 1) Preparation of PEI40000 stock solution PEI40000 was dissolved in ultrapure water at room temperature. The pH of the resulting PEI40000 aqueous solution was adjusted to 6.8 with sodium hydroxide solution. After filtration through a 0.1-0.45μm filter, the solution was brought to a final volume of 1 mg / mL to obtain a PEI40000 stock solution. The solution was then aliquoted and stored at 2-6℃. 2) Prepare PEI40000 reagent Dilute the PEI40000 stock solution obtained in step 1) with PBS solution to obtain PEI40000 reagent with a concentration of 0.006~0.042µg / µL; 3) Mixing vaccines and reagents The PEI40000 reagent obtained in step 2) was diluted with PBS solution and then mixed with the fish hemorrhagic disease virus DNA vaccine to obtain a mixed reagent. 4) Processing the fish The mixed reagent obtained in step 3) was injected into the fish via the peritoneal cavity or muscle. Fish hemorrhagic disease virus was injected 1 day later, and the vaccine protection rate was tested 24 hours later. The ratio of the fish hemorrhagic disease virus DNA vaccine to PEI40000 reagent is 2 μg : 2.1 μg; The ratio of fish body to fish hemorrhagic disease virus DNA vaccine is 3g:2μg; The fish hemorrhagic disease virus mentioned is either carp spring viremia virus SVCV or grass carp reovirus GCRV.

Citation Information

Patent Citations

  • Gene for treating orthopedic diseases and gene therapy medicine taking AAV as carrier

    CN116790610A