Substances inhibiting the KCNK3 gene and their application in regulating lipid metabolism or ferroptosis

Abstract

The present invention discloses a substance for inhibiting the KCNK3 gene and its application in regulating fat metabolism or ferroptosis. The present invention uses the CRISPR / Cas9 technology to construct gene knockout and overexpression cell lines, and finds that the knockout of KCNK3 inhibits lipid synthesis and accumulation in porcine preadipocytes and promotes lipolysis thermogenesis. Further, by using the technology of combined transcriptome and lipidome analysis, the KCNK3 gene knockout cells are analyzed, and it is found that KCNK3 regulates the biological processes of fat metabolism and ferroptosis. By detecting the iron content, ROS level, glutathione level, mitochondrial morphological characteristics, etc. in KCNK3 knockout PK15 cells, it is proved that the knockout of KCNK3 promotes ferroptosis. The present invention discovers for the first time the role of the KCNK3 gene in promoting porcine fat formation and inhibiting ferroptosis, and this discovery has important significance for regulating porcine fat deposition by using the KCNK3 gene and for the treatment of human obesity and ferroptosis-related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and specifically, to substances that inhibit the KCNK3 gene and their applications in regulating fat metabolism or ferroptosis. Background Art

[0002] Improving the fat deposition of livestock meat quality and cultivating new low-fat and high-quality varieties have always been the goals of breeders. Over the years, some genes related to fat deposition have been screened using omics techniques, but the only molecular breeding targets verified in animals are MSTN, UCP1, and MC3R. The research on the regulatory mechanism of fat deposition in livestock is not deep enough, and there is still a lack of genes with breeding value. The lack of major genes for fat deposition traits is the main "bottleneck" in biological breeding.

[0003] Ferroptosis is an iron ion-dependent programmed cell death. Excessive iron in cells will generate ROS through the Fenton reaction. ROS can react with polyunsaturated fatty acids (PUFAs) on the lipid membrane to induce lipid peroxidation, causing ferroptosis. Moreover, ferroptosis is also closely related to the occurrence and development of various diseases such as neurological diseases (Huntington's disease, Alzheimer's disease, etc.), tissue ischemia-reperfusion injury (brain, liver, kidney, etc.), liver and lung fibrosis, heart diseases, osteoarthritis, obesity, and diabetic complications. Therefore, exploring new targets that inhibit ferroptosis-related pathways can not only reduce fat deposition but also be regarded as a potential hope and direction for treating related diseases.

[0004] In addition, pig organ transplantation is of great significance for treating human diseases. The discovery of genes regulating pig fat metabolism and ferroptosis will have important reference value for studying human obesity and ferroptosis complications.

[0005] Potassium channel subfamily member 3 (KCNK3, potassium channel, subfamily K, member 3), a transmembrane protein with a molecular weight of 21 kDa to 24 kDa, participates in the formation of cell membrane microdomains (caveolae). The region of amino acid residues 82 - 101 is called the caveolin-scaffolding domain (SCD), which is the structural basis for interacting with many other molecules. KCNK3 is widely distributed in terminally differentiated cells or quiescent cells of the body. KCNK3 can participate in the regulation of signal transduction, inhibit cell growth and transformation, and vesicle transport (including endocytosis, pinocytosis, and transcytosis). However, the role of KCNK3 in the fat metabolism and ferroptosis of livestock (such as pigs) has not been reported. Summary of the Invention

[0006] To solve at least one of the above problems, the present disclosure provides an RNA that inhibits the KCNK3 gene and its application in regulating lipid metabolism or regulating ferroptosis.

[0007] According to one aspect of the present disclosure, there is provided an application of a substance that inhibits the KCNK3 gene in regulating lipid metabolism or regulating ferroptosis.

[0008] In some embodiments, the application in regulating lipid metabolism or regulating ferroptosis includes:

[0009] (1) Inhibiting the expression of KCNK3 protein;

[0010] (2) Inhibiting adipogenic differentiation and / or fatty acid synthesis, and / or promoting lipolysis;

[0011] (3) Promoting ferroptosis of cells;

[0012] (4) Increasing the abundance of polyunsaturated fatty acids;

[0013] (5) Upregulating total triglycerides, fatty acyls, sterol esters, glycerides, and / or glycerophospholipids; and / or downregulating hexosylceramides, monogalactosyldiacylglycerols, and / or sphingolipids;

[0014] (6) Reducing fat deposition; and / or promoting lipid peroxidation;

[0015] (7) Inhibiting glutathione metabolism, and / or reducing the production of total glutathione in cells, including reduced glutathione and oxidized glutathione;

[0016] (8) Increasing the ROS level in cells;

[0017] (9) Preparing a KCNK3 inhibitor;

[0018] (10) Preparing a drug for regulating lipid metabolism or a drug for regulating ferroptosis, and / or preparing a drug for preventing, alleviating, and / or treating obesity and its complications;

[0019] (11) Preparing a drug for regulating ferroptosis, and / or preparing a drug for preventing, alleviating, and / or treating diseases related to ferroptosis;

[0020] (12) Preparing a model cell for lipid metabolism diseases or ferroptosis-related diseases;

[0021] (13) Preparing a kit for constructing a model cell for lipid metabolism diseases or ferroptosis-related diseases;

[0022] (14) Preparing an animal model for lipid metabolism diseases or ferroptosis-related diseases;

[0023] (15) Kit for preparing an animal model for constructing a lipid metabolism disease or an iron death-related disease;

[0024] (16) Breeding or cultivation for livestock animals.

[0025] In some embodiments, the iron death-related diseases include, but are not limited to, neurological diseases, tissue ischemia-reperfusion injury, liver and lung fibrosis, heart diseases, osteoarthritis, diabetes, etc.

[0026] In some embodiments, the neurodegenerative diseases include one or more of Huntington's disease, Parkinson's disease, and Alzheimer's disease.

[0027] In some embodiments, the livestock animals include one or more of deer, goats, sheep, cattle, and / or pigs.

[0028] In some embodiments, the substance that inhibits the KCNK3 gene includes at least one of a substance that inhibits KCNK3 activity, a substance that degrades KCNK3, and a substance that reduces the expression level of KCNK3.

[0029] In some embodiments, the substance that reduces the expression level of KCNK3 comprises at least one of (a1)-(a3):

[0030] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA, or shRNA targeting KCNK3;

[0031] (a2) Nucleic acid molecule expressing (a1);

[0032] (a3) Expression cassette, vector, transgenic cell line, or microorganism comprising (a2).

[0033] In some embodiments, the substance that inhibits KCNK3 activity comprises at least one of (b1)-(b3):

[0034] (b1) Antibody specifically binding to KCNK3;

[0035] (b2) Ligand protein or polypeptide specifically binding to KCNK3;

[0036] (b3) Non-protein compound specifically binding to KCNK3.

[0037] In some embodiments, the siRNA has a nucleotide sequence as shown in SEQ ID NO: 3 and 4, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0038] In some embodiments, the 3' end of the siRNA is further modified with 2-6 overhanging nucleotides composed of dT, dA, dC, dG or U.

[0039] In some embodiments, the sgRNA is used for gene knockout / knockdown based on CRISPR / Cas9, and the targeting sequence of the sgRNA has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0040] In some embodiments, the sgRNA has a nucleotide sequence as shown in SEQ ID NOs: 15-18, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0041] In some embodiments, the substance for inhibiting the KCNK3 gene includes a vector containing the sgRNA.

[0042] In some embodiments, the substance for inhibiting the KCNK3 gene includes a CRISPR / Cas system for knocking out the KCNK3 gene, and the CRISPR / Cas system includes the sgRNA and a Cas protein.

[0043] In some embodiments, the Cas protein includes one or more of Cas9, Cas12, Cas13, and Cas14.

[0044] The application does not include the diagnosis and treatment of diseases.

[0045] According to another aspect of the present disclosure, a method for preparing a cell with inhibited KCNK3 gene expression is provided.

[0046] In some embodiments, the method includes the step of transfecting a cell with the siRNA.

[0047] In some embodiments, the method includes the step of transfecting a cell with a vector containing a nucleic acid molecule encoding the sgRNA.

[0048] In some embodiments, the method includes the step of transfecting a cell with a vector containing a nucleic acid molecule encoding the sgRNA.

[0049] In some embodiments, a gene editing technique is used to prepare a cell with inhibited KCNK3 gene expression, and the gene editing technique includes using gene targeting techniques, CRISPR / Cas9 techniques, zinc finger nuclease techniques, transcription activator-like effector nuclease techniques, or homing endonucleases.

[0050] In some embodiments, the sgRNA targeting sequence in the CRISPR / Cas9 technology has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0051] In some embodiments, the sgRNA has a nucleotide sequence as shown in SEQ ID NOs: 15 to 18, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0052] According to yet another aspect of the present disclosure, there is provided a cell in which the KCNK3 gene is inhibited obtained by the method provided in the present application.

[0053] In some embodiments, the cell is selected from eukaryotic cells.

[0054] In some embodiments, the eukaryotic cell includes mammalian cells.

[0055] In some embodiments, the mammal is selected from the order Primates, order Lagomorpha, order Rodentia, order Artiodactyla, etc.

[0056] In some embodiments, the mammal is selected from humans, monkeys, orangutans, rabbits, mice, rats, hamsters, deer, goats, sheep, cows, pigs, etc.

[0057] In some embodiments, the cell is selected from SVF cells, SK15 cells, CHO cells, CHOK1 cells, 293 cells, 3T6 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, etc.

[0058] According to yet another aspect of the present disclosure, there is provided a substance for inhibiting the expression of the KCNK3 gene, and the substance for inhibiting the KCNK3 gene includes siRNA and / or sgRNA against the KCNK3 gene.

[0059] In some embodiments, the siRNA has a nucleotide sequence as shown in SEQ ID NOs: 3 and 4, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0060] In some embodiments, the 3' end of the siRNA is further modified with 2 to 6 overhanging nucleotides composed of dT, dA, dC, dG or U.

[0061] In some embodiments, the sgRNA is based on CRISPR / Cas9 for gene knockout / knockdown, and the targeting sequence of the sgRNA has a nucleotide sequence as shown in SEQ ID NO: 13 or 14, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0062] In some embodiments, the sgRNA has a nucleotide sequence as shown in SEQ ID NOs: 15 to 18, or a nucleotide sequence that is reverse complementary thereto or has 85% sequence identity therewith.

[0063] In some embodiments, the substance for inhibiting the KCNK3 gene includes the CRISPR / Cas system for knocking out the KCNK3 gene, and the system includes the sgRNA and the Cas protein.

[0064] In some embodiments, the cas protein includes one or more of Cas9, Cas12, Cas13, and Cas14.

[0065] According to another aspect of the present disclosure, there is provided a nucleic acid molecule encoding the siRNA.

[0066] According to another aspect of the present disclosure, there is provided a nucleic acid molecule encoding the sgRNA, or encoding the CRISPR / Cas system.

[0067] According to another aspect of the present disclosure, there is provided a vector containing the nucleic acid molecule.

[0068] According to another aspect of the present disclosure, there is provided a cell containing the substance for inhibiting the KCNK3 gene, the nucleic acid molecule, and / or the vector.

[0069] According to another aspect of the present disclosure, there is provided a pharmaceutical composition including a therapeutically effective amount of the substance for inhibiting the KCNK3 gene and a pharmaceutically acceptable carrier.

[0070] In some embodiments, the pharmaceutical composition is used for a drug for regulating lipid metabolism or regulating ferroptosis, and / or preventing, alleviating, and / or treating obesity and its complications or ferroptosis-related diseases.

[0071] According to another aspect of the present disclosure, there is provided a kit including the substance for inhibiting the KCNK3 gene.

[0072] In some embodiments, the kit is used for detecting the KCNK3 gene.

[0073] In some embodiments, the kit is used for constructing a model cell or animal model of a lipid metabolism disease or a ferroptosis-related disease.

[0074] According to yet another aspect of the present disclosure, there is provided a method for preventing, alleviating, and / or treating obesity and its complications or ferroptosis-related diseases, which comprises administering to a subject a pharmaceutically effective amount of the substance that inhibits the KCNK3 gene or the pharmaceutical composition.

[0075] According to yet another aspect of the present disclosure, there is provided a method for cultivating livestock animals, characterized in that the method comprises administering to the livestock animals an effective dose of the substance that inhibits the KCNK3 gene, the feed, or the feed additive.

[0076] Beneficial effects:

[0077] The present invention for the first time discovers that the KCNK3 gene can inhibit cell ferroptosis and also has the effects of promoting porcine fat synthesis and inhibiting fat hydrolysis. Substances such as siRNA or sgRNA designed against the KCNK3 gene to inhibit the expression of the KCNK3 gene can interfere with the expression of the KCNK3 gene and have important application values in the regulation of porcine fat deposition traits, the breeding of livestock animals with low fat and high lean meat rate, the improvement of feed utilization rate, the regulation of lipid metabolism drugs or the regulation of ferroptosis, the treatment of human obesity and its complications, and ferroptosis-related diseases. Description of the drawings

[0078] Figure 1 Shows the detection of KCNK3 expression levels in the backfat tissues of 1-month-old DLY and Wuzhishan pigs (n = 3). DLY: Duroc × Landrace × Yorkshire pigs, WZS: Wuzhishan pigs.

[0079] Figure 2 Shows the detection of KCNK3 expression levels in different tissues of 1-month-old Wuzhishan pigs (n = 3). IAT: Inguinal subcutaneous adipose tissue; BF: Back adipose tissue; PAT: Perirenal adipose tissue.

[0080] Figure 3 Shows the bar graph of the fluorescence quantitative PCR results of si-KCNK3 knockdown.

[0081] Figure 4 Shows the knockout pattern diagram of the KCNK3 gene.

[0082] Figure 5 Shows the white light images of wild-type (WT) and KCNK3 knockout (KO) Wuzhishan pig SVF cells on the 8th day of induced adipogenic differentiation (scale bar: 100 μm).

[0083] Figure 6 Shows the detection of KCNK3 gene expression levels in wild-type (WT) and KCNK3 knockout (KO) Wuzhishan pig SVF cells.

[0084] Figure 7 Detection of the expression levels of fat thermogenesis marker genes in wild-type (WT) and KCNK3 knockout (KO) Wuzhishan pig SVF cells was shown.

[0085] Figure 8 Detection of the expression of de novo fatty acid synthesis genes in SVF cells with siRNA interference of KCNK3 expression was shown.

[0086] Figure 9 Detection of the KCNK3 gene level in WT and overexpressing cells (OE) was shown.

[0087] Figure 10 White light images of WT and OE cells induced to differentiate into adipocytes for 8 days (scale bar: 50 μm) were shown.

[0088] Figure 11 Bar graphs showing the detection of the expression levels of genes related to fat synthesis and thermogenesis in WT and OE cells were shown.

[0089] Figure 12 Electrophoresis graphs showing the detection of the expression levels of genes related to fat synthesis and thermogenesis in WT and OE cells were shown.

[0090] Figure 13 Results of PCA analysis of WT and KO SVF cells were shown.

[0091] Figure 14 Volcano plots of differentially expressed genes in WT and KO SVF cells were shown.

[0092] Figure 15 Enrichment bubble plots of differentially expressed genes in WT and KO SVF cells were shown.

[0093] Figure 16 Heat maps showing the expression of major genes in the glutathione and fatty acid metabolic pathways were shown.

[0094] Figure 17 Expression levels of genes related to fatty acid synthesis in WT and KO cells were shown.

[0095] Figure 18 Expression levels of genes related to promoting ferroptosis in WT and KO cells were shown.

[0096] Figure 19 Expression levels of genes related to inhibiting ferroptosis in WT and KO cells were shown.

[0097] Figure 20 Results of PCA analysis of WT and KO PK15 cells were shown.

[0098] Figure 21 Volcano plots of differentially expressed lipids in WT and KO PK15 cells were shown.

[0099] Figure 22 Shows the differential lipid VIP enrichment heatmap of WT and KO PK15 cells.

[0100] Figure 23 Shows the results of the abundances of different lipid subclasses in WT and KO PK15 cells.

[0101] Figure 24 Shows the results of the abundances of major lipid classes in WT and KO PK15 cells.

[0102] Figure 25 Shows the results of the PUFA abundances in WT and KO PK15 cells, where PUFA: polyunsaturated fatty acid.

[0103] Figure 26 Shows the fluorescence results of ROS detection in WT and KCNK3 knockout (KO) PK15 cells (scale bar: 100 μm), where the left figure is the cells of the WT group and the right figure is the cells of the KO group.

[0104] Figure 27 Shows the flow cytometry analysis results of ROS detection in WT and KCNK3 knockout (KO) PK15 cells. The left figure is the number of particles, where red represents the cells of the WT group and blue represents the cells of the KO group; the right figure is the histogram of the mean fluorescence density.

[0105] Figure 28 Shows the detection of the expression levels of key ferroptosis genes in WT and KCNK3 knockout (KO) PK15 cells.

[0106] Figure 29 Shows the detection of the expression levels of lipid accumulation-related genes in WT and KCNK3 knockout (KO) PK15 cells.

[0107] Figure 30 Shows the expression levels of genes related to glutathione synthesis (GCLC, GCLM, and GSS) in WT and KCNK3 knockout (KO) PK15 cells.

[0108] Figure 31 Shows the detection of glutathione levels in WT and KCNK3 knockout (KO) PK15 cells; tGSH: total glutathione; GSH: reduced glutathione; GSSG: oxidized glutathione.

[0109] Figure 32 Shows the effect of KCNK3 knockout on the mitochondrial morphology of PK15 cells. The scale bars from left to right are: 5 μm, 2 μm, and 500 nm. Detailed implementation method

[0110] The present disclosure uses combined transcriptome and lipidome analysis and unexpectedly discovers that KCNK3 can inhibit fat metabolism and promote ferroptosis through lipid peroxidation. The present disclosure combines siRNA interference technology, constructs gene knockout and overexpression cell lines using CRISPR / Cas9 technology, and through cell induced differentiation, further demonstrates that KCNK3 deficiency inhibits fatty acid synthesis and accumulation and promotes fat thermogenesis. Therefore, the results of the present disclosure support that the KCNK3 gene has important application value for the molecular regulation of porcine fat traits, fat metabolism, and ferroptosis-related diseases.

[0111] Definitions

[0112] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural and vice versa.

[0113] Unless the context clearly indicates otherwise, the expressions "a" and "an" as used herein include plural referents.

[0114] The expression "about" as used herein is as understood by those of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If those of ordinary skill in the art do not understand the use of this term according to the context in which it is used, "about" will mean up to plus or minus 10% of a particular value.

[0115] As used herein, the term "nucleic acid" refers to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and their synthetic non-naturally occurring analogs) linked by phosphodiester bonds, related naturally occurring structural variants, and their synthetic non-naturally occurring analogs.

[0116] As used herein, the term "fat metabolism" includes fat synthesis and / or hydrolysis metabolism. Specific metabolic processes include, by way of example, lipid digestion, lipid absorption, lipid transport, lipid storage, lipid catabolism, and lipid biosynthesis.

[0117] As used herein, the term "inhibit gene expression" means to reduce or completely abolish the expression of a gene or protein. "Inhibiting" expression means a reduction of at least 10% compared to the normal expression level, such as a reduction of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or more, and including a reduction of 100%. Inhibiting or reducing the expression of a gene or protein can lead to partial or complete loss (inactivation) of its biological activity.

[0118] As used herein, the term "knockout" refers to "gene knockout", which is a technical means or operation process aimed at gene deletion, including but not limited to introducing a DNA fragment that can undergo homologous recombination with the gene sequence to be knocked out, introducing a transposon system, or introducing a gene editing tool into cells by means of infection, transfection, or transformation, etc., to change the genomic sequence; or changing the genomic sequence by irradiation or chemical drugs. For example, the CRISPR / Cas9 nuclease system.

[0119] As used herein, the term "knockdown" refers to "gene knockdown", which is a technical means or operation process aimed at inhibiting gene expression, including but not limited to introducing substances such as nucleic acids or functional proteins into cells by means of infection, transfection, or transformation, etc., to down-regulate the transcription or translation level of the target gene without changing the genomic sequence; or down-regulating the transcription or translation level of the target gene by chemical drugs. For example, RNA interference.

[0120] In the present application, the term "CRISPR / Cas system" generally refers to a group of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule, which can direct and effect the modification of nucleic acids by the RNA-guided nuclease or other effector molecule at a target sequence, such as causing degradation of the target sequence. In certain embodiments, the CRISPR system comprises a gRNA and a Cas protein, for example, the Cas9 protein. A system comprising Cas9 or its functional mutant is referred to as a "Cas9 system" or a "CRISPR / Cas9 system" in the present application. In certain embodiments, the gRNA molecule and the Cas molecule can be complexed to form a ribonucleoprotein (RNP) complex. In the present application, the term "Cas protein" generally refers to the enzyme in the CRISPR / Cas system responsible for cleaving DNA. It can include enzymes from type I, II, and III CRISPR / Cas systems. For example, Cas9, Cas12, Cas13, and Cas14.

[0121] As used herein, the term "single guide RNA (sgRNA)" or "guide RNA (gRNA)" refers to an RNA that comprises a crRNA and a tracrRNA. The sgRNA is designed based on a specific target site on a target gene sequence, and its sequence is sufficient to cooperate with a Cas9 or Cpf1 endonuclease to direct an endonuclease-mediated DNA double-strand break at the target site. The sgRNA generally exists in two forms: a double-stranded form and a single-stranded form. The double-stranded form is composed of a crRNA and a tracrRNA, and needs to be annealed to form a complex, which can be achieved by chemically synthesizing the crRNA and tracrRNA. Single-stranded form: The crRNA and tracrRNA are engineered into a single RNA, which does not require annealing and still has the function of cleaving double-stranded DNA. The sgRNA can be achieved by plasmid, in vitro transcription, or chemical synthesis. Conventional sgRNAs are delivered into cells in the form of plasmids or viruses.

[0122] As used herein, the term "CRISPR / Cas9 system" refers to a genetic engineering tool that includes a guide RNA (gRNA) sequence having a Cas9 binding site and a targeting sequence specifically directed to the region to be modified. Cas9 binds to the gRNA to form a ribonucleoprotein, which binds to and cleaves the target region. CRISPR / Cas9 can cause a permanent loss of a gene by knocking out the gene at the genomic DNA level, resulting in a complete loss or reduction of the function of the target protein. The Cas9 protein generally refers to the enzyme from the bacterial type II CRISPR / Cas system responsible for cleaving DNA. Cas9 can include wild-type proteins and their functional mutants.

[0123] In addition to the CRISPR / Cas 9 platform, which is a type II CRISPR / Cas system, there are other systems, including type I CRISPR / Cas systems, type III CRISPR / Cas systems, and type V CRISPR / Cas systems. A variety of CRISPR / Cas9 systems have been disclosed, including, for example, Streptococcus pyogenes Cas9 (SpCas9), Streptococcus thermophilus Cas9 (StCas9), Campylobacter jejuni Cas9 (CjCas9), and Neisseria cinerea Cas9 (NcCas9). Additional alternative systems of the Cas system include Francisella novicida Cpfl (FnCpfl), Acidaminococcus sp. Cpfl (AsCpfl), and Lachnospiraceae bacterium ND2006 Cpfl (LbCpfl) systems. Any of the above CRISPR systems can be used in the method for generating the cell lines of the present invention.

[0124] As used herein, the term "RNA interference" or "RNAi" refers to a sequence-specific process by which a target molecule (e.g., a target gene, protein, or RNA) is downregulated via the downregulation of expression. Without being bound to a particular mechanism, as currently understood by those skilled in the art, RNAi involves the degradation of RNA molecules such as intracellular mRNA molecules catalyzed by the enzymatic RNA-induced silencing complex (RISC). RNAi (RNA interference) reduces the gene expression level at the post-transcriptional level, does not change the genomic sequence, does not affect the long-term stability of the genome, and the resulting reduction in gene expression level is reversible.

[0125] As used herein, the term "small interfering RNA (siRNA)" refers to a nucleic acid molecule that is double-stranded RNA, is complementary to a portion of the mRNA, and is capable of base pairing. siRNA acts by specifically directing enzymes in the host cell to cleave the target RNA. By virtue of the sequence specificity of the siRNA and its homology to the RNA target, the siRNA can cause cleavage of the target RNA strand, thereby inactivating the target RNA molecule. siRNA is approximately 19-25 nucleotides in length. Such siRNAs can have overhangs (e.g., 3'-overhangs of 1, 2, or 3 nucleotides (or nucleotide analogs)). Such siRNAs can mediate RNA interference.

[0126] As used herein, the term "O2PLS analysis" stands for Two-Way Orthogonal PLS, i.e., Two-Way Orthogonal Partial Least Squares. It is applicable to data mining in complex scenarios and belongs to a type of unsupervised modeling. The O2PLS method can be used to mine the correlation features between different dimensional data of multi-omics.

[0127] As used herein, the term "overhang" refers to a terminal non-base-paired nucleotide at either end of either strand of a double-stranded nucleic acid molecule. That is, a single-stranded region extending beyond the 3' end and / or 5' end of the duplex is called an overhang. In some embodiments, overhang nucleotides composed of deoxyribonucleotides are modified at the ends of siRNAs to protect the siRNAs from enzymatic degradation.

[0128] As used herein, the term "sequence identity" refers to the "percent sequence identity" or "percent sequence identity" between two polynucleotides, i.e., the number of identical matching positions shared by the sequences within a comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for the optimal alignment of the two sequences. A matching position is any position where the same nucleotide is present in both the target sequence and the reference sequence. Since gaps are not nucleotides, gaps present in the target sequence are not counted. Similarly, gaps present in the reference sequence are not counted since nucleotides from the target sequence are counted and nucleotides from the reference sequence are not. At least 85% sequence identity includes continuous segments having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity over the full length of the sequence.

[0129] The percent sequence identity can be calculated by the following process: Determine the number of positions in which the same amino acid residue or nucleic acid base occurs in both of two sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percent sequence identity. The comparison of sequences and the determination of the percent sequence identity between two sequences can be accomplished using software readily available for online use and download. Suitable software programs are available from a variety of sources for alignment of protein and nucleotide sequences. A suitable program for determining the percent sequence identity is bl2seq, which is part of the BLAST program suite available from the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses the BLASTN or BLASTP algorithm for comparison between two sequences. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are also available at www.ebi.ac.uk / Tools / psa.

[0130] As used herein, the components of the term "pharmaceutically acceptable carrier" refer to substances that are suitable for use in humans and / or animals without undue adverse side effects (such as toxicity, irritation, and allergic response), i.e., having a reasonable benefit / risk ratio. Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween), wetting agents (such as sodium lauryl sulfate), buffering agents, chelating agents, thickening agents, pH regulators, transdermal enhancers, coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, bacteriostatic agents, delivery agents (such as liposomes, nanoparticles, etc.), pyrogen-free water, and the like.

[0131] As used herein, the term "pharmaceutical composition" can be in any dosage form, for example, including but not limited to tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, injections, sprays, aerosols, powder inhalations, lotions, liniments, ointments, plasters, pastes, patches, eye drops, nose drops, suppositories, and the like.

[0132] The pharmaceutical compositions of the present disclosure can be administered in a pharmaceutically effective amount. A "pharmaceutically effective amount" means an amount that is sufficient to treat a disease and that is applied at a reasonable benefit / risk ratio suitable for any medical treatment. The effective dose level of the composition can be determined based on the type of subject, the severity of the disease, the age and gender of the subject, the drug activity, the sensitivity to the drug, the time of administration, the route of administration, the excretion rate, the treatment time, the drugs used in combination with the composition, and other known factors in the medical field. The compositions of the present disclosure can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The composition can be administered in one or more dosage forms.

[0133] As used herein, the term "effective dose" means a dose sufficient to improve the performance of a breeding animal without causing any significant adverse side effects.

[0134] As used herein, the term "treating" a subject's disease or "treating" a subject suffering from or suspected of suffering from a disease means administering a drug treatment to the subject, such as administering one or more agents, so as to reduce or prevent the worsening of at least one symptom of the disease. Thus, in some embodiments, "treating" particularly refers to delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing the efficacy of alternative therapies or reducing resistance to alternative therapies, or combinations thereof.

[0135] As used herein, the term "preventing" is well recognized in the art and, when used in connection with conditions such as local recurrence, is well known in the art and includes administering a composition that reduces the occurrence or delays the onset of symptoms of a medical condition in a subject relative to a subject who has not received the composition.

[0136] As used herein, the term "subject" refers to any animal, mammal, or human. The subject has, may have, or is suspected of having one or more diseases. In some embodiments, the subject is a human, monkey, chimpanzee, rabbit, mouse, rat, hamster, deer, goat, sheep, cow, pig, etc.

[0137] The drugs according to the present invention can exist in various forms. Such forms include, but are not limited to, liquid, semi-solid and solid pharmaceutical forms, where the liquid includes, but is not limited to, dispersion or suspension; the semi-solid and solid include, but are not limited to, lozenges, pills, powders, liposomes and suppositories. The preferred form depends on the intended mode of administration and therapeutic application. For the purpose of making the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. The actual protection scope of the present invention is set forth in the claims. In the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies have also been described in many publications. The equipment, instruments, reagents and / or kits used in the following embodiments that are not mentioned as to their sources are all obtained through commercial purchase in the market or obtained by conventional methods known to those skilled in the art. Example

[0138] Example 1. Tissue expression profile of KCNK3 gene

[0139] (1) Three healthy male Duroc×Landrace×Yorkshire (DLY) pigs and three Wuzhishan pigs at 28 days of age were selected. After slaughter, subcutaneous back fat tissues were collected. In addition, inguinal subcutaneous adipose tissue (IAT), back fat (BF), perirenal adipose tissue (PAT), heart, liver, spleen, lung, kidney, longissimus dorsi muscle, leg muscle, jejunum and ileum tissues of Wuzhishan pigs were also collected. After being snap-frozen in liquid nitrogen, they were stored at -80 °C.

[0140] (2) Total RNA of tissues was extracted according to the instructions of RNAiso Plus (9109) of Takara Company. According to the operation instructions of the reverse transcription kit (RR092S) and qPCR quantification reagent (RR42LR) of Takara Company, cDNA was obtained by reverse transcription, and qPCR was carried out to detect the expression levels of KCNK3 gene in different pig breeds and different tissues of Wuzhishan pigs. The primer sequences used for qPCR are shown in Table 1, and 18s RNA was used as a control.

[0141] As Figure 1 and 2 shown, the expression level of KCNK3 is higher in fat-type pigs (Wuzhishan pigs, WZS) ( Figure 1 ), and the expression level in adipose tissues of Wuzhishan pigs is much higher than that in other tissues ( Figure 2 ).

[0142]

[0143] Example 2. Screening of siRNAs for knocking down the KCNK3 gene (KD)

[0144] (1) Five pairs of siRNA sequences, Si-KCNK3-1, Si-KCNK3-2, Si-KCNK3-3, Si-KCNK3-4, and Si-KCNK3-5, were designed and screened based on the mRNA sequence of the KCNK3 gene (Genebank ID: 100737895). Each siRNA carried two deoxythymidine nucleotides (dT) at its 3' end, along with a negative control sequence Si-NC (synthesized by Beijing Tianyi Huiyuan Company), as shown in Table 2;

[0145] (2) Fresh inguinal subcutaneous white adipose tissue from Wuzhishan pigs was cut, washed with DPBS containing 5% penicillin / streptomycin, minced, digested in Dulbecco Hanks balanced salt solution containing 2 mg / ml type I collagenase at 37 °C for 60 min, filtered through a 70 μm cell strainer, centrifuged at 1500 r / min for 10 min, and the cell pellet was resuspended in high-glucose DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S). The cells were maintained in a 37 °C incubator with 5% CO2. The obtained cells were porcine stromal vascular fraction (SVF) cells.

[0146] (3) The stromal vascular fraction (SVF) cells obtained in step (2) were seeded into a 12-well cell culture plate at 1×10 5 cells per well. When the cells reached 70 - 80% confluence, the medium was aspirated, and 875 μL of complete DMEM medium was added to each well, and then placed in the cell culture incubator;

[0147] (4) The interference reagents were prepared according to the number of cells to be treated in the cell culture plate. Solution A: Add 62.5 μL of Opti-MEM™ medium and 2.5 μL of siRNA or negative control to each well; Solution B: Add 62.5 μL of OPTI and 2.5 μL of Lipofectamine™ 3000 transfection reagent (ThermoFisher Scientific) to each well. Solution A and Solution B were mixed separately and allowed to stand at room temperature for 5 min;

[0148] (5) Solution B was added to Solution A and mixed thoroughly, and incubated at room temperature for 15 min;

[0149] (6) The above mixture was slowly added to the cell culture plate at 125 μL per well, and the medium and interference reagent in the cell culture plate were gently mixed, and then placed in the cell culture incubator;

[0150] After 72 h of transfection, cell RNA was collected and reverse transcription and fluorescence quantitative PCR were performed according to the method of Example 1.

[0151] The results were as Figure 3 shown. The relative expression level of KCNK3 after treatment with Si-KCNK3-1 was the lowest, and Si-KCNK3-1 was selected for RNAi experiments in subsequent experiments.

[0152]

[0153] Example 3. Obtaining KCNK3 knockout (KO) Wuzhishan pig SVF cells using the Cas9 / gRNA technology to detect the effects of KCNK3 deficiency on fat synthesis and thermogenesis

[0154] (1) The Cas9 / gRNA vector was designed using the online tool CRISPR Design Tool (https: / / crispor.gi.ucsc.edu). Two gRNA sequences with the highest scores were selected near ATG. The sgRNA1 targeting sequence was GGCGAAGCGCCACTGCACGC (5'-3', SEQ ID NO: 13) and the sgRNA2 targeting sequence was CGGAGATGATCGAGCGGCAG (5'-3', SEQ ID NO: 14). SEQ ID NOs: 15 to 18 were designed based on these two sequences as shown in Table 3. After annealing into double strands, they were ligated to the pCRISPR-sg6 vector backbone (Xu C et al., piggyBac mediates efficient invivo CRISPR library screening for tumorigenesis in mice. Proc Natl Acad Sci USA. 2017 Jan 24;114(4):722-727). The gene knockout vector was obtained and cloned with Lonza The 2b cell nuclear transfection instrument (program: A-024) co-transfected two gRNA plasmids (2 μg each) and 1 μg Cas9 expression vector (pM3-Cas9, reference: Lu H et al. A HIT-trapping strategy for rapid generation of reversible and conditional allelesusing a universal donor. Genome Res. 2021 May;31(5):900-909.) into the porcine vascular stromal cells (SVF) obtained in step (1). 24-48 hours after transfection, positive cells were selected with 2 μg / mL puromycin to obtain porcine SVF cells with KCNK3 gene knockout.

[0155] Figure 4 The knockout pattern of the KCNK3 gene is exemplified.

[0156]

[0157] (2) Cultivate the stromal vascular fraction (SVF) cells of Wuzhishan pigs according to step (2) of Example 2. After the cells grow to confluence, contact inhibition is carried out for 2 days and then induction of differentiation begins: Add 20 mM HEPES (pH 7.4), 5 μg / mL insulin, 17 μM pantothenate, 33 μM biotin, 1 μM dexamethasone, 0.25 mM isobutylmethylxanthine (IBMX), and 50 mM rosiglitazone to the basal medium (DMEM high-glucose medium + 1% PS, 10% FBS). After 5 days, half of the medium is changed to the maturation medium. The maturation medium is the differentiation medium without IBMX and rosiglitazone. On the 8th day of induced differentiation, the observation results are as Figure 5 shown. The lipid droplets of the SVF cells with KCNK3 knockout are significantly reduced, demonstrating that KCNK3 knockout inhibits the adipogenic differentiation of SVF cells.

[0158] Example 4. Effects of knockdown or knockout of KCNK3 gene on the expression of adipogenic differentiation-related genes in SVF cells

[0159] Perform qPCR detection on the relevant genes according to the method in step (2) of Example 1. The primers used are shown in Table 4. The results are as Figures 6 - 8 shown. Using the Cas9 / gRNA technology to knockout the KCNK3 gene (KO) can inhibit the expression of KCNK3 ( Figure 6 ), promote the expression of thermogenic genes PGC1A and CD137 ( Figure 7 ), and using Si-KCNK3-1 to knockdown the KCNK3 gene (KD) can reduce the expression of de novo fatty acid synthesis genes FABP 4, CEBPA , SREBP1C , ACC , FASN , ACLY and SCD ( Figure 8 ).

[0160]

[0161] Example 5. Effects of overexpressing KCNK3 on fat synthesis and thermogenesis in Wuzhishan pig SVF cells

[0162] (1) Using the cDNA of Wuzhishan pig SVF cells prepared in step (2) of Example 2 as a template, the CDS region of the KCNK3 gene was amplified, and the primer sequences used are shown in Table 5. The CDS region and polyA tail of the KCNK3 gene were ligated to the digested pPB-EF1α-Flag vector backbone (Addgene, #212646) using a seamless cloning kit to obtain a KCNK3 overexpression vector with a Flag tag (pPB-EF1α-KCNK3-Flag). The KCNK3 overexpression vector was transfected into the above-mentioned Wuzhishan pig SVF cells using a Lonza 2b nucleofector. After 24-48 h of transfection, positive cell clones were screened with 2 μg / mL puromycin to obtain porcine preadipocytes overexpressing the KCNK3 gene.

[0163]

[0164] (2) Referring to step (2) of Example 1, the expression of the KCNK3 gene was detected.

[0165] And the expression level of the KCNK3 protein was detected by Western blot, including the following steps:

[0166] (2.1) Total cell protein extraction was performed according to the instructions of the cell protein extraction kit from Sangon Biotech.

[0167] (2.1.1) The supernatant of the cells in the 12-well plate was aspirated, and the cells were washed twice with pre-cooled DPBS. 200 μL of pre-cooled DPBS was added to each well, and the cells were scraped off with a cell scraper and placed in a 1.5 mL centrifuge tube. The cells were centrifuged at 500 g for 5 min at 4°C, and the cell pellet was collected and placed on ice;

[0168] (2.1.2) 5 μl of phosphatase inhibitor, 1 μl of protease inhibitor, and 10 μl of PMSF were sequentially added to each 1 mL of pre-cooled Lysis Buffer and mixed well. It was pre-cooled on ice for later use;

[0169] (2.1.3) 100 μl of the prepared Lysis Buffer was added to each centrifuge tube containing cells, and the tubes were placed on a shaker platform at 4°C and shaken at medium speed (100-150 rpm) for 30 min-1 h;

[0170] (2.1.4) The cells were centrifuged at 14000 rpm for 15 min at 4°C, and the supernatant was taken as the total protein extract. The total protein extract was aliquoted and stored at -70°C for protein quantification and other protein-related experiments, avoiding repeated freeze-thaw cycles;

[0171] (2.2) Protein concentration determination: The cell protein concentration was determined according to the instructions of the BCA protein concentration detection kit from Beyotime.

[0172] (2.3) Incubate the membrane with the primary antibody, and wash off the excess primary antibody with PBST, 10 min each time, wash 3 times, and then hybridize with the secondary antibody: Dilute the secondary antibody with the PBST working solution according to the instruction manual, add it to the incubation box containing the membrane, incubate at room temperature on a horizontal shaker for 40 - 60 min, expose the protein bands with the Tanon-5200 fully automatic chemiluminescence imaging system after development and save the results.

[0173] The results verified the successful overexpression of the KCNK3 gene at both the mRNA and protein levels ( Figure 9 ).

[0174] (3) After the cells reached confluence, contact inhibition was carried out for 2 days and then induction of differentiation began, referring to step (2) in Example 3. After 8 days of induced differentiation, RNA and protein samples were collected, and the expression levels of genes related to fat synthesis and hydrolysis were detected at the mRNA and protein levels. The results showed that overexpression of KCNK3 promoted adipogenic differentiation of SVF cells ( Figure 10 ), promoted the expression of adipogenic differentiation gene PPARG and de novo fatty acid synthesis gene ACC1, and inhibited the expression of fat hydrolysis and thermogenesis genes CPT1A, PRDM16, and PGC-1α genes ( Figures 11 - 12 ).

[0175] Information of the antibodies used: Anti-ACC1 antibody (dilution ratio 1:5000, Proteintech), anti-PGC-1α antibody (dilution ratio 1:2000, Abcam), anti-α-TUBULIN antibody (dilution ratio 1:2000, Proteintech), FLAG (dilution ratio 1:2000, Abmart); Goat anti-rabbit secondary antibody (dilution ratio 1:5000, Proteintech), Rabbit anti-goat secondary antibody (dilution ratio 1:5000, Proteintech), Goat anti-mouse secondary antibody (dilution ratio 1:5000, Proteintech).

[0176] Example 6. Transcriptome differential analysis of SVF cells from Wuzhishan pigs

[0177] In this example, transcriptome sequencing was performed on the WT and KO SVF cells obtained in Example 3, with 3 replicates in each group. 932 up-regulated genes and 1036 down-regulated genes were screened in the KO group ( Figures 13 - 14 ). Enrichment analysis of the differential genes found that they were mainly enriched in biological processes such as fat hydrolysis regulation, Wnt signaling pathway, cAMP signaling pathway, MAPK signaling pathway, P13K-Akt signaling pathway, etc. In addition, metabolic pathways related to ferroptosis such as p53 signaling pathway, HIF-1 signaling pathway, glutathione metabolism, and ferroptosis were also enriched ( Figure 15). The results of the gene heatmap showed that the key genes of glutathione metabolism and fatty acid metabolism were significantly downregulated ( Figure 16 ). The analysis of RNA-seq results showed that the genes for de novo fatty acid synthesis in the KO group of cells, such as CEBPA , FABP 4, ACC , FASN and SCD were significantly downregulated ( Figure 17 ); the genes promoting ferroptosis, such as PRNP, FTL, HMOX1, TP 53 and CP were significantly upregulated ( Figure 18 ); the genes inhibiting ferroptosis, such as GPX 4 , ATF 4 , SLC 39 A 14 , STEP 3 , SLC7A 11 and SLC 40 A 1 were significantly downregulated ( Figure 19 ).

[0178] The results showed that the knockout of KCNK3 inhibited lipid synthesis, promoted lipolysis and ferroptosis in SVF cells.

[0179] Example 7. Results of lipidomics analysis of PK15 cells

[0180] The PK15 cell line preserved in the laboratory was resuscitated and cultured in a DMEM high-glucose medium (containing 1% P / S and 10% FBS) in a 37 °C incubator with 5% CO2. Referring to the method in Example 3, KO PK15 cells were obtained. In this example, PK15 cells in the WT and KO groups, with 6 replicates in each group, were analyzed by LC-MS / MS using the Thermo Fisher Scientific's ultra-high performance liquid chromatography tandem Fourier transform mass spectrometry UHPLC-Q Exactive HF-X system. A total of 642 differential lipids were screened, among which 412 lipids were upregulated and 230 lipids were downregulated in the KO group ( Figures 20 - 21 ). The results of the VIP heatmap and lipid abundance map showed that the downregulated lipids in the KO group were mainly dihexosyl-ceramides (Hex2Cer) and Monogalactosyl diglyceride (MGDG), and the total TG (triglyceride) was significantly increased. Except for the decreased abundance of Sphingolipids (SP), the abundances of Fatty acids (FA), Sterol Lipids (ST), Glycerolipids (GL), and Glycerophospholipids (GP) were all significantly increased (Figures 22 - 24 ). In addition, the abundance of polyunsaturated fatty acids (PUFAs) increased significantly ( Figure 25 ).

[0181] The above results showed that after KCNK3 knockout, the abundances of lipids TG and PUFAs that promote ferroptosis increased significantly, indicating that the sensitivity of cells to ferroptosis increased after KCNK3 knockout.

[0182] The results of transcriptome and lipidome analyses showed that the KCNK3 gene mainly affects biological processes related to lipid metabolism and ferroptosis.

[0183] Example 8. Verification of KCNK3 knockout promoting ferroptosis in PK15 cells

[0184] (1) Cell ROS detection was performed according to the instructions of the Beyotime Reactive Oxygen Species Assay Kit (S0033S). One day in advance, PK15 cells in the WT and KO groups were seeded in 12-well plates at 5×10 5 cells / well. Before detection, the cell culture medium was discarded, and the cells were washed 3 times with pre-warmed DPBS at 37°C. DCFH-DA was diluted 1:1000 with serum-free culture medium to a final concentration of 10 μmol / L. 500 μL of the diluted ROS indicator DCFH-DA was added to each well. The cells were incubated in a cell culture incubator at 37°C for 20 minutes. The cells were washed 3 times with serum-free cell culture medium for fluorescence photography and flow cytometry analysis ( Figures 26 - 27 ). The results showed that the ROS level in cells increased significantly after KCNK3 knockout.

[0185] (2) Referring to the method in step (2) of Example 1, cells were collected to extract RNA, and the expression levels of genes related to ferroptosis and de novo fatty acid synthesis were detected by qPCR. The primer sequences used are shown in Tables 4 (partial) and 6. The results showed that the expression levels of ferroptosis inhibitors ( GPX4, NRF2 and TF ), de novo fatty acid synthesis genes ( SREBP1C, ACC, FASN and SCD ), and genes related to glutathione synthesis ( GCLC , GCLM and GSS ) in KCNK3 knockout cells all decreased, and the ferroptosis promoter COX7A 1 was significantly upregulated ( Figures 28 - 30 ).

[0186]

[0187] (3)According to the instructions of the GSH and GSSG Detection Kit (S0053) from Beyotime, the glutathione level in cells was detected and corrected with the protein concentration of the cells. The results showed that the levels of total glutathione (tGSH), reduced glutathione (GSH), and oxidized glutathione (GSSG) in cells decreased significantly after KCNK3 knockout ( Figure 31 ).

[0188] (4)Transmission electron microscopy analysis was performed on WT and KO cells. The WT and KO cells grown to confluence in a 10 cm dish were washed 3 times with DPBS preheated to 37 °C, 1 mL of 2.5% glutaraldehyde was added, and the cells were incubated in the dark at room temperature for 30 min. The cells were gently scraped off with a cell scraper, placed in a 1.5 ml centrifuge tube, centrifuged at 3000 rpm for 5 min, resuspended with 1 mL of fresh 2.5% glutaraldehyde, left at room temperature for 30 min, stored in the dark at 4 °C, and sent to the company for testing within 1 week. The results showed that the cell membrane of KCNK3 knockout cells was broken, and the mitochondria were deformed, swollen, and ruptured ( Figure 32 ).

[0189] Figures 26 - 32 The results showed that after KCNK3 knockout, the generation of glutathione was reduced through lipid peroxidation, thereby promoting ferroptosis in cells.

[0190] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention. The technical solutions of the present invention are not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solutions of the present invention falls within the protection scope of the present invention.

Claims

1. Use of a substance that inhibits the expression of the KCNK3 gene in the preparation of a reagent for promoting ferroptosis of mammalian cells, The Genbank ID of the KCNK3 gene is 100737895; the substance that inhibits the KCNK3 gene includes siRNA and sgRNA targeting KCNK3; The nucleotide sequences of the siRNA are shown in SEQ ID NO: 3 and 4; The sgRNA and the Cas9 protein are used together for gene knockout, and the nucleotide sequence of the targeting sequence of the sgRNA is shown in SEQ ID NO: 13 or 14.

2. A method for preparing mammalian cells with inhibited KCNK3 gene expression, the method comprising the step of transfecting cells with siRNA, and the nucleotide sequences of the siRNA are shown in SEQ ID NO: 3 and 4.

Images