ULK1 Gene SNP Molecular Marker Related to Muscovy Duck Reproductive Traits and Its Application

The identification of the reproductive traits of the ULK1 gene SNP molecular marker has solved the problem of breeding performance in the breeding of the ULK1 duck, and achieved accurate identification of the start-up date and improvement of the breeding effect.

CN119372338BActive Publication Date: 2025-08-01ANIMAL SCI RES INST GUANGDONG ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411820349.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-11
Publication Date
2025-08-01
Estimated Expiration
2044-12-11

AI Technical Summary

Technical Problem

At this stage, the breeding progress of Muslim ducks is backward, the breeding performance is difficult to select and breed, and the heritability of reproductive traits is low, making it difficult to improve Muslim duck egg production productivity.

Method used

Provide SNP molecular markers of the ULK1 gene, and amplify and analyze mutations in the 869761 site of the fourth intron of the ULK1 gene, identify the reproductive traits of the duck, especially the birth age, and provide scientific basis to guide breeding.

Benefits of technology

Through the application of SNP molecular marker of ULK1 gene, the breeding traits of the duck are accurately identified, especially the birth age, and the accuracy of seed selection and breeding effect are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372338B_ABST
    Figure CN119372338B_ABST
Patent Text Reader

Abstract

The present invention discloses a ULK1 gene SNP molecular marker related to the reproductive traits of muscovy ducks and its application, belonging to the field of molecular biotechnology. This ULK1 gene SNP molecular marker is located at the 869761 site of the fourth intron of the ULK1 gene on chromosome 16 of muscovy ducks, with a G>A mutation. Through experiments, it was found that the ULK1 gene SNP molecular marker is significantly related to the reproductive traits of muscovy ducks, more specifically, significantly related to the age at first laying of muscovy ducks. Using the ULK1 gene SNP molecular marker of the present invention can assist in breeding muscovy duck strains with excellent reproductive traits, providing a scientific basis for the breeding of muscovy ducks.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, in particular to a ULK1 gene SNP molecular marker related to the reproductive traits of Muscovy ducks and an application thereof. Background Art

[0002] Native to the tropical regions of Central and South America, Muscovy ducks, also known as knob-headed ducks, barnacle ducks, Western ducks, fragrant ducks, and musk ducks, are a primary duck breed raised in southern China. Muscovy ducks are a superior lean-meat duck breed, characterized by thin skin, tender meat, rapid growth, tolerance to roughage, and excellent egg production. Duck eggs are highly sought after by consumers because they contain a variety of nutrients that promote human health and enhance immunity. Traits such as age at first laying are key indicators for identifying the reproductive performance of Muscovy ducks. However, current Muscovy duck breeding is lagging behind, making selection for reproductive performance difficult, which severely restricts the duck's egg-laying productivity. Reproductive traits have low heritability, making it difficult to make significant progress in current trait-based breeding.

[0003] Single nucleotide polymorphisms (SNPs) are common heritable variations in animals, widely present in animal genomes and accounting for over 90% of all known polymorphisms. SNPs are characterized by stable inheritance and ease of detection, making them useful in molecular marker-assisted selection (MAS), improving selection accuracy and breeding effectiveness.

[0004] UNC-51-like kinase (UNC-51like autophagy activating kinase 1, ULK1), one of the serine / threonine kinases, is an important regulatory factor in biology and has a regulatory effect on various life processes. ULK1 has been found to be an indispensable component of autophagic vesicles and the main regulator of the autophagy initiation step, and is crucial for maintaining the balance of the intracellular environment. Studies have found that autophagy in ovarian granulosa cells is an important cause of follicular atresia and decreased fertility in laying birds. Currently, there are few reports on the regulatory effect of the ULK1 gene on the reproductive traits of laying birds. The present invention provides a new SNP molecular marker in combination with the reproductive performance indicators of Muscovy ducks. Summary of the Invention

[0005] The purpose of the present invention is to provide the field of molecular biotechnology, in particular, to provide a SNP molecular marker of the ULK1 gene related to the reproductive traits of Muscovy ducks and its application, so as to solve the problems existing in the above-mentioned prior art. The SNP molecular marker is significantly correlated with the reproductive traits of Muscovy ducks, especially the age at first laying, providing a new molecular marker for the breeding of Muscovy ducks for reproductive traits.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a ULK1 gene SNP molecular marker related to the reproductive traits of muscovy ducks. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, and there is a G>A mutation at the 101st position of the sequence shown in SEQ ID NO: 1.

[0008] Preferably, the genotypes of the mutation sites of the SNP molecular marker are GG, GA, and AA.

[0009] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO: 2-3.

[0010] The present invention also provides a kit for identifying the reproductive traits of muscovy ducks, including the primer pair.

[0011] The present invention also provides a method for identifying the reproductive traits of muscovy ducks, including amplifying the SNP molecular marker, analyzing the genotype of the mutation site of the SNP molecular marker according to the amplification result, and analyzing the reproductive traits of muscovy ducks according to the genotype. The nucleotide sequences of the primer pair used for amplification are as shown in SEQ ID NO: 2-3.

[0012] Preferably, the reproductive trait of the muscovy duck is the age at first egg.

[0013] Preferably, the age at first egg of muscovy duck individuals with the genotype GG at the mutation site of the SNP molecular marker is less than that of muscovy duck individuals with the genotypes GA and AA.

[0014] The present invention also provides the application of the SNP molecular marker in the breeding of muscovy duck reproductive traits.

[0015] The present invention also provides the application of the primer pair in the preparation of a kit for identifying the reproductive traits of muscovy ducks.

[0016] Preferably, the reproductive trait of the muscovy duck is the age at first egg of muscovy duck.

[0017] The present invention discloses the following technical effects:

[0018] By analyzing the ULK1 gene, the present invention found that the locus at 869761 on the fourth intron of this gene (i.e., the 101st position of the sequence shown in SEQ ID NO: 1) is significantly correlated with the reproductive traits of Muscovy ducks, providing a new SNP molecular marker for MAS. Through experimental verification, it was found that this SNP molecular marker (g.869761G>A) is significantly correlated with the age at first laying of Muscovy ducks (p<0.05). Among them, the age at first laying of individuals with the wild homozygous genotype GG is less than that of individuals with the AA mutant homozygous genotype and GA heterozygous genotype (p<0.05), but there is no significant difference between AA and GA (p>0.05). The SNP molecular marker provided by the present invention can accurately identify the reproductive traits of Muscovy ducks, thereby providing a scientific basis for the breeding of Muscovy ducks. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0020] Figure 1 It is a genotyping map of SNP sites in the ULK1 gene sequence. DETAILED DESCRIPTION OF THE INVENTION

[0021] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation methods of the present invention.

[0022] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0023] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0024] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0025] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0026] Example 1

[0027] 1. Materials and Methods

[0028] 1.1 Animal samples

[0029] The experimental animals were 484 female Muscovy ducks aged 65 weeks (Guangdong Wenshi Southern Poultry Breeding Co., Ltd.). Two milliliters of subcutaneous venous blood was collected and stored at -80°C for DNA extraction. Reproductive traits, including age at first laying, egg production at 58 weeks, number of eggs laid at 58 weeks, number of eggs laid at 65 weeks, and number of eggs laid at 65 weeks, were also recorded.

[0030] 1.2 Main Reagents

[0031] Animal genomic DNA extraction kit (brand: Qingke; product number: TSP201-50; Beijing Qingke Biotechnology Co., Ltd.), 2×Es Taq MasterMix (Dye) (brand: Kangwei, product number: CW0690M, Kangwei Century Biotechnology Co., Ltd.); DNA marker (brand: Novezan, product number: MD101, Jiangsu Novezan Biotechnology Co., Ltd.); high-purity low-electrosmotic agarose (brand: Qingke, product number: TSJ001, Beijing Qingke Biotechnology Co., Ltd.).

[0032] 1.3 Experimental methods

[0033] 1.3.1 Primer design

[0034] Primers were designed using the NCBI Primer-BLAST tool based on the ULK1 gene (ENSCMMG00000006476) from the Muscovy duck (domestic) genome (GCA_009194515.1) published by Ensembl. Primers were synthesized by Guangzhou Qingke Biotechnology Co., Ltd. The primer sequences are shown in Table 1.

[0035] Table 1 PCR amplification primer sequences

[0036]

[0037] 1.3.2 Blood sample DNA extraction

[0038] Extract the blood sample DNA with reference to the operation manual of the blood sample DNA extraction kit.

[0039] 1.3.3 PCR amplification of the ULK1 gene intron sequence

[0040] Use the genomic DNA of the above 484 Muscovy duck blood samples as the PCR template. The amplification system: 2×Es TaqMasterMix 25 μL, ULK1-SNP-F 2 μL, ULK1-SNP-R 2 μL, template DNA 2 μL, ddH2O Up to 50 μL. Reaction program: Pre-denaturation at 94 °C for 2 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, 34 cycles; final extension at 72 °C for 3 min; store at 4 °C.

[0041] 1.3.4 SNP determination and genotyping

[0042] Use the SeqMan tool in the DNAstar software to analyze the sequence peak map of the Sanger sequencing results of the PCR products to determine potential SNP sites, and compare the sequencing data of each sample through this tool for genotyping.

[0043] '1.3.5 Association analysis of SNP genotypes and Muscovy duck reproductive traits

[0044] For the reproductive trait data of Muscovy duck individuals corresponding to the SNP sites and genotypes, use the GLM program (General Linear Models Procedure) of the SAS software to conduct an association analysis between SNPs and Muscovy duck reproductive traits.

[0045] 2. Results

[0046] 2.1 PCR amplification of the ULK1 gene intron sequence and SNP screening

[0047] Select 484 Muscovy duck individuals, use the blood sample DNA of each individual as the template for PCR amplification, obtain the PCR products (the amplified nucleotide sequence is shown in SEQ ID NO: 1) for Sanger sequencing, and compare and analyze the sequenced peak maps. A total of one SNP site, g.869761G>A, was detected. This SNP site is located at position 869761 in the fourth intron of the ULK1 gene on chromosome 16 of Muscovy duck, and this SNP site corresponds to the 101st position of the sequence shown in SEQ ID NO: 1. The comparison result after Sanger sequencing is as Figure 1 shown.

[0048] The sequence of SEQ ID NO: 1 is as follows

[0049] GGGCGACACGGGCAGACTACAGCACCCAGAAGGCACCGCGACCAGGCTGCACCGTGCTGCGGGTGACGTGGGGCCGCCCAAACCAATCCATGCAGAAGGA G GAATGTCAACAAACACGGGCCTCGTGACACCAGGGACACGGCAGGCAGCCCCCCGGCACGGGACCAGTGGCTACCAGGGTCTGGCATGGGGTCCTGGGCC。

[0050] Note: The base "G" underlined in the above sequence is the mutation site.

[0051] 2.2 Association analysis of SNP sites in the ULK1 intron sequence with the reproductive traits of Muscovy ducks

[0052] The above SNP sites were subjected to association analysis with the reproductive traits of Muscovy ducks (age at first laying, number of eggs laid at 58 weeks, number of qualified eggs laid at 58 weeks, number of eggs laid at 65 weeks, and number of qualified eggs laid at 65 weeks). The results are shown in Table 1.

[0053] The molecular marker g.869761G>A was significantly associated with the age at first laying of Muscovy ducks (p<0.05). Among them, the age at first laying of individuals with the wild homozygous genotype GG was less than that of individuals with the AA mutant homozygous genotype and the GA heterozygous genotype (p<0.05), but there was no significant difference between AA and GA (p>0.05).

[0054] Table 1 Association results of SNP sites in the ULK1 gene intron with the reproductive traits of Muscovy ducks

[0055]

[0056] Note: Different lowercase letters in the superscript of the same row of data indicate significant differences (P<0.05).

[0057] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker of the ULK1 gene related to the reproductive traits of muscovy ducks, characterized in that, The nucleotides of the SNP molecular marker are as shown in SEQ ID NO: 1, and there is a G>A mutation at the 101st position of the sequence shown in SEQ ID NO: 1; The genotypes of the mutation sites of the SNP molecular marker are GG, GA, and AA; The Muscovy duck reproductive trait is the age at first egg of Muscovy ducks.

2. A primer pair for amplifying the SNP molecular marker described in claim 1, characterized in that, The nucleotide sequences of the primer pair are as shown in SEQ ID NO: 2-3.

3. A kit for identifying the reproductive traits of muscovy ducks, characterized in that, It includes the primer pair described in claim 2; the Muscovy duck reproductive trait is the age at first egg of Muscovy ducks.

4. A method for identifying the reproductive traits of muscovy ducks, characterized in that, It includes the steps of amplifying the SNP molecular marker described in claim 1, analyzing the genotype of the mutation site of the SNP molecular marker according to the amplification result, and analyzing the Muscovy duck reproductive trait according to the genotype, wherein the nucleotide sequences of the primer pair used for amplification are as shown in SEQ ID NO: 2-3; The Muscovy duck reproductive trait is the age at first egg; The age at first egg of Muscovy duck individuals with the genotype GG at the mutation site of the SNP molecular marker is less than that of Muscovy duck individuals with the genotypes GA and AA.

5. Use of the SNP molecular marker according to claim 1 in the breeding trait selection of muscovy ducks, characterized in that, The Muscovy duck reproductive trait is the age at first egg of Muscovy ducks.

6. Use of the primer pair according to claim 2 in the preparation of a kit for identifying the reproductive traits of muscovy ducks, characterized in that, The Muscovy duck reproductive trait is the age at first egg of Muscovy ducks.

Citation Information

Patent Citations

  • Modulation of LC3-associated endocytosis pathway and genetically modified non-human animals as a model of neuroinflammation and neurodegeneration

    US20220104468A1

  • Crispr-associated mu transposase systems

    US20220298501A1