Reverse genetic operating system of fowl adenovirus type 4 and application of reverse genetic operating system

Abstract

The invention discloses a reverse genetic operating system of fowl adenovirus type 4 and application of the reverse genetic operating system. Belongs to the technical field of virus genetic manipulation. The FAdV-4 full-length genome is amplified in a segmented mode through a PCR method, segmented amplification products are cloned to pOK-CMV vectors through the homologous recombination technology, four library plasmids covering the whole gene are successfully obtained, and LMH cells are transfected to successfully rescue the virus. Meanwhile, the reporter gene NanoLuc is inserted into the FAdV-4 genome, so that the recombinant FAdV-4 for expressing the NanoLuc is successfully rescued. The invention provides an efficient technical platform for deep development of foundation and application research of FAdV-4, and has important scientific application value.

Description

Technical Field

[0001] The present invention relates to the technical field of virus genetic manipulation, and more particularly to a reverse genetic manipulation system of avian adenovirus type 4 and its application. Background Art

[0002] Fowladenovirus type 4 (FAdV-4) belongs to the genus Aviadenovirus of the family Adenoviridae. It is a non-enveloped double-stranded DNA virus that mainly infects 3-6 week-old chickens and can cause severe hepatitis-hydropericardium syndrome (HHS), with a mortality rate of up to 80% to 90%, causing huge economic losses to the poultry industry. Although researchers at home and abroad have done some work on FAdV-4 in terms of biological characteristics, pathogenicity, diagnostic reagents and vaccine research, there is still a lack of effective prevention and control measures. Therefore, clarifying the pathogenicity of FAdV-4 and developing a safe and effective new vaccine are of great significance for both basic and applied research on FAdV-4.

[0003] The FAdV-4 genome is huge, about 43 to 46 kb long, and it is difficult to operate and modify its genome. The reverse genetic operating system platform is a key tool for studying the gene function, pathogenic mechanism and new vaccines of FAdV-4 virus. At the same time, the reverse genetic operation technology can be used to insert exogenous tags into the viral genome to study viral replication, the function of viral encoded proteins and the screening of antiviral drugs. However, at present, only a few laboratories at home and abroad have constructed a reverse genetic operating system platform for FAdV-4, and the application of this system is still in its infancy. In addition, the existing FAdV-4 infectious clone construction method requires the Red α / β recombination system to transform the virus in the later stage. This method requires two clonings to insert the target gene into the viral genome. The operation process is relatively cumbersome, which further increases the risk of genome mutation.

[0004] In summary, how to provide an efficient and convenient avian adenovirus type 4 reverse genetics operating system is a problem that technical personnel in this field urgently need to solve. Summary of the invention

[0005] In view of this, the present invention provides a reverse genetic operating system for avian adenovirus type 4 and its application.

[0006] In order to further establish a more efficient and convenient reverse genetics operating system, the present invention uses FAdV-4 / Y17215-1 as the research object, divides it into four fragments, A, B, C and D, and connects them to the pOK-CMV vector respectively using homologous recombination technology, successfully constructs four library plasmids covering the whole genome and can successfully rescue the virus. At the same time, in order to verify whether the construction strategy can quickly transform the virus and insert foreign genes, the NanoLuc reporter gene is inserted between ORF42 and ORF43 of the avian adenovirus type 4 genome using homologous recombination technology, and the recombinant FAdV-4 expressing the NanoLuc reporter gene is successfully rescued.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A reverse genetic operating system for fowl adenovirus type 4 comprises four recombinant clays containing nucleotide sequences of 1-10990nt, 10492-21968nt, 21703-32894nt and 32708-43720nt of fowl adenovirus type 4 genome respectively. The GeneBank accession number of the fowl adenovirus type 4 full genome is PQ539419.

[0009] Furthermore, the four recombinant cosmids are obtained by connecting the nucleotide sequences of 1 to 10990 nt, 10492 to 21968 nt, 21703 to 32894 nt and 32708 to 43720 nt of the avian adenovirus type 4 genome to the pOK-CMV vector respectively;

[0010] The construction method of the pOK-CMV vector is: sequentially connecting the CMV promoter, the hepatitis D virus ribozyme HdVRz and the PolyA terminator sequence, and homologously recombining the fragment with the pOK12 vector to obtain the pOK-CMV vector.

[0011] Furthermore, it also includes a host cell in which avian adenovirus type 4 is able to replicate.

[0012] Furthermore, the host cell is a LMH cell.

[0013] A method for constructing a reverse genetics operating system for avian adenovirus type 4 comprises the following steps:

[0014] (1) Using the full-length genome of avian adenovirus type 4 as the backbone, four DNA fragments were obtained by PCR amplification. The primers used were as follows:

[0015] AF: GTCTCATCATTTTGGCAAACATCATCTTATATAACCGCGTCTTT TGACAC, SEQ ID NO.1;

[0016] AR: GGAGATGCCATGCCGACCCTCCGATTTCTACTCCGTAGACGTC ATCG, SEQ ID NO.2;

[0017] BF: GTCTCATCATTTTGGCAAAGGTGATTTTGGTTCCACAGTTGTTT TTG, SEQ ID NO.3;

[0018] BR: GGAGATGCCATGCCGACCCAGGTTTTTGATGGCGAAGAATTTT TGGG, SEQ ID NO.4;

[0019] CF: GTCTCATCATTTTGGCAAATTACAAGTTTAGCATCTCCGGCTTC GAC, SEQ ID NO.5;

[0020] CR: GGAGATGCCATGCCGACCCTTCATAGTATCCATGGCCGAGTA CGTCC, SEQ ID NO.6;

[0021] DF: GTCTCATCATTTTTGGCAAATACCTCCCTCTACTTGAAATTGGAC AGC, SEQ ID NO.7;

[0022] DR: GGAGATGCCATGCCGACCCCATCATCTTATATAACCGCGTCTTTTGACAC, SEQ ID NO.8;

[0023] (2) sequentially connecting the CMV promoter, hepatitis D virus ribozyme HdVRz and PolyA terminator sequence, and homologously recombining the fragment with the pOK12 vector to obtain the pOK-CMV vector;

[0024] (3) Using homologous recombination technology, the four DNA fragments were cloned into the pOK-CMV vector to obtain four library plasmids, named pOKCMV-A, pOKCMV-B, pOKCMV-C, and pOKCMV-D;

[0025] (4) pOKCMV-A, pOKCMV-B, pOKCMV-C, and pOKCMV-D were co-transfected into LMH cells for virus rescue.

[0026] Furthermore, in the step (3), an EcoR I restriction site is retained between the CMV promoter and the hepatitis D virus ribozyme HdVRz.

[0027] The application of the above-mentioned reverse genetic operating system is to use the reverse genetic operating system to rescue avian adenovirus type 4.

[0028] The application of the above-mentioned reverse genetic operating system is to use the reverse genetic operating system to construct avian adenovirus type 4 mutants or to modify the avian adenovirus type 4 genome.

[0029] The application of the above-mentioned reverse genetic operating system is to use the reverse genetic operating system for the preparation of recombinant vaccines.

[0030] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0031] The present invention adopts the avian adenovirus type 4 genome segmented amplification method for the first time to obtain four library plasmids. After the cells are infected, lesions appear in the first generation, and the rescue efficiency is high. The construction method adopted can directly delete, replace and insert genes without the need for the Red α / β recombination system. The construction efficiency is faster and more convenient, which provides an efficient technical platform for in-depth basic and applied research on FAdV-4 and has important scientific application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0033] Figure 1 Schematic diagram of the construction of the full-length infectious clone of FAdV-4 / Y17215-1 in Example 1 of the present invention;

[0034] Figure 2 This is the construction strategy of the FAdV-4-Nluc recombinant virus in Example 1 of the present invention;

[0035] Figure 3 This is a gel electrophoresis diagram of the segmented amplification of the full-length genome of FAdV-4 in Example 1 of the present invention;

[0036] Figure 4 This is a diagram of cell pathological changes observed in Example 1 of the present invention, wherein A is a normal cell; B is a LMH cell infected with the parental virus; and C is a LMH cell infected with the rescue virus rFAdV-4 / Y17215-1;

[0037] Figure 5: This is a PCR identification diagram of the rescued virus rFAdV-4 / Y17215-1 in Example 1 of the present invention, wherein A is PCR amplification of Fiber-1, 1 represents Mock; 2 represents the parental virus; 3 represents the rescued virus; B is PCR amplification of Penton, 1 represents Mock; 2 represents the parental virus; 3 represents the rescued virus;

[0038] Figure 6 IFA detection of the rescued virus rFAdV-4 / Y17215-1 in Example 1 of the present invention;

[0039] Figure 7 The rescued virus rFAdV-4 / Y17215-1 identified by WB in Example 1 of the present invention;

[0040] Figure 8 This is the observation of pathological changes in LMH cells infected with the FAdV-4-Nluc recombinant virus in Example 1 of the present invention, wherein A is a normal cell; B is an LMH cell infected with the parental virus; and C is an LMH cell infected with the FAdV-4-Nluc recombinant virus;

[0041] Fig. 9 IFA identification of LMH cells infected with the recombinant virus rFAdV-4-Nluc in Example 1 of the present invention;

[0042] Fig.10 This is the genetic stability analysis of the recombinant virus rFAdV-4-Nluc in Example 1 of the present invention, wherein A is a gel electrophoresis diagram, M represents the DL 2000 DNA relative molecular mass standard; 1-5 represents rFAdV-4-Nluc F6-F10; 6 represents FAdV-4; 7 represents the control group; and B is the Nluc activity of the recombinant virus rFAdV-4-Nluc F1-F10 generations. DETAILED DESCRIPTION

[0043] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0045] Example 1

[0046] 1 Materials and methods

[0047] 1.1 Viruses, cells and vectors

[0048] The FAdV-4 / Y17215-1 strain was isolated and preserved by our laboratory (Wang Lili, Tian Xiangxue, Lu Chao, Li Xiuli, Li Fuqiang, Ren Weike, Li Cheng, Zhang Li, Yan Minghua. Study on the pathogenicity of avian adenovirus serotype 4 Y17215-1 strain to SPF chicken embryos and SPF chickens [J]. Heilongjiang Animal Husbandry and Veterinary Medicine, 2022(4):19-24,126-127.);

[0049] The pOK12 vector and chicken hepatoma cells (LMH) were both stored in our laboratory.

[0050] 1.2 Primer synthesis for constructing the full-length infectious clone of FAdV-4

[0051] According to the gene sequence of FAdV-4 / Y17215-1, primers were designed using Oligo6.0, and four pairs of overlapping primers AF / AR, BF / BR, CF / CR and DF / DR covering the whole genome of FAdV-4 / Y17215-1 virus and FAdV-4 detection primers were designed and synthesized. The primer sequences are shown in Table 1. All primers were synthesized by Jinweizhi Biotechnology Co., Ltd.

[0052] Table 1 FAdV-4 complete gene and identification primers

[0053]

[0054]

[0055] 1.3 Primer synthesis for constructing FAdV-4-Nluc recombinant virus

[0056] Using the commercial pEGFP-N1 plasmid as a template, primers pEGFP-FX / RX were used to amplify the linearized vector, and then the recombinant plasmid containing the NanoLuc gene was amplified with primers TY-Nano-F / R (Guo X, Zhao K, Liu X, Lei B, Zhang W, Li X, Yuan W. Construction and Generation of a Recombinant Senecavirus a Stably Expressing the NanoLuc Luciferase for Quantitative Antiviral Assay. Front Microbiol. 2021 Oct 1; 12: 745502.) to obtain a fragment containing the vector homology arm, and the linearized vector and the fragment containing the vector homology arm were homologously recombined to obtain the recombinant plasmid pNanoLuc-N1. Using the recombinant plasmid pNanoLuc-N1 as a template, PCR amplification was performed using Nluc-FP / RP to obtain a NanoLuc gene expression cassette under the control of the CMV promoter; pOKCMV-D was further PCR amplified using primers POK-DF / R to obtain a linearized vector, and the NanoLuc gene expression cassette under the control of the CMV promoter was cloned into the insertion site between the ORF42 and ORF43 genes (between 35426 and 35427 nt) to construct a recombinant FAdV-4 expressing the NanoLuc gene (FAdV-4-Nluc recombinant virus). The primer sequences are shown in Table 2, and all primers were synthesized by GeneWeiZ Biotechnology Co., Ltd.

[0057] Table 2 Primer sequences for constructing FAdV-4-Nluc recombinant virus

[0058]

[0059] 1.4 Construction of the infectious clone of FAdV-4 full-length cDNA

[0060] Build strategies such as Figure 1, using the full-length genome of FAdV-4 / Y17215-1 as the skeleton, four DNA fragments (AD) were amplified by PCR, each containing a homology arm of about 200 bp in length, and the total length of the four fragments covered the complete sequence of FAdV-4 / Y17215-1. The four DNA fragments were cloned into the pOK12 vector and stored at -20°C after sequencing. The CMV promoter, hepatitis delta virus ribozyme HdVRz and PolyA terminator sequences were artificially synthesized, and the EcoR I restriction site was retained between the CMV promoter and the HdVRz ribozyme sequence. The fragment was homologously recombined with pOK12 to obtain the modified pOK12 vector, named pOK-CMV. After linearizing the pOK-CMV vector using EcoR I, the four AD fragments were cloned into the pOK-CMV vector using homologous recombination technology to obtain four library plasmids containing the full length of FAdV-4 / Y17215-1, which were named pOKCMV-A, pOKCMV-B, pOKCMV-C, and pOKCMV-D respectively.

[0061] 1.5 Virus rescue

[0062] 1 μg of each of the four library plasmids (pOKCMV-A, pOKCMV-B, pOKCMV-C, and pOKCMV-D) was co-transfected into LMH cells and cultured in a 37°C incubator containing 5% CO2 for 5 days before the virus was harvested. After repeated freezing and thawing for 3 times, the virus was continued to be passaged on LMH cells until the virus could stably produce cytopathic effects. The rescued virus was named rFAdV-4 / Y17215-1.

[0063] 1.6 Construction of recombinant FAdV-4 expressing NanoLuc luciferase reporter gene

[0064] Build strategies such as Figure 2 Based on the established FAdV-4 / Y17215-1 four-library plasmid rescue system, the NanoLuc gene was inserted between ORF42 and ORF43 of the pOKCMV-D genome. Since the insertion position was in the D segment, only the D segment needed to be transformed. The main steps are as follows:

[0065] According to the known positions and sequences of FAdV-4ORF42 and ORF43, the corresponding homology arm primers were designed. The pNanoLuc-N1 recombinant plasmid was used as a template and Nluc-FP / RP primers were used to amplify the NanoLuc fragment by PCR. The pOKCMV-D vector was used as a template and the plasmid was linearized using POK-DF / R primers to amplify the pOKCMV-D linearized vector. The NanoLuc fragment was cloned into the pOKCMV-D linearized vector by homologous recombination technology to obtain the pOKCMV-D recombinant plasmid containing the NanoLuc reporter gene, named: pOKCMV-D-Nluc. pOKCMV-A, pOKCMV-B, pOKCMV-C and pOKCMV-D-Nluc were co-transfected into LMH cells to rescue the recombinant virus.

[0066] 1.7 PCR identification

[0067] The rescued virus F5 generation DNA was extracted and used as a template to perform PCR amplification using primers (Fiber1 and Penton) of the major structural protein gene of FAdV-4. The PCR product was electrophoresed on a 1% agarose gel and sequenced.

[0068] 1.8 Indirect immunofluorescence (IFA) identification

[0069] After infecting LMH cells with the rescue virus for 24 h, the cells were washed three times with PBS, fixed with 4% paraformaldehyde, and detected by IFA using FAdV-4Fiber1 polyclonal antibody as primary antibody and FITC-labeled goat anti-rabbit as secondary antibody. The samples were observed under a fluorescent inverted microscope.

[0070] 1.9 Western blotting

[0071] After infecting LMH cells with rescue virus for 24 hours, the cells were collected and lysed with protein lysis buffer for 30 minutes, centrifuged to remove the precipitate, added an appropriate amount of SDS protein loading buffer, placed in a metal bath at 100°C for 10 minutes, and the samples after electrophoresis were transferred to nitrocellulose membranes and blocked at 4°C overnight. The blocked nitrocellulose membranes were placed in the primary antibody diluent, incubated on a shaker for 1 hour, and then washed three times with TBST. The secondary antibody diluent was added and incubated for 1 hour, and then color development and grayscale analysis were performed.

[0072] 1.10 Analysis of genetic stability of FAdV-4-Nluc recombinant virus

[0073] In order to evaluate the genetic stability of the recombinant virus with inserted exogenous fragments, the FAdV-4-Nluc recombinant virus was continuously propagated on LMH cells for 10 generations, and the viral DNA was extracted from the culture supernatant of F1-F10 cells. The exogenous gene was amplified by PCR and sequenced using primers Nluc-FP / RP as a template.

[0074] 2 Results

[0075] 2.1 Construction, rescue and identification of rFAdV-4 / Y17215-1 infectious clone

[0076] 2.1.1 rFAdV-4 / Y17215-1 segmented amplification

[0077] Using the full-length genome of FAdV-4 / Y17215-1 as a template, four pairs of overlapping primers AF / AR, BF / BR, CF / CR and DF / DR covering the whole genome of FAdV-4 were designed and synthesized, and amplified by PCR to obtain four fragments A, B, C and D. The sizes of the amplified target bands were 11028 bp, 11514 bp, 11229 bp and 11050 bp (including the 38 bp vector homology arm on the primer) ( Figure 3 ), and the four amplified fragments were connected to the linearized pOK-CMV vector by homologous recombination technology to obtain the eukaryotic transcription plasmids pOKCMV-A, pOKCMV-B, pOKCMV-C and pOKCMV-D.

[0078] 2.1.2 Observation of cytopathic effects

[0079] Four recombinant plasmids (pOKCMV-A, pOKCMV-B, pOKCMV-C, pOKCMV-D) were co-transfected into LMH cells and a blank control group was set up. The virus was repeatedly frozen and thawed three times 5 days after transfection, and then serially passaged in LMH cells. At the first generation, both the rescued virus rFAdV-4 / Y17215-1 and the parental virus showed obvious cytopathic effects, such as cell rounding, shrinkage and shedding, while the cells in the blank control group showed no lesions, indicating that the virus was successfully rescued ( Figure 4 ).

[0080] 2.1.3 Detection of viral nucleic acid

[0081] Viral DNA was extracted from the rescued virus rFAdV-4 / Y17215-1 F5 cell cytotoxicity, and the rescued virus was amplified by PCR using primers (Fiber1 and Penton) of the main structural protein gene of FAdV-4. Gel electrophoresis showed fragments of the expected size ( Figure 5 ). The amplified target fragment was sequenced, and the results showed that the rescued virus sequencing results were consistent with the parental virus.

[0082] 2.1.4 Indirect immunofluorescence (IFA) identification results

[0083] The rescued viruses rFAdV-4 / Y17215-1 and FAdV-4 strain were inoculated into LMH cells at an infection dose of MOI = 0.01. When the cells showed slight lesions, the rescued viruses were identified using a rabbit-derived polyclonal antibody against FAdV-4Fiber1 protein as the primary antibody and FITC-labeled goat anti-rabbit IgG as the secondary antibody. The results showed that the rescued viruses rFAdV-4 / Y17215-1 and FAdV-4 strain infection groups showed specific green fluorescence, while the Mock group did not show green fluorescence, indicating that the virus was successfully rescued ( Figure 6 ).

[0084] 2.1.5WB Identification

[0085] The rescued viruses rFAdV-4 / Y17215-1 and FAdV-4 were inoculated into LMH cells at an infection dose of MOI = 0.01, and cell samples were collected 24 hours later for WB identification. The results showed that Figure 7 Fiber 1 protein bands were detected in both rescued virus rFAdV-4 / Y17215-1 and parental virus, while no Fiebr 1 protein bands were detected in blank control, which finally confirmed that the virus rescue was successful ( Figure 7 ).

[0086] 2.2 Application of reverse genetics system of avian adenovirus type 4

[0087] 2.2.1 Rescue of recombinant FAdV-4 infectious clones carrying the NanoLuc gene

[0088] The recombinant plasmid pOKCMV-D-Nluc identified by sequencing was co-transfected with pOKCMV-A, pOKCMV-B, and pOKCMV-C into LMH cells. After 5 days, the cell supernatant was collected and inoculated into LMH cells after repeated freezing and thawing for 3 times. The results showed that when the FAdV-4-Nluc recombinant virus was propagated to the first generation, it showed severe cytopathic effects, including cell rounding, shrinkage, and shedding ( Figure 8 ), indicating that the virus was successfully rescued and named rFAdV-4-Nluc.

[0089] 2.2.2 IFA identification of recombinant viruses

[0090] The recombinant virus rFAdV-4-Nluc and FAdV-4 strain were inoculated into LMH cells at an infection dose of MOI = 0.01. When the cells showed slight lesions, the rabbit anti-FAdV-4Fiber1 protein polyclonal antibody was used as the primary antibody, and the FITC-labeled goat anti-rabbit IgG was used as the secondary antibody to identify the rescued virus rFAdV-4-Nluc. The results showed that both the recombinant virus rFAdV-4-Nluc and the parental virus showed specific green fluorescence, while the Mock group did not show green fluorescence, indicating that the virus was successfully rescued ( Fig. 9 ).

[0091] 2.2.3 Genetic stability analysis

[0092] To further analyze the genetic stability of the recombinant virus, the recombinant virus rFAdV-4-Nluc was continuously passaged 10 times in LMH cells to detect the genetic stability of the exogenous gene Nluc. PCR amplification of the recombinant virus rFAdV-4-Nluc F6-F10 generations showed that the recombinant virus rFAdV-4-Nluc could amplify a 1961bp target band, while the parent virus FAdV-4 without the Nluc gene could only amplify a 379bp target band ( Fig.10 A), and the Nluc activity of F1-F10 was detected. The results showed that the luciferase activity of the recombinant virus rFAdV-4-Nluc did not decrease during cell passage ( Fig.10 B), indicating that the recombinant virus has good genetic stability.

[0093] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0094] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A reverse genetics system for avian adenovirus type 4, characterized in that: The invention comprises four recombinant clay particles respectively containing nucleotide sequences of 1-10990nt, 10492-21968nt, 21703-32894nt and 32708-43720nt of the fowl adenovirus type 4 genome. The GeneBank accession number of the fowl adenovirus type 4 complete genome is PQ539419.

2. The reverse genetics operating system according to claim 1, characterized in that: The four recombinant cosmids are obtained by connecting the nucleotide sequences of 1 to 10990 nt, 10492 to 21968 nt, 21703 to 32894 nt and 32708 to 43720 nt of the fowl adenovirus type 4 genome to the pOK-CMV vector respectively; The construction method of the pOK-CMV vector is: sequentially connecting the CMV promoter, the hepatitis D virus ribozyme HdVRz and the PolyA terminator sequence, and homologously recombining the fragment with the pOK12 vector to obtain the pOK-CMV vector.

3. The reverse genetics operating system according to any one of claims 1 to 2, characterized in that: Also included are host cells in which avian adenovirus type 4 is capable of replication permissiveness.

4. The reverse genetics operating system according to claim 3, characterized in that: The host cell is a LMH cell.

5. A method for constructing a reverse genetics operating system for avian adenovirus type 4, characterized in that: The steps include: (1) Using the full-length genome of avian adenovirus type 4 as the backbone, four DNA fragments were obtained by PCR amplification. The primers used were as follows: AF: GTCTCATCATTTTGGCAAACATCATCTTATATAACCGCGTCTTT TGACAC, SEQ ID NO.1; AR: GGAGATGCCATGCCGACCCTCCGATTTCTACTCCGTAGACGTC ATCG, SEQ ID NO.2; BF: GTCTCATCATTTTGGCAAAGGTGATTTTGGTTCCACAGTTGTTT TTG, SEQ ID NO.3; BR: GGAGATGCCATGCCGACCCAGGTTTTTGATGGCGAAGAATTTT TGGG, SEQ ID NO.4; CF: GTCTCATCATTTTGGCAAATTACAAGTTTAGCATCTCCGGCTTC GAC, SEQ ID NO.5; CR: GGAGATGCCATGCCGACCCTTCATAGTATCCATGGCCGAGTA CGTCC, SEQ ID NO.6; DF: GTCTCATCATTTTGGCAAATACCTCCCTCTACTTGAAATTGGAC AGC, SEQ ID NO.7; DR: GGAGATGCCATGCCGACCCCATCATCTTATATAACCGCGTCTTTTGACAC, SEQ ID NO.8; (2) sequentially connecting the CMV promoter, hepatitis D virus ribozyme HdVRz and PolyA terminator sequence, and homologously recombining the fragment with the pOK12 vector to obtain the pOK-CMV vector; (3) Using homologous recombination technology, the four DNA fragments were cloned into the pOK-CMV vector to obtain four library plasmids, named pOKCMV-A, pOKCMV-B, pOKCMV-C, and pOKCMV-D; (4) pOKCMV-A, pOKCMV-B, pOKCMV-C, and pOKCMV-D were co-transfected into LMH cells for virus rescue.

6. The method according to claim 5, characterized in that In the step (3), an EcoR I restriction site is retained between the CMV promoter and the hepatitis D virus ribozyme HdVRz.

7. The use of the reverse genetics operating system according to any one of claims 1 to 2, characterized in that: The reverse genetics system is used to rescue avian adenovirus type 4.

8. The use of the reverse genetics operating system according to any one of claims 1 to 2, characterized in that: The reverse genetic operating system is used to construct avian adenovirus type 4 mutants or to modify the avian adenovirus type 4 genome.

9. The use of the reverse genetics operating system according to any one of claims 1 to 2, characterized in that: The reverse genetics operating system is used to prepare recombinant vaccines.

Images