Application of ORM1 protein or VIM knockout adenovirus in preparation of medicine for treating temporomandibular joint osteoarthritis

Abstract

The invention belongs to the technical field of biological medicines, and particularly discloses application of ORM1 protein or VIM knockout adenovirus in preparation of a medicine for treating temporomandibular joint osteoarthritis (TMJOA). The invention proves that the expression of ORM1 is reduced in synovial fluid of a TMJOA patient and a unilateral anterior tooth reverse inhale model rat, and the degradation of cartilage matrix of the UAC rat can be remarkably inhibited and the progress of TMJOA can be relieved by locally injecting ORM1 protein. On the mechanism level, ORM1 is combined with waveform protein VIM to inhibit an MAPK channel, so that expression of MMP13 and MMP3 is reduced, cartilage matrix degradation is reduced, and cartilage steady state is maintained. In addition, the invention also finds that after the VIM of the rat is knocked out by using the adeno-associated virus, the progress of TMJOA, including cartilage degeneration and subchondral bone destruction, is also obviously improved. Therefore, the invention provides a new therapeutic target and a new therapeutic strategy for the TMJOA.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to application of ORM1 protein or VIM knockout adenovirus in the preparation of a drug for treating temporomandibular joint osteoarthritis. Background Art

[0002] Temporomandibular joint osteoarthritis (TMJOA) is one of the most complex TMJOA diseases. It is osteoarthritis (OA) caused by anterior disc displacement (TMJ ADD) of the TMJOA and can cause a variety of problems, but its pathogenesis is still unclear. Considering the importance of condylar cartilage in mandibular development, maintaining condylar cartilage homeostasis is considered a key strategy for the treatment of CR. The destruction of cartilage homeostasis in TMJ OA can be attributed to a variety of factors, such as chondrocyte apoptosis and abnormal autophagy, among which the most important is the degenerative changes of cartilage extracellular matrix (ECM). Cartilage matrix degradation leads to the infiltration of nerves, blood vessels and inflammatory cells, thereby destroying the function of chondrocytes. Matrix metalloproteinases (MMPs) play an important role in ECM degradation, and their expression can accelerate the progression of condylar bone destruction. Therefore, targeting MMPs is considered a potential therapeutic strategy for TMJOA.

[0003] Orosomucoid 1 (ORM1), also known as α1-1-acid glycoprotein 1, is a glycoprotein that is primarily synthesized in the liver and detectable in plasma. As ORM1 is an acute phase protein, its levels in the blood are increased during certain disease processes, including inflammation, infection, and cancer states. A key role of ORM1 is as a carrier protein in the blood that transports various endogenous and exogenous substances, especially drugs. In addition, ORM1 can play an immunomodulatory role by interacting with components of the immune system and regulating inflammatory responses. Studies have reported that ORM1 has an anti-inflammatory effect in inflammation. Of note, it has been reported that serum ORM levels in patients with active knee arthritis are lower than those in patients with inactive knee arthritis. However, no studies have reported the role of ORM1 in targeting MMPs and regulating cartilage homeostasis during temporomandibular joint condylar destruction. Summary of the invention

[0004] To solve the above problems, the present invention provides the use of a VIM inhibitor in the preparation of a drug for treating temporomandibular joint osteoarthritis. The VIM inhibitor is ORM1 protein or VIM knockout adenovirus, both of which can achieve the purpose of treating TMJOA by inhibiting vimentin (VIM).

[0005] In order to achieve the above object, the specific technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides use of ORM1 protein in the preparation of a drug for treating temporomandibular joint osteoarthritis.

[0007] The inventors found that ORM1 expression was downregulated in the synovial fluid of TMJOA patients and unilateral anterior crossbite (UAC) rats. Local injection of ORM1 protein can significantly inhibit cartilage matrix degradation in UAC rats and alleviate TMJOA progression. At the mechanistic level, ORM1 binds to vimentin VIM, inhibits mitogen-activated protein kinase (MAPK), inhibits cartilage degradation marker matrix metalloproteinase 13 (MMP13) and MMP3-mediated cartilage matrix degradation, thereby significantly reducing cartilage matrix degradation and maintaining cartilage homeostasis.

[0008] Furthermore, the concentration of ORM1 protein in the drug is 100-200 μg / mL, and more preferably 200 μg / mL.

[0009] In a second aspect, the present invention provides the use of adenoviruses with knockout VIM in the preparation of drugs for treating temporomandibular joint osteoarthritis. Based on the above mechanism, the inventors have also found through research that knockout of rat VIM using adeno-associated viruses can also significantly improve the progression of TMJOA, including cartilage degradation and subchondral bone destruction.

[0010] Furthermore, the VIM knockout adenovirus is a plasmid carrying VIM shRNA, which is obtained by inserting the VIM shRNA fragment between the EcoRI and BamHI sites of the pHBAAV-U6-MCS-CMV-EGFP plasmid, and the VIM shRNA fragment is obtained by annealing the primers shown in the sequence SEQ ID NO.1-2.

[0011] In a third aspect, the present invention provides a pharmaceutical composition for treating temporomandibular joint osteoarthritis, which contains a VIM inhibitor as an active ingredient, wherein the VIM inhibitor is the aforementioned ORM1 protein or a VIM knockout adenovirus.

[0012] Further, the pharmaceutical composition comprises the active ingredient and a pharmaceutically acceptable carrier, and "pharmaceutically acceptable" means that when the carrier is properly administered to an animal or a human, they will not produce adverse, allergic or other adverse reactions. The pharmaceutically acceptable carrier can be selected from one or more of a diluent (such as saline), a filler, a surfactant, an absorption promoter, a disintegrant, a wetting agent, a dispersant, etc.

[0013] Furthermore, the dosage form of the pharmaceutical composition includes but is not limited to any one of injection, emulsion, tablet, powder, granule, gel, ointment, capsule or oral solution.

[0014] The present invention has the following beneficial effects:

[0015] The present invention proves the important function of ORM1 in maintaining cartilage homeostasis by inhibiting VIM / MAPK / MMP signal transduction, provides a new method for intervening in the treatment of TMJ CR by maintaining cartilage homeostasis, and indicates that ORM1 is a target for the treatment of TMJOA. The present invention proposes for the first time the use of two VIM inhibitors, ORM1 protein and VIM knockout adenovirus, as drugs for the treatment of temporomandibular joint osteoarthritis, and proves the therapeutic effects of both on TMJOA through experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 :Expression of ORM1 in TMJOA in Example 1. A. Proteomics results; B. ORM1 expression levels corresponding to different severity levels of TMJOA (Mild, Moderate, Severe); C. ORM1 expression levels in pain patients and pain-free patients; D. Fluorescence expression of ORM1 in rat condylar cartilage; E. Quantitative analysis of ORM1 expression in rat condylar cartilage.

[0017] Figure 2 : The treatment effect of ORM1 on rat condyle in Example 2. A. Immunohistochemical staining results; B. Condyle thickness and osteoarthritis score; C. Micro-CT results; D. Quantitative analysis of condyle Micro-CT results.

[0018] Figure 3 : Transcriptome sequencing results of cells treated with ORM1 in Example 3. A. Expression of key indicators; B. GO analysis of differentially expressed genes; C. KEGG analysis of differentially expressed genes.

[0019] Figure 4 : The results of the effect of ORM1 treatment on the expression of MMP13 and MMP3 in Example 4. A and B are the expression of RNA and protein levels of cellular MMP13 and MMP3 after ORM1 treatment; C and D are the results of immunohistochemical staining and quantitative analysis of rat condylar cartilage after ORM1 injection.

[0020] Figure 5: Results of determining downstream targets of ORM1 in Example 5. A. Mass spectrometry was used to detect the co-precipitated proteins ORM1 and VIM, and ZDOCK was used to predict the binding of ORM1 and VIM; B. Immunoprecipitation was used to verify the binding results of ORM1 and VIM; C. Immuno-colocalization staining results of ORM1 and VIM in condylar cartilage; D. Quantitative analysis of the expression of ORM1 and VIM and the binding of ORM1 and VIM.

[0021] Figure 6 : Effects of ORM1 treatment on VIM expression and MAPK pathway in Example 6. A. Western blot results and quantitative analysis of ORM1 treatment; B. Effects of ORM1 treatment on the phosphorylation levels of ERK, JNK and p38 in the MAPK pathway and quantitative analysis.

[0022] Figure 7 : Experimental results of ORM1 inhibiting VIM / MAPK / MMP pathway in Example 7. A. Expression of MMP13 and MMP3 and activation of MAPK pathway after overexpression of VIM with or without ORM1 treatment; B. Expression of MMP13 and MMP3 and activation of MAPK pathway after inhibition of VIM; C. Expression of MMP13 and MMP3 after overexpression of VIM with or without MAPK pathway inhibitor.

[0023] Figure 8 :The effect of using VIM knockdown adeno-associated virus to treat rat condylar cartilage in Example 8. A. Schematic diagram of plasmid vectors in the construction process of VIM knockdown adeno-associated virus; B. Immunohistochemical staining results of rat condylar cartilage after VIM knockdown adeno-associated virus treatment; C. Quantitative analysis of rat condylar cartilage thickness and osteoarthritis severity score; D. Micro-CT detection results of rat condylar cartilage after VIM knockdown adeno-associated virus treatment; E. Quantitative analysis of various Micro-CT indicators. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0025] Example 1: ORM1 expression is downregulated in the condylar cartilage of adolescent TMJOA patients' SF and rat condylar resorption model

[0026] In this example, 63 adolescent ADD-related TMJOA patients were studied, including mild CR (n=21), moderate CR (n=27) and severe CR (n=15) patients. SF (synovial fluid) samples were collected from the joint cavity of these patients during arthroscopic disc reduction and tested using proteomic analysis.

[0027] The analysis of the three groups of differentially identified proteins revealed that the level of ORM1 showed a significant downward trend with the progression of the disease, that is, as the severity of TMJOA increased, the expression level of ORM1 in the synovial fluid showed a downward trend ( Figure 1 A and 1B). In addition, the level of ORM1 in patients with pain was significantly lower than that in patients without pain ( Figure 1 C), there was no significant difference between patients with different MIO and between patients with and without bruxism.

[0028] In addition, a rat condylar cartilage destruction UAC model was established, and the expression of ORM1 was observed in the condylar cartilage of both the control group and UAC rats ( Figure 1 D). Six weeks after UAC construction, the expression of ORM1 in condylar cartilage was significantly lower than that in the control group ( Figure 1 E).

[0029] Example 2: Injection of ORM1 can reduce condylar bone destruction in UAC rats

[0030] A rat UAC model of condylar rupture was established. Normal saline (UAC+NS group) or ORM1 dissolved in NS (100μg / mL or 200μg / mL, UAC+ORM1 group) was injected into the superior cavity of the TMJ joint of UAC rats at 1-2 weeks or 1-5 weeks, respectively. At the same time, normal rats were injected with normal saline (NS group) at 1-2 weeks or 1-5 weeks as a control. Then, the rats were euthanized at 3 and 6 weeks, respectively, and the condyles were collected. There was no significant difference in the body weight of UAC rats injected with NS or ORM1 among the three groups of NS, UAC+NS, and UAC+ORM1. The condyles were collected for immunohistochemical analysis. HE staining showed that the surface of each UAC group was rough and the ossification area was obvious, especially in the rats treated for 6 weeks. After ORM1 injection, the thickness of the condylar cartilage of UAC rats increased significantly ( Figure 2 A). Compared with the saline-treated UAC group, the OARSI scores of UAC rats treated with ORM1 were significantly lower, indicating that the degree of injury was significantly smaller ( Figure 2 B). Micro-CT was used to evaluate the subchondral bone changes of the condylar process in each group of rats. At weeks 3 and 6, the trabecular density of the condylar process in the NS group was the highest, while the trabeculae in the UAC group were significantly hollow. The trabecular density of both UAC groups treated with ORM1 was significantly improved ( Figure 2 C). Further analysis confirmed these changes. The BV / TV (bone volume fraction), BS / BV (bone area fraction), Tb.N (number of trabeculae) and BMD (bone mineral density) of the condylar cartilage in the UAC+NS group were lower than those in the NS group, while Tb.Sp (trabecular separation) was higher than that in the NS group. ORM1 treatment reversed this change. The ORM1-treated group showed higher BV / TV, BS / BV, Tb.N and BMD compared with the UAC+NS group, and Tb.Sp was lower than that in the UAC+NS group ( Figure 2 D).

[0031] Example 3: ORM1 is involved in regulating chondrocyte homeostasis

[0032] C28 / I2 cells were treated with PBS as a control group (n=3), 10 ng / mL IL-1β (n=3), or 10 ng / mL IL-1β and 200 μg / mL ORM1 (n=3) for 24 h, and then the cells were collected for high-throughput RNA sequencing.

[0033] PCA analysis showed significant differences among the three groups. Comparing the changes in gene expression in the three groups, it was noted that after ORM1 treatment of cells, the upregulation of MMP3 expression caused by IL-1β treatment was reversed. Genes related to osteoarthritis are the most noteworthy. ORM1 treatment reduced the increased expression of MMP13, MMP3, MMP12 and ADAMTS4 caused by IL-1β ( Figure 3 A). Subsequent GO analysis showed that genes that were upregulated after IL-1β treatment and downregulated after ORM1 treatment were closely related to ECM tissue-related biological functions ( Figure 3 B) KEGG pathway analysis showed that these genes were enriched in the biological process of ECM receptor interaction ( Figure 3 C).

[0034] Example 4: ORM1 inhibits the expression of MMP13 and MMP3

[0035] Due to the key role of MMP13 and MMP3 in osteoarthritis and the results of high-throughput RNA sequencing, this example focuses on these two genes. In natural and inflammatory environments, after C28 / I2 and SW1353 cells were treated with 200 μg / mL of ORM1 protein, the expression of MMP13 and MMP3 at the RNA level was significantly reduced ( Figure 4 A). At the protein level, the expression of MMP13 and MMP3 was downregulated in C28 / I2 and SW1353 cells after ORM1 treatment ( Figure 4 B). The effect of ORM1 on MMPs was further confirmed in the rat UAC model ( Figure 4 C). Immunohistochemical staining showed that the proportion of cells expressing MMP13 and MMP3 in the condylar cartilage of the UAC+NS group was higher than that in the NS control group, while the number of chondrocytes expressing these two markers in the condylar cartilage of the ORM1-treated group (UAC+ORM1 group) was less than that in the UAC+NS group ( Figure 4 D).

[0036] Example 5: ORM1 interacts with VIM

[0037] In order to further explore the therapeutic mechanism of ORM1 on TMJOA, Co-IP was performed to find key proteins that interact with ORM1. Coomassie Brilliant Blue staining results showed that there were differential proteins around 50 kDa between the IgG and IP lanes. LC-MS / MS identified VIM as the only protein around 50 kDa that co-immunoprecipitated with ORM1 protein ( Figure 5 A). The co-immunoprecipitation of the two proteins was confirmed by co-IP experiments in HEK-293T cells and C28 / I2 cells ( Figure 5 B). To further confirm the binding of ORM1 and VIM, we used rat condylar cartilage for immunocolocalization detection ( Figure 5 C). The expression level of ORM1 in the condylar cartilage of the UAC group was lower than that of the NS control group, and the expression level of ORM1 in the condylar cartilage of the ORM1-treated group was higher than that of the UAC+NS group and the NS control group; in contrast, the expression level of VIM in the condylar cartilage of the UAC+NS group was higher than that of the NS control group, and the expression level of VIM in the condylar cartilage of the ORM1-treated group was lower than that of the UAC+NS group, but higher than that of the NS control group; in addition, the colocalization of ORM1 and VIM in the condylar cartilage of the UAC+NS group was more obvious than that of the NS control group, and was most obvious in the ORM1-treated group ( Figure 5 D).

[0038] Example 6: ORM1 downregulates VIM expression and inhibits the MAPK pathway

[0039] In vitro experiments further confirmed that the VIM protein level was reduced after ORM1 treatment. C28 / I2 and SW1353 cells were treated with IL-1β and ORM1 as variables, and the results of Western blotting showed that ORM1 protein treatment significantly reduced the VIM protein expression level in natural environment and inflammatory environment in C28 / I2 and SW1353 cells ( Figure 6 A, - represents no addition, + represents addition, no addition of IL-1β represents the natural environment, and addition of IL-1β represents the inflammatory environment). Further analysis showed that after ORM1 treatment, the phosphorylation levels of three proteins in the MAPK pathway, ERK, JNK, and p38, were downregulated in both natural and inflammatory environments ( Figure 6 B, p- represents phosphorylation), indicating that ORM1 inhibits the MAPK pathway.

[0040] Example 7: ORM1 reduces the expression of MMP13 and MMP3 by inhibiting the activation of MAPK pathway by VIM

[0041] After cells were transfected with VIM-Myc plasmid, VIM expression was upregulated. Cells treated with Myc plasmid and Myc plasmid plus IL-1β were used as negative and positive controls, respectively. The results showed that VIM overexpression upregulated MMP13 and MMP3, and ORM1 treatment inhibited the upregulation of MMP13 and MMP3 caused by VIM; VIM promoted the phosphorylation of ERK, JNK and p38, and ORM1 treatment inhibited this process ( Figure 7 A, - represents no corresponding treatment, + represents corresponding treatment). In addition, VIM siRNA was used to inhibit VIM expression. The results showed that inhibition of VIM could downregulate the protein levels of MMP13 and MMP3, and inhibit the phosphorylation of ERK, JNK and p38 ( Figure 7 B). The expression of MMP13 and MMP3 was detected after the cells transfected with VIM-Myc were treated with ERK (SCH772984), JNK (SP600125) or p38 (SB203580) inhibitors. The results showed that ERK, JNK or p38 inhibitors significantly reduced the upregulation of MMP13 and MMP3 after VIM overexpression ( Figure 7 C).

[0042] Example 8: Adeno-associated virus knockdown of rat VIM can reduce condylar bone destruction in UAC rats

[0043] The plasmid carrying VIM shRNA was constructed as follows:

[0044] Design and construct primer sequences for VIM knockdown shRNA:

[0045] The top strand sequence of this primer is:

[0046] AATTCGTGCGAAGTGGATGCCCTTAAActcgagTTTAAGGGCATCCACTTCGC ATTTTTTG (SEQ IDNO.1),

[0047] The bottom strand sequence of the primer is:

[0048] GATCCAAAAAATGCGAAGTGGATGCCCTTAAActcgagTTTAAGGGCATCCA CTTCGCACG(SEQ IDNO.2);

[0049] In addition, the primer sequences of the control viral vector shRNA are as follows:

[0050] The top strand sequence is:

[0051] GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACAC GTTCGGAGAATTTTTTC,

[0052] The bottom strand sequence is:

[0053] AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTG ACACGTTCGGAGAACG.

[0054] Synthesize the corresponding primers, anneal the primers (annealing conditions: 95℃, 75℃, 55℃, 35℃, 15℃ for 10 minutes in sequence) to form a double-stranded fragment with sticky ends, which is the target fragment. Use pHBAAV-U6-MCS-CMV-EGFP interference vector ( Figure 8 A), the vector was digested at EcoRI and BamHI, and then the interference fragment (i.e., the target fragment) was connected to the vector, the synthesized vector was transformed into DH5α competent cells, the plasmid was extracted and PCR sequencing was performed, and after confirming that the target plasmid was successfully constructed, the cells were transfected, and the cell precipitates were collected after 72 hours for adeno-associated virus packaging and purification. Finally, quality control and virus titer were detected to complete the construction of VIM knockdown adeno-associated virus.

[0055] The rats were divided into three groups: control adeno-associated virus injection group, control adeno-associated virus injection group and UAC construction group, VIM knockdown adeno-associated virus injection group and UAC construction group. UAC construction was performed 2 weeks after the rats were injected with control or VIM knockdown adeno-associated virus in the joint cavity. After construction, the rats were euthanized at the 3rd and 6th weeks, and the condyles were collected. The condyles were collected for immunohistochemical analysis ( Figure 8 B). Compared with the UAC group injected with the control virus (i.e., UAC+AAV2-siControl group), the condylar cartilage thickness of UAC rats with VIM knockdown (i.e., UAC+AAV2-siVIM group) was significantly higher and the OARSI score was significantly lower ( Figure 8 C). Micro-CT was used to evaluate the subchondral bone changes of the condylar process in each group of rats. The results showed that at the 3rd and 6th weeks, all indicators of the UAC group with knockdown of VIM were significantly improved ( Figure 8 DE).

[0056] In summary, the present invention confirms for the first time the protective effect of ORM1 on condylar cartilage in TMJOA, and conducts in-depth research on it. The study shows that ORM1 is downregulated in the synovial fluid of TMJOA patients and the condylar cartilage of UAC rats. Further experiments show that ORM1 inhibits the activation of the MAPK (ERK, JNK and p38) pathway by directly binding to and downregulating VIM, thereby downregulating the expression of MMP13 and MMP3 and inhibiting the degradation of cartilage matrix during TMJ CR. The present invention demonstrates the important role of ORM1 in maintaining condylar cartilage homeostasis by inhibiting the VIM / MAPK / MMP signaling pathway, and indicates that ORM1 is an important target for the treatment of TMJOA. In addition to injecting ORM1, the present invention also found that TMJOA can be effectively treated after VIM knockout using adenovirus, and also showed the therapeutic effect of inhibiting VIM on TMJOA.

[0057] This specific implementation is only an explanation of the present invention, not a limitation of the present invention. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. Application of ORM1 protein in the preparation of drugs for the treatment of temporomandibular joint osteoarthritis.

2. Use of the ORM1 protein according to claim 1 in the preparation of a drug for treating temporomandibular joint osteoarthritis, characterized in that: The ORM1 protein binds to vimentin VIM and inhibits the MAPK pathway, thereby downregulating the expression of MMP13 and MMP3, reducing cartilage matrix degradation, and maintaining cartilage homeostasis.

3. Use of the ORM1 protein according to claim 1 in the preparation of a drug for treating temporomandibular joint osteoarthritis, characterized in that: The concentration of ORM1 protein in the drug is 100-200 μg / mL.

4. Application of VIM knockout adenovirus in the preparation of drugs for the treatment of temporomandibular joint osteoarthritis.

5. Use of the VIM knockout adenovirus according to claim 4 in the preparation of a drug for treating temporomandibular joint osteoarthritis, characterized in that: The VIM knockout adenovirus is a plasmid carrying VIM shRNA, which is obtained by inserting the VIM shRNA fragment between the EcoRI and BamHI sites of the pHBAAV-U6-MCS-CMV-EGFP plasmid, and the VIM shRNA fragment is obtained by annealing the primers shown in the sequence SEQ ID NO.1-2.

6. A pharmaceutical composition for treating temporomandibular joint osteoarthritis, characterized in that: The VIM inhibitor is used as an active ingredient, and the VIM inhibitor is ORM1 protein or VIM knockout adenovirus.

7. The pharmaceutical composition for treating temporomandibular joint osteoarthritis according to claim 6, characterized in that: It comprises an active ingredient and a pharmaceutically acceptable carrier.

8. The pharmaceutical composition for treating temporomandibular joint osteoarthritis according to claim 6, characterized in that: The dosage form is injection, emulsion, tablet, powder, granule, gel, ointment, capsule or oral solution.

Images