SNP sites in the promoter region of MMP2 gene and their application in pig breeding

By detecting SNP sites in the promoter region of the MMP2 gene, the problem of assessing the age of puberty in pigs and selecting high-yielding breeding pigs in existing technologies has been solved. This enables accurate assessment of the age of puberty and the onset of puberty, improves the efficiency of breeding pig selection, and regulates the ferroptosis signaling pathway in ovarian granulosa cells, promoting follicle maturation and ovulation.

CN119410782BActive Publication Date: 2025-09-16SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411502454.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-25
Publication Date
2025-09-16
Estimated Expiration
2044-10-25

AI Technical Summary

Technical Problem

In the existing technology, there are no reports on the association between the SNP site in the promoter region of the MMP2 gene and the sexual maturity of sows, making it difficult to effectively assess the age of puberty in pigs and to select high-yielding breeding pigs.

Method used

By detecting the genotypes of SNP sites in the promoter region of the MMP2 gene, including g.30088284, g.30088004, g.30088855, g.30088669, g.30088615, g.30088475, g.30088228, and g.30088210, the gene can be used to assess the age of puberty in pigs, determine the onset of puberty, and select high-yielding breeding pigs. Furthermore, by overexpressing or knocking down the MMP2 gene, ferroptosis in ovarian granulosa cells can be regulated in vitro.

Benefits of technology

It enabled accurate assessment of the age of puberty and the onset of puberty in pigs, improved the efficiency of breeding pig selection, promoted follicle maturation and ovulation, and affected transcriptomic differences and ferroptosis signaling pathways in ovarian granulosa cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119410782B_ABST
    Figure CN119410782B_ABST
Patent Text Reader

Abstract

The present invention discloses SNP sites in the promoter region of the MMP2 gene and their application in pig breeding. The present invention takes the promoter region of the MMP2 gene as the research object, and uses molecular and cell biological methods to study its correlation with the sexual maturity of sows: it is found that the g.30088284G>A site and the g.30088004C>T site are significantly correlated with the age of sexual maturity of the Douro Black pig group; then, by transfecting different vectors, the different genotypes of the above sites are studied to affect the activity of the IRS1 gene promoter. Further, using sow ovarian granulosa cells as experimental materials, transcriptome sequencing, total iron colorimetry, malondialdehyde colorimetry and other experimental techniques are used to study the effect of the MMP2 gene on the transcription level and ferroptosis of sow ovarian granulosa cells. It is found that the differential genes in the cell transcriptome affected by the MMP2 gene are mainly enriched in signal pathways such as cell differentiation, promoting cell ferroptosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical fields of cell engineering and gene engineering, and particularly relates to a SNP site in a promoter region of a MMP2 gene and its application in pig breeding. Background Art

[0002] The first estrus and ovulation of an egg in a female mammal signifies sexual maturity and reproductive capacity. The follicle is the fundamental structural and functional unit of the ovary. Within the follicle, a single layer of flattened granulosa cells undergoes continuous proliferation and differentiation, ultimately leading to the maturation and rupture of the follicle, releasing follicular fluid and the oocyte. However, only a very small number of follicles develop to maturity and ovulate. During development, the granulosa cells initiate a programmed cell death process, regulating the follicle's atresia and degeneration. When 10% of the granulosa cells in a follicle undergo apoptosis, the follicle is considered to have entered a state of atresia. Single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by mutations such as deletions, transitions, insertions, and transversions of a single nucleotide. They are third-generation molecular genetic markers. These diallelic molecular markers offer advantages such as abundant loci, genetic stability, and ease of detection. These SNPs provide greater information for studying genetic variation in organisms, allowing for analysis of complex genetic problems. Currently, they are one of the most commonly used methods for assessing genetic diversity in biological populations.

[0003] Matrix metalloproteinase (MMP2) is a class of endopeptidases that degrades all extracellular matrix components, including type IV and V collagen. It participates in signal transduction and plays a role in tissue remodeling during the growth and development of extrauterine tissues and granulosa cells. The porcine MMP2 gene is located on chromosome 6. The protein has a relative molecular weight of 70 kDa and requires activation for proteolytic activity. Its mRNA is localized in theca cells and stroma. It has been reported that ovaries of sows with delayed sexual maturation (no sexual maturation signals at 8 months of age) exhibit a greater number of atretic and degenerated follicles, with a maximum diameter of less than 4 mm, compared to ovaries of pre-mature (6 months of age) and normally mature (7 months of age, the day estrus was first observed). Whole-genome DNA methylation sequencing of porcine sows revealed that methylation levels in the MMP2 gene promoter region are closely associated with sexual maturity in sows. MMP2 encodes a matrix metalloproteinase that hydrolyzes type IV collagen. Upon activation, this protease degrades type IV collagen in the connective tissue of theca surface and proteins in the follicular fluid that regulate GC proliferation and differentiation, promoting follicular maturation and ovulation. However, no SNPs in the MMP2 gene promoter region have been linked to sexual maturation in sows. Summary of the Invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, one of the objectives of the present invention is to provide a SNP site in the promoter region of the MMP2 gene.

[0005] The second purpose of the present invention is to provide the application of the above-mentioned SNP site in the promoter region of the MMP2 gene in pig breeding.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The SNP site in the promoter region of the MMP2 gene includes at least one of the following SNP molecular markers:

[0008] (1) The SNP site corresponding to the G>A mutation at position g.30088284 (i.e., -1253 bp in the promoter region of the porcine matrix metalloproteinase (MMP2) gene) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0009] (2) The SNP site corresponding to the C>T mutation at position g.30088004 (i.e., -973 bp in the promoter region of the matrix metalloproteinase (MMP2) gene) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0010] (3) The SNP site corresponding to the C>T mutation at position g.30088855 (i.e., -1825 bp in the promoter region of the porcine matrix metalloproteinase (MMP2) gene) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0011] (4) The SNP site corresponding to the T>C mutation at position g.30088669 (i.e., the promoter region of the matrix metalloproteinase (MMP2) gene -1638 bp) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0012] (5) The SNP site corresponding to the G>A mutation at position g.30088615 (i.e., -1584 bp in the promoter region of the porcine matrix metalloproteinase (MMP2) gene) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0013] (6) The SNP site corresponding to the T>C mutation at position g.30088475 (i.e., -1444 bp in the promoter region of the matrix metalloproteinase (MMP2) gene) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0014] (7) The SNP site corresponding to the G>C mutation at position g.30088228 (i.e., -1197 bp in the promoter region of the porcine matrix metalloproteinase (MMP2) gene) on chromosome 6 of the porcine reference genome Sscrofa11.1;

[0015] (8) The SNP site corresponding to the C>T mutation at position g.30088210 (i.e., -1179bp in the promoter region of the matrix metalloproteinase (MMP2) gene) on chromosome 6 of the pig reference genome Sscrofa11.1.

[0016] Furthermore, the SNP site in the promoter region of the MMP2 gene is preferably at least one of the SNP molecular marker (1) and the SNP molecular marker (2).

[0017] The application of the SNP site in the promoter region of the MMP2 gene includes at least one of the following applications:

[0018] A. Application in assessing the age of puberty in pigs;

[0019] B. Application in judging the onset of puberty in pigs;

[0020] C. Application in breeding high-yield pig breeds.

[0021] Furthermore, in the application A, the genotype of the g.30088284 locus is detected, and the age of puberty of individuals with the genotype of AA is shorter than that of GG and GA individuals; and / or, the genotype of the g.30088004 locus is detected, and the age of puberty of individuals with the genotype of TT is shorter than that of CC and CT individuals; the genotype of the g.30088855 locus is detected, and the age of puberty of individuals with the genotype of CC is shorter than that of CT and TT individuals; and / or, the genotype of the g.30088669 locus is detected, and the age of puberty of individuals with the genotype of CT and TT is shorter than that of The age at puberty is shorter than that of CC individuals; the genotype of the g.30088615 locus is detected, and the age at puberty of individuals with the genotype of GG is shorter than that of AA individuals; and / or, the genotype of the g.30088475 locus is detected, and the age at puberty of individuals with the genotype of TC is shorter than that of TT individuals; the genotype of the g.30088228 locus is detected, and the age at puberty of individuals with the genotype of CC is shorter than that of GG and GC individuals; and / or, the genotype of the g.30088210 locus is detected, and the age at puberty of individuals with the genotype of TT is shorter than that of CC and CT individuals.

[0022] Furthermore, in the application B, the genotype of the g.30088284 locus is detected, and the individual with the genotype of AA starts puberty faster than the GG and GA individuals; and / or, the genotype of the g.30088004 locus is detected, and the individual with the genotype of TT starts puberty faster than the CC and CT individuals; the genotype of the g.30088855 locus is detected, and the individual with the genotype of CC starts puberty faster than the CT and TT individuals; and / or, the genotype of the g.30088669 locus is detected, and the individual with the genotype of CT and TT starts puberty faster than the CC and TT individuals. The onset of first puberty is faster than that of CC individuals; the genotype of the g.30088615 locus is detected, and the individual with the genotype of GG starts puberty faster than that of AA individuals; and / or, the genotype of the g.30088475 locus is detected, and the individual with the genotype of TC starts puberty faster than that of TT individuals; the genotype of the g.30088228 locus is detected, and the individual with the genotype of CC starts puberty faster than that of GG and GC individuals; and / or, the genotype of the g.30088210 locus is detected, and the individual with the genotype of TT starts puberty faster than that of CC and CT individuals.

[0023] Furthermore, in the application C, the genotype of the g.30088284 site is detected, and individuals with genotypes of AA and AA are selected as breeding pigs; and / or, the genotype of the g.30088004 site is detected, and individuals with genotypes of TT are selected as breeding pigs; the genotype of the g.30088855 site is detected, and individuals with genotypes of CC are selected as breeding pigs; and / or, the genotype of the g.30088669 site is detected, and individuals with genotypes of CT and TT are selected as breeding pigs; the genotype of the g.30088615 site is detected, and individuals with genotypes of GG are selected as breeding pigs; and / or, the genotype of the g.30088475 site is detected, and individuals with genotypes of TC are selected as breeding pigs; the genotype of the g.30088228 site is detected, and individuals with genotypes of CC are selected as breeding pigs; and / or, the genotype of the g.30088210 site is detected, and individuals with genotypes of TT are selected as breeding pigs.

[0024] Furthermore, the pigs include any one of Duroc and its synthetic lines.

[0025] The above applications are for non-diagnostic purposes.

[0026] A primer for identifying the SNP site in the promoter region of the MMP2 gene, comprising:

[0027] F: 5′-ACGTCTCCGTAGCTCAAGTC-3′;

[0028] R: 5′-TCCCCCTGCCCAAGGATATT-3′.

[0029] Application of the MMP2 gene in regulating ferroptosis in porcine ovarian granulosa cells, wherein the application is any one or more of the following applications:

[0030] I. Application of overexpression of MMP2 gene to inhibit ferroptosis of ovarian granulosa cells in vitro;

[0031] II. Application of knocking down the MMP2 gene to promote ferroptosis of ovarian granulosa cells in vitro.

[0032] Furthermore, the overexpression of the MMP2 gene is achieved by the following method: connecting the nucleic acid molecule encoding the porcine MMP2 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing the MMP2 gene into sow ovarian granulosa cells cultured in vitro.

[0033] Furthermore, the knockdown of the MMP2 gene is achieved by transfecting siRNA, and the siRNA sequence is as follows: MMP2-siRNA: 5′-GCAAACAGGACATCGTCTT-3′.

[0034] The promotion or inhibition of ferroptosis is determined by measuring the total iron and malondialdehyde (MDA) content and comparing the mRNA and protein expression levels of pathway marker genes.

[0035] The verification results of the present invention are as follows:

[0036] 1. Fifteen SNP sites were discovered in the promoter region of the MMP2 gene.

[0037] 2. The age of sexual maturity of individuals with CC genotype at g.30088855C>T locus was significantly earlier than that of individuals with CT and TT genotypes; the age of sexual maturity of individuals with CT and TT genotypes at g.30088669T>C locus was significantly earlier than that of CC genotype individuals; the age of sexual maturity of individuals with GG genotype at g.30088615G>A locus was significantly earlier than that of AA genotype individuals; the age of sexual maturity of individuals with TC genotype at g.30088475T>C locus was significantly earlier than that of TT genotype individuals; g.30088284G>A site AA genotype individuals reached sexual maturity at an earlier age than GG and GA genotype individuals; g.30088228G>C site CC genotype individuals reached sexual maturity at an earlier age than GG and GC genotype individuals; g.30088210C>T site TT genotype individuals reached sexual maturity at an earlier age than CC and CT genotype individuals; g.30088004C>T site TT genotype individuals reached sexual maturity at an earlier age than CC and CT genotype individuals.

[0038] 3. Before the mutation of g.30088284G>A site, it may bind to transcription factors AP-2α and SP1, and after the mutation, it may bind to transcription factor SP1; before the mutation of g.30088004C>T site, it may bind to transcription factors SP1 and CPE-bind, and after the mutation, it may bind to transcription factor SP1.

[0039] 4. The MMP2 gene promoter activity in the Mut-8284 group was significantly lower than that in the WT-8284 group; the MMP2 gene promoter activity in the Mut-8004 group was significantly lower than that in the WT-8004 group.

[0040] 5. By transfecting sow ovarian granulosa cells with a 1000 ng / mL overexpression vector and measuring MMP2 expression using qRT-PCR, we found that the transfection efficiency of pcDNA3.1-MMP2 was good, with significant differences. For subsequent studies, 1000 ng / mL was selected as the transfection concentration for pcDNA3.1-MMP2.

[0041] 6. Synthesize a small MMP2 interference fragment / control (MMP2-siRNA / siRNA-NC) and test its interference efficiency. The results show that the MMP2-siRNA small fragment has a good interference effect when transfected into sow ovarian granulosa cells by qRT-PCR, and will be used for subsequent experiments.

[0042] MMP2-siRNA: 5′-GCAAACAGGACATCGTCTT-3′;

[0043] 7. In the pcDNA3.1-MMP2 group, 169 genes were significantly upregulated and 357 genes were significantly downregulated. The differentially expressed genes were mainly involved in biological processes such as the G protein-coupled receptor signaling pathway, the ERBB signaling pathway, the epidermal growth factor receptor signaling pathway, the phospholipase-activated G protein-coupled signaling pathway, and the negative regulation of leukocyte-mediated immunity.

[0044] 8. There were 115 genes significantly upregulated and 176 genes significantly downregulated in the MMP2-siRNA group. The differentially expressed genes were mainly involved in signaling pathways such as cell differentiation, humoral immune response mediated by circulating immunoglobulins, and complement activation of activated immune responses.

[0045] 9. The total iron ion level of cells in the pcDNA3.1-MMP2 group was higher than that in the control group, but did not reach a statistically significant level. The total iron ion level of cells in the MMP2-siRNA group was significantly lower than that in the control group.

[0046] 10. The MDA level of cells in the pcDNA3.1-MMP2 group was significantly higher than that in the control group, and the MDA level of cells in the MMP2-siRNA group was significantly lower than that in the control group.

[0047] 11. Overexpression of MMP2 significantly reduced the mRNA and protein expression levels of GPX4 and SLC7A11 genes, and significantly increased the mRNA and protein expression levels of P53. Knockdown of MMP2 significantly increased GPX4 and SLC7A11 mRNA, with no significant difference in protein levels, and significantly reduced the mRNA and protein expression levels of P53. In summary, MMP2 can promote ferroptosis in cells.

[0048] The present invention has the following advantages and effects compared to the prior art:

[0049] 1. The present invention uses ear-like tissue of Duroc pigs (Duroc pigs × country black pigs) as experimental materials, adopts Sanger sequencing technology to discover SNP sites in the promoter region of the MMP2 gene, and studies the relationship between SNP sites and the age of sexual maturity of the Duroc pig population: Combining trait association analysis and population genetic structure analysis, it was found that g.30088855C>T, g.30088669T>C, g.30088615G>A, g.30088475T>C, g.30088284G>A, g.30088228G>C, g.30088210C>T, and g.30088004C>T sites are significantly associated with the age of sexual maturity of the Duroc pig population.

[0050] 2. This study used the eight SNPs described above as research targets, employing molecular and cell biology methods to investigate their application in sow ovarian granulosa cells. Using bioinformatics websites to predict potential transcription factor binding sites, the g.30088284G>A and g.30088004C>T sites were selected for subsequent research. Transfection with WT-8284, Mut-8284, WT-8004, and Mut-8004 vectors revealed significantly lower cell viability in the Mut-8284 and Mut-8004 groups compared to the control group. This study demonstrates promising application for studying the effects of MMP2 gene promoter SNPs on sexual maturation in sows.

[0051] 3. The present invention uses sow ovarian granulosa cells as experimental materials, and adopts transcriptome sequencing, total iron colorimetry, malondialdehyde (MDA) colorimetry, qRT-PCR, Western Blot and other experimental techniques to study the effect of MMP2 gene on the transcription level and ferroptosis of sow ovarian granulosa cells. It is found that the differential genes affected by the MMP2 gene in the cell transcriptome are mainly enriched in signal pathways such as cell differentiation, thereby inhibiting cell ferroptosis.

[0052] 4. The technical solution of the present invention is well designed and the results are reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is the result of PCR amplification of the MMP2 gene promoter region.

[0054] Figure 2 This is a diagram showing the effect of SNP sites on MMP2 gene promoter activity.

[0055] Figure 3 This is a graph showing the efficiency detection of the overexpression vector pcDNA3.1-MMP2.

[0056] Figure 4 This is a graph showing the efficiency detection of the interference fragment MMP2-siRNA.

[0057] Figure 5 This is an analysis diagram of the effects of overexpression / interference of the MMP2 gene on the transcriptional level of pig ovarian granulosa cells; among them, a and b are the effects of overexpression of MMP2 on the transcriptional level of sow ovarian granulosa cells; c and d are the effects of interference with MMP2 on the transcriptional level of sow ovarian granulosa cells.

[0058] Figure 6 This is a graph showing the total iron ion level in pig ovarian granulosa cells detected by total iron colorimetry using overexpression / interference of the MMP2 gene.

[0059] Figure 7 This is a diagram of the malondialdehyde (MDA) level in pig ovarian granulosa cells detected by overexpression / interference of MMP2 gene using the malondialdehyde (MDA) colorimetric method.

[0060] Figure 8 It is a diagram for detecting the effects of overexpression / interference of MMP2 gene on the levels of key genes in the ferroptosis signaling pathway of pig ovarian granulosa cells; wherein, a is the effect of overexpression of MMP2 on the transcriptional levels of key genes in the ferroptosis signaling pathway of sow ovarian granulosa cells; b is the effect of interfering with MMP2 on the protein expression levels of key genes in the ferroptosis signaling pathway of sow ovarian granulosa cells. DETAILED DESCRIPTION

[0061] The present invention will be described in further detail below with reference to the examples and accompanying drawings, but the embodiments of the present invention are not limited thereto. The experimental methods in the following examples where specific conditions are not specified are generally based on conventional conditions. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0062] In the present invention, statistical methods were applied to analyze the results of three independent experiments in each embodiment, and the "mean ± standard deviation" was calculated. The significance of the difference was analyzed using one-way analysis of variance ("*" indicates P < 0.05, and "**" indicates P < 0.01 in the figure).

[0063] The test samples collected in the following examples are ear samples of a binary hybrid pig of Duroc and Country Black pig (abbreviated as Duroc Black pig). The sampling site is located at the Niujiaowan R&D site of Guangdong No. 1 Food Co., Ltd., and all pigs are fed and managed using the same standards.

[0064] The present invention uses R language (v4.03) and general linear model (GLM) to analyze the genetic association between SNP and puberty. The model is as follows:

[0065] Yij=L+Gj

[0066] where Yij is the observed age at puberty for the i-th animal, L is the mean age at puberty, and Gj represents the genotype effect. Different genotypes were coded as dummy variables based on categorical variables. Statistics are presented as mean ± SD.

[0067] Example 1: DNA extraction

[0068] This experiment used the traditional chloroform method to extract sow genomic DNA. The specific steps are as follows:

[0069] (1) Tissue sample processing:

[0070] Take approximately 0.2 g of pig ear tissue sample and place it in a labeled 2 mL centrifuge tube. Use sterile ophthalmic surgical scissors to mince the ear sample thoroughly and evenly in the centrifuge tube.

[0071] (2) Tissue lysis and digestion:

[0072] Add 1 ml of tissue lysis buffer to the centrifuge tube in step (1). Subsequently, add 40 ml of 20 mg / ml proteinase K. Immediately cap the centrifuge tube and gently invert it several times to ensure that the proteinase K and tissue lysis buffer are thoroughly mixed. Place the centrifuge tube in a preheated 56°C water bath and digest overnight until the ear sample tissue is completely dissolved.

[0073] (3) After the sample is completely digested, centrifuge it at 12,000 rpm for 10 min at 4°C.

[0074] (4) Take 950 μL of supernatant, add an equal volume of Tris-saturated phenol, shake well for 10 minutes, and centrifuge at 12,000 rpm for 10 minutes in a 4°C low-temperature centrifuge.

[0075] (5) Take 900 μL of the supernatant and place it in a new 2 mL centrifuge tube. Add 900 μL of an equal volume of phenol-formaldehyde mixture, shake well for 10 minutes, and centrifuge at 12,000 rpm in a 4°C low-temperature centrifuge for 10 minutes.

[0076] (6) Take 850 μL of the supernatant and place it in a new 2 mL centrifuge tube. Add 850 μL of an equal volume of phenol-formaldehyde mixture, shake well for 10 minutes, and centrifuge at 12,000 rpm in a 4°C low-temperature centrifuge for 10 minutes.

[0077] (7) Take 800 μL of the supernatant and place it in a new 2 mL centrifuge tube. Add 800 μL of an equal volume of phenol-formaldehyde mixture, shake well for 10 minutes, and centrifuge at 12,000 rpm in a 4°C low-temperature centrifuge for 10 minutes.

[0078] (8) Take 750 μL of the supernatant and quickly add 800 μL of pre-cooled anhydrous ethanol. Gently invert the tube to mix until a white precipitate is formed.

[0079] (9) Gently pick up the precipitated DNA with a pipette tip, transfer it to a 1.5 mL centrifuge tube, add 800 μL of 75% alcohol for rinsing, and centrifuge it at 12,000 rpm in a 4°C low-temperature centrifuge for 10 min.

[0080] (10) Remove excess alcohol, place in a clean bench fume hood, and open the centrifuge tube cap for a while. Add 200 μL of Elution Buffer preheated to 37°C and pipette thoroughly to dissolve. Store in a -20°C refrigerator.

[0081] Experimental Example 2: RNA Extraction

[0082] The specific operation process of extracting RNA using Trizol as lysis buffer is as follows:

[0083] (1) Treatment of adherent cells: Taking a 6-well plate as an example, add 500 μL Trizol to each well, place the cell culture plate on ice for 10-15 minutes, then use a pipette to blow down the cells of the same treatment group and collect them together. Centrifuge them at 12,000 rpm for 5 minutes at 4°C. Carefully transfer the supernatant to a new 1.5 mL RNase-free tube, avoiding the absorption of impurities.

[0084] (2) Mix chloroform and Trizol at a ratio of 1:5, add 1 mL of the mixed chloroform to the supernatant, shake and mix, then let it stand on ice for 5 minutes, centrifuge at 12000 rpm in a 4°C cold centrifuge for 5 minutes, and carefully transfer the upper aqueous phase to a new 1.5 mL RNase-free tube;

[0085] (3) Add 1 mL of a mixture of isopropanol and Trizol (isopropanol:Trizol = 1:2), gently invert and mix, let stand on ice for 10 min, centrifuge at 12,000 rpm at 4°C for 10 min, and discard the supernatant;

[0086] (4) Add 1 mL of 75% ethanol-DEPC (75% ethanol:DEPC = 1:1) pre-cooled to 4°C, gently pipette the RNA precipitate to wash the RNA, then centrifuge at 12,000 rpm for 15 min at 4°C, and discard the supernatant;

[0087] (5) Open the centrifuge tube lid and allow the RNA to dry at room temperature for 5 to 10 minutes to evaporate the ethanol as much as possible, but also prevent the RNA precipitate from over-drying;

[0088] (6) Add 30 μL of DEPC water pre-cooled to 4°C to dissolve the RNA precipitate and store in a -80°C refrigerator.

[0089] Example 3: Genomic DNA and RNA quality detection and concentration determination

[0090] (1) Detection of RNA and DNA integrity by agarose gel electrophoresis

[0091] Prepare a 1% agarose gel: Add 1× TAE buffer and agarose powder in the correct proportions to a conical flask. Microwave and heat for 3–5 minutes to completely dissolve. Remove and cool briefly. Add 1–3 μL of EB stain, shake gently, and pour into a plate. Insert a comb and let stand at room temperature for 30 minutes before use. Add 5 μL of the DNA or RNA solution to be tested to 1 μL of 6× Loading Buffer and mix thoroughly. Apply the sample to the 1% agarose gel in an electrophoresis tank. Run the electrophoresis instrument at 150 V / cm for 25 minutes. After electrophoresis, observe the gel in a UV analyzer and photograph it. DNA samples should have a single band, while RNA samples should show three small RNA bands: 28S, 18S, and 5S. No obvious degradation should be observed.

[0092] (2) Detection of genomic DNA concentration and purity

[0093] NanoDrop 2000 UV Spectrophotometer (Thermo): Turn on the instrument and select double-stranded nucleic acid (DNA) or single-stranded nucleic acid (RNA) measurement. Pipette 1 μL of Elution Buffer to clean the assay base and click the Blank button to calibrate. Gently wipe the base with qualitative filter paper and add 1 μL of the DNA or RNA sample to be measured. Click the Measure button to measure.

[0094] After the measurement is complete, rinse the assay base with Elution Buffer and turn off the instrument. Acceptable DNA / RNA sample standards: A260 / A230 ratio between 1.8 and 2.2, and A260 / A280 ratio between 1.7 and 2.1.

[0095] Example 4: Cloning of the porcine MMP2 gene promoter sequence

[0096] The promoter sequence of the porcine MMP2 gene (Gene ID: 397391) was searched in the NCBI database, and specific primers for cloning the MMP2 gene promoter sequence were designed. The primer sequences are as follows:

[0097] F: 5′-AGTCTACAGAGGGACGGGTT-3′;

[0098] R: 5′-GGCACTGTCTAAGCAACAGC-3′.

[0099] The promoter region of MMP2 gene was amplified using the DNA extracted from pig ears of Doumbra fasciatus as template.

[0100] Example 5: Culture of sow ovarian granulosa cells

[0101] (1) Ovaries of healthy commercial sows were collected at Kongwangji Slaughterhouse in Huangpu District, Guangzhou. Ovaries with a rosy, shiny surface, normal development, and moderate size were selected and placed in PBS containing 1% double-antibody. Ice packs were placed around them to keep the temperature low and the ovaries were quickly brought back to the cell room for subsequent experiments.

[0102] (2) Wash the sow ovaries 2-3 times with PBS containing 1% double antibody, then soak them in 75% alcohol for 30 seconds, and finally wash the ovaries with PBS containing 1% double antibody until the solution is clear and transparent. After sealing, quickly transfer them to the clean bench in the cell room for operation;

[0103] (3) Add 4 mL of DMEM medium to a 15 mL centrifuge tube, use forceps to pick up the ovary, use a disposable 1 mL sterile syringe to draw 1.5 mL of follicular fluid, inject it into the 15 mL centrifuge tube prepared with medium, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant;

[0104] (4) Add 3 mL of PBS containing 2% double-antibody to resuspend and wash the cells, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0105] (5) Repeat the above steps once;

[0106] (6) Add 1 mL of complete culture medium and gently pipette to resuspend the cells. Inoculate the cells in a 75 cm 2 The cells were placed in a cell culture flask and cultured in a 37°C, 5% CO2 cell culture incubator;

[0107] (7) After 48 h of culture, observe the cell adhesion using an inverted microscope and change the medium or plate the cells according to their growth status.

[0108] Example 6: Inoculation and transfection of recombinant plasmids

[0109] 1. Inoculation and transfection of mutation site recombinant plasmid

[0110] (1) When the cell confluence reaches 70-80%, discard the old culture medium and wash the adherent cells 1-2 times with PBS containing 2% double antibody;

[0111] (2) The same as steps ② to ⑥ in the subculture process;

[0112] (3) Gently pipette an appropriate amount of complete culture medium to resuspend the cells, inoculate an appropriate amount of the cell suspension in a cell culture plate, gently shake to evenly distribute the cells, and place in a 37°C, 5% CO2 incubator. Observe after 24 hours and proceed with subsequent experiments based on the growth status.

[0113] (4) Transfection can be performed only when the cell confluence reaches 70-80%;

[0114] (5) Press Prepare transfection reagent according to the 3000 kit instructions. Prepare solution A: Opti-MEM and Lipofectamine TM Prepare Solution B: Gently mix Opti-MEM, recombinant plasmid, pGL-TK plasmid and P3000, add Solution A to Solution B, gently pipette to mix, incubate at room temperature in the dark for 15 minutes, add to cell culture plates, and perform transfection (each treatment group requires at least 3 replicates). After transfection, culture in a 37°C, 5% CO2 incubator.

[0115] Among them, the pRL-TK plasmid is a commercially available plasmid obtained from the Key Laboratory of Agricultural Animal Genomics and Molecular Breeding of Guangdong Province; the recombinant plasmids include the wild-type and mutant vectors at the g.30088284G>A site, named WT-8284 and Mut-8284; and the wild-type and mutant vectors at the g.30088004C>T site, named WT-8004 and Mut-8004; all were commissioned to Wuhan Jinkairui Bioengineering Co., Ltd. for synthesis. The basic plasmid used was pGL3-basic, with KpnI and XhoI cloning sites. The target sequences are as follows:

[0116] WT-8284 target sequence: GAGGCCATGGACCTGAGCCAAGTGGGGCTGAGCCAGGAGGCAACCCCCTCCCCCGCTGACCTTAGACTCACCCTCACGCACACAGCCAGGCTTCTCCCCAGGTCAGGCTGAGGGGCCTGGGCCCCTTCTGTGGGGTGACGTCCCTCCCAAGGGGCGCCTTTCGGAGGGACCTCTGGCTAGCCAGCAACATATGCGTGCCAGGCAAGCCTGTGTTTGTCTGAAACCCACTGAGACCCAAGCTGCAGAGGCTT

[0117] Mut-8284 target sequence: GAGGCCATGGACCTGAGCCAAGTGGGGCTGAGCCAGGAGGCAACCCCCTCCCCCGCTGACCTTAGACTCACCCTCACGCACACAGCCAGGCTTCTCCCCAGGTCAGGCTGAGGGGCCTGAGCCCCTTCTGTGGGGTGACGTCCCTCCCAAGGGGCGCCTTTCGGAGGGACCTCTGGCTAGCCAGCAACATATGCGTGCCAGGCAAGCCTGTGTTTGTCTGAAACCCACTGAGACCCAAGCTGCAGAGGCTT

[0118] WT-8004 target sequence: TGCAGAGGCTTTTCTGGTTCTTACATTAAAGACCAGATACATCGCCCTGACTTCCAAGGCCCTCACAGGCAGGCGGTTGCTGTGACCCTTTCAGGGCATGATTTTGCTCCTCAAAATGGTCTCTGCTAACTCCCAGTCCCATCTCCTCCCCCTGTCCCCCCAATCTTCAGATAGAGGACACTTCCTTCTCCAGTGCACCTCGCTGGCCTGCCTCTCTGGACCTTCGTAAATGCTGTTGCTTAGACAGTGCCTTCAGCATCCCTCCCGCCCCCACCCCCACCCCACCCCACCCCCCTCTCCAACGCTCCTGTCTTAGACCTCTTCAGGTTTCAGCCCAGTAATGACTTCTTCCAGGAAGCCTTCCAGGATCACCTGTACTAGTTT

[0119] Mut-8004 target sequence: TGCAGAGGCTTTTCTGGTTCTTACATTAAAGACCAGATACATCGCCCTGACTTCCAAGGCCCTCACAGGCAGGCGGTTGCTGTGACCCTTTCAGGGCATGATTTTGCTCCTCAAAATGGTCTCTGCTAACTCCCAGTCCCATCTCCTCCCCCTGTCCCCTCAATCTTCAGATAGAGGACACTTCCT TCTCCAGTGCACCTCGCTGGCCTGCCTCTCTGGACCTTCGTAAATGCTGTTGCTTAGACAGTGCCTTCAGCATCCCTCCCGCCCCCACCCCCACCCCACCCCACCCCTCTCCAACGCTCCTGTCTTAGACCTCTTCAGGTTTCAGCCCAGTAATGACTTCTTCCAGGAAGCCTTCCAGGATCACCTGTACTAGTTT.

[0120] (6) Conduct subsequent experiments according to the expected experimental plan.

[0121] 2. Inoculation and transfection of pcDNA3.1-MPP2 or MPP2-siRNA

[0122] Observe the cell status. When the confluency of porcine GCs reaches approximately 80%, discard the culture medium in the flask, rinse twice with PBS containing 1% penicillin-streptomycin, and discard the PBS. Add 3 mL of trypsin to the flask and place it in a cell culture incubator for 5 minutes. Observe the cell adhesion under a microscope. When most cells appear round and float with the liquid, digestion is complete. Add 4 mL of complete culture medium to terminate digestion. After pipetting the flask wall with a pipette tip, transfer the mixture to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes at room temperature. Discard the supernatant, rinse twice with PBS containing 1% penicillin-streptomycin, and discard the supernatant. Resuspend the cells in 3 mL of complete culture medium and plate them into a cell culture plate. Gently shake the tube to mix thoroughly and incubate in a 37°C, 5% CO2 incubator. After 24 hours, observe the cell adhesion and growth. When the GCs reach 70-80% confluency, discard the complete culture medium, rinse twice with PBS, and add incomplete culture medium.

[0123] Prepare solution A: Opti-MEM and Lipofectamine TMMix thoroughly at 3000°C. Prepare Solution B: Mix Opti-MEM, overexpression plasmid, and P3000, or Opti-MEM and small RNA fragments, and mix gently. Add Solution A to Solution B, pipette gently to mix, and incubate at room temperature in the dark for 15 minutes. The overexpression plasmid was constructed as follows:

[0124] Basic plasmid: pcDNA3.1 plasmid

[0125] Insertion sites: BstEII and NotI

[0126]

[0127] The sequence of the small RNA fragment siRNA is as follows: 5′-GCAAACAGGACATCGTCTT-3′.

[0128] Add the AB solution mixture to the cell culture plate and gently shake it in a "cross" pattern to thoroughly mix the mixture with the culture medium. Then place the culture plate in a constant temperature 5% CO2 cell culture incubator for 24 hours of transfection. Perform subsequent experiments according to the experimental design.

[0129] Example 7: Dual fluorescence activity detection of recombinant plasmid in the promoter region of MMP2 gene

[0130] Refer to the instructions of the dual-luciferase assay kit to detect the dual fluorescence activity of the recombinant plasmid in the MMP2 gene promoter region. The steps are as follows:

[0131] (1) 24 hours after transfection, discard the culture medium and wash the cells twice with PBS containing 1% double antibody. Add 100 μL of cell lysis buffer to each well, gently shake the cell culture plate to allow the cell lysis buffer to completely cover the cells, and incubate the cell culture plate on ice for 5 minutes.

[0132] (2) Pipette 50 μL of cell lysate and add it to the dual fluorescence detection plate. Add 75 μL of Luciferase Assay Reagent to each well, pipette gently to mix, incubate at room temperature for 15 minutes, and then detect the luminescence value.

[0133] (3) Add 75 μL of Stop& Reagent, mix gently by pipetting, incubate at room temperature for 15 min, and then detect the luminescence value.

[0134] (4) Calculation: Relative activity of firefly luciferase = luminescence value of firefly luciferase / luminescence value of Renilla luciferase.

[0135] Experimental Example 8: Strand-specific transcriptome sequencing

[0136] (1) Take a certain amount of total RNA sample and use oligodT to obtain mRNA from the total RNA;

[0137] (2) mRNA disruption;

[0138] (3) Fragmented mRNA is added with random primers to synthesize one strand of cDNA;

[0139] (4) cDNA second-strand synthesis, using dUTP instead of dTTP;

[0140] (5) End-repair, A addition, and adapter ligation of double-stranded cDNA;

[0141] (6) PCR and PCR product recovery;

[0142] (7) Library quality testing;

[0143] (8) Circularization of library products;

[0144] (9) Circular DNA molecules replicate through rolling circles to form DNA nanoballs (DNBs) 10. Sequencing is performed on the DNBSEQ platform.

[0145] Experimental Example 9: Detection of total cellular iron ion levels

[0146] (1) Reagent preparation

[0147] ① Before testing, remove the reagent and allow it to return to room temperature.

[0148] ② Prepare 100 μmol / L iron standard: Mix 20 μL of Reagent 3 with 1980 μL of ddH2O. Prepare as needed and use immediately.

[0149] ③ Dilution of standards of different concentrations (Table 1):

[0150] Table 1 Standard dilution system

[0151]

[0152] (2) Sample processing

[0153] Cell sample: Collect about 1×10 6 For each cell, add 200 μL of reagent 1, mix thoroughly, place on ice for 10 min, centrifuge at 15,000 × g at 4°C for 10 min, and collect the supernatant.

[0154] (3) Operation steps

[0155] ① Standard wells: Take 80 μL of standard samples of different concentrations and add them to the corresponding wells of the ELISA plate. Assay wells: Take 80 μL of the sample to be tested and add them to the corresponding wells of the ELISA plate.

[0156] ② Add 80 μL of reagent 2 to each well.

[0157] ③ Shake gently to mix, and incubate in a 37℃ constant temperature incubator for 40 minutes.

[0158] ④ Use a microplate reader to measure the OD value of each well at 593 nm.

[0159] (4) Calculate the total iron ion content in cells (nmol / 10 6 ):

[0160]

[0161] Note: Standard fitting curve: y=ax+b

[0162] y: Standard OD value - blank OD value (OD value when the standard concentration is 0)

[0163] x: concentration of the standard

[0164] a: slope of the curve

[0165] b: intercept of the curve

[0166] ΔA: Absolute OD value of the sample - OD value of the test well + OD value of the blank well

[0167] N: Number of cell samples used for lysis (calculated by cell number) / 10 6

[0168] V: Volume of reagent added when processing cell samples (mL)

[0169] f: dilution factor of the sample before adding it to the detection system

[0170] Experimental Example 10: Malondialdehyde (MDA) Level Detection

[0171] (1) Reagent preparation:

[0172] ① Before testing, remove the reagent and allow it to return to room temperature.

[0173] ② Reagent 1 may solidify when stored in a 4°C refrigerator. It can be heated in a 37°C constant temperature water bath and used only after the liquid melts to a transparent state.

[0174] ③ If reagent 3 precipitates, it needs to be heated and dissolved in a constant temperature water bath at 80℃ and used after cooling.

[0175] ④Prepare reagent 2 application solution:

[0176] Reagent 2: double-distilled water = 1.2:34, store at 4°C for 3 months.

[0177] ⑤ Prepare the working solution: Prepare it in the ratio of Reagent 1: Reagent 2 application solution: Reagent 3 = 0.2:3:1, and use it immediately after preparation.

[0178] (2) Sample preparation

[0179] Take at least 3×10 6 Discard the cell culture medium and digest the cells with trypsin. Transfer the cells from the same treatment group to a 1.5 mL sterile centrifuge tube, add 500 μL of Reagent V extraction solution, mix by inversion for 2 minutes, and use an ultrasonic disruptor or a glass homogenizer to manually homogenize the cells to make a suspension for testing.

[0180] Note: Ultrasonic crushing: The ultrasonic crusher can select parameters of 90W, 4s / time, 2s interval, and total time of 10min.

[0181] (3) Operation steps

[0182] ① Add 100 μL of anhydrous ethanol (blank tube), 100 μL of 10 nmol / mL standard (standard tube), and 100 μL of the sample to be tested (sample tube) to the corresponding 1.5 mL EP tubes.

[0183] ②Add 1 mL of working solution to each tube in ①.

[0184] ③Wrap the EP tube mouth with aluminum foil, mix it upside down, and place it in a 100℃ water bath for 40 minutes.

[0185] ④ Cool to room temperature and centrifuge at 1078×g for 10 min.

[0186] ⑤ Transfer 250 μL of the supernatant to a 96-well plate. (Do not add the precipitate to the ELISA plate.)

[0187] ⑥ Use an enzyme-labeled instrument to measure the OD value of the test solution at 532 nm.

[0188] (4) Calculate the malondialdehyde content in cells (nmol / mgprot):

[0189]

[0190] ΔA1: OD value of the measuring tube - OD value of the blank tube

[0191] ΔA2: OD value of standard tube - OD value of blank tube

[0192] C: Standard concentration (10 nmol / mL)

[0193] f: dilution factor of the sample before adding it to the detection system

[0194] Cpr: protein concentration of the sample to be tested (mgprot / mL)

[0195] Experimental Example 11: qRT-PCR detection of gene expression

[0196] According to the target gene CDS region sequence information provided by the NCBI database, the primer-blast function in the NCBI website was used to design the target gene quantitative primers. GAPDH was used as an internal reference. The length of the qRT-PCR product generally did not exceed 300 bp (Table 2).

[0197] Table 2 qRT-PCR primer list

[0198]

[0199]

[0200] Note: All the above primers belong to pig species.

[0201] The qRT-PCR process was performed according to the instructions for the Maxima SYBR Green qPCR Master Mix reagent. The qRT-PCR reaction system is shown in Appendix 3. The Ct values ​​of the reference gene and the target gene were obtained by qRT-PCR, and the relative expression of the target gene was calculated using the 2-ΔΔCt method:

[0202] Relative expression level = 2 -[(实验组目的基因Ct值-实验组内参Ct值)-(对照组目的基因Ct值-对照组内参Ct值)]

[0203] Table 3 qRT-PCR reaction system

[0204]

[0205] Note: The reaction program is 95℃ for 15 min; 95℃ for 5 s, 60℃ for 1 min, 40 cycles.

[0206] Experimental Example 12: Western Blot

[0207] (1) Total protein extraction (taking 6-well plate as an example):

[0208] ① Pour away the culture medium and add an appropriate amount of PBS to each well and wash 2 to 3 times.

[0209] ② Add 100 μL of protein lysis buffer (protease inhibitor: RIPA = 1:100) to each well, and place the cell culture plate on a shaker at 4°C and gently shake for 15-20 minutes.

[0210] ③ Use a pipette to repeatedly blow the cells in the well to ensure that the protein is fully lysed. Collect the cells in the same treatment group into the same 1.5 mL centrifuge tube, centrifuge at 4°C and 12,000 rpm for 10 minutes, and collect the supernatant for subsequent experiments.

[0211] (2) Protein quantification:

[0212] ① Prepare the working solution: According to the BCA protein concentration assay kit, mix Reagent A and Reagent B in a volume ratio of 50:1 to prepare the BCA working solution.

[0213] ② Prepare a 96-well plate and add 0, 1, 2, 4, 8, 12, 16, and 20 μL of 0.5 mg / mL protein standard to the corresponding wells, and fill each well to 20 μL with PBS solution.

[0214] ③ Take 2 μL of the protein sample to be tested and add it to the corresponding wells, and fill each well to 20 μL with PBS solution.

[0215] ④ Add 200 μL of BCA working solution to each sample well and standard well.

[0216] ⑤ Place the 96-well plate in a 37°C constant temperature incubator and incubate for 30 minutes to allow the BCA working solution to react with the protein.

[0217] ⑥ Use a microplate reader to measure the absorbance (A562) of each well at a wavelength of 570 nm. Draw a standard curve based on different concentrations of protein standards and their corresponding A562 values ​​to calculate the original concentration of the protein sample.

[0218] (3) Protein denaturation: Calculate the volume of ddH2O and 5×SDS loading buffer required for 20 μg of protein sample based on the protein concentration obtained in the protein quantification test. Boil the mixture in 95-100°C boiling water for 5-10 min.

[0219] (4) SDS-PAGE electrophoresis: Add the treated protein sample to the precast protein gel and run the gel at 140V for 45min. After the electrophoresis is complete, cut the gel band containing the target protein according to the position indicated by the protein marker.

[0220] (5) Transfer: In eBlot TM The membrane was transferred on an L1 rapid wet transfer instrument, and the transfer program used the instrument's default settings.

[0221] (6) Blocking: Prepare 5% skim milk powder in advance. After transfer, wash the membrane once with 1×TBST and soak the membrane in milk powder for 1–2 h at room temperature for blocking.

[0222] (7) Primary antibody incubation: Prepare the primary antibody using 1×TBST according to the ratio in the instructions. After blocking, wash with 1×TBST for 8 minutes, repeat three times, and incubate at 4°C overnight (12-16 hours).

[0223] (8) Secondary antibody incubation: Prepare the secondary antibody using 1×TBST according to the ratio in the instructions. After the primary antibody incubation, wash the membrane with 1×TBST for 8 minutes, repeat three times; then soak the membrane in the secondary antibody and incubate at room temperature for 1-2 hours.

[0224] (9) Exposure and result analysis: Prepare the luminescent solution according to the instructions of the BCL color development kit. After the secondary antibody incubation is completed, wash with 1×TBST for 8 minutes, repeat three times; use a chemiluminescence instrument to expose the protein sample, and use ImageJ software to process the exposed image and analyze the grayscale value of the target protein.

[0225] Result analysis:

[0226] 1. Using pig ear sample DNA as a template, primers were designed for PCR amplification based on the pig MMP2 promoter sequence published on NCBI. The band positions were observed by agarose gel electrophoresis, and the pig MMP2 gene promoter region sequence of 1185 bp (-2102 / -917) was obtained. Figure 1 ).

[0227] 2. According to Table 4, the C mutation at the g.30089086C>T site of the MMP2 gene of the Douro pig was T, and three genotypes were found, CC, CT and TT, with two alleles, of which the mutant base T was the minor allele; the C mutation at the g.30088991C>T site was T, and two genotypes were found, CC and CT, with two alleles, of which the mutant base T was the minor allele; the A mutation at the g.30088928A>G site was G, and three genotypes were found, AA, AG and GG, with two alleles, of which the mutant base G was the minor allele; the C mutation at the g.30088855C>T site was T, and CC, CT and T were found. There are 3 genotypes of T, with 2 alleles, of which the mutant base T is the minor allele; g.30088852C>T site C mutated to T, and 3 genotypes of CC, CT and TT were found, with 2 alleles, of which the mutant base T is the minor allele; g.30088825A>C site A mutated to C, and 2 genotypes of AA and CC were found, with 2 alleles, of which the mutant base C is the minor allele; g.30088774C>T site C mutated to T, and 3 genotypes of CC, CT and TT were found, with 2 alleles, of which the mutant base T is the minor allele; g.30088715C>T site C mutated to T , it was found that there were 3 genotypes, CC, CT and TT, with 2 alleles, among which the mutant base T was the minor allele; g.30088669T>C site T mutated to C, it was found that there were 3 genotypes, TT, TC and CC, with 2 alleles, among which the mutant base C was the minor allele; g.30088615G>A site G mutated to A, it was found that there were 2 genotypes, GG and AA, with 2 alleles, among which the mutant base A was the minor allele; g.30088475T>C site T mutated to C, it was found that there were 2 genotypes, TT and TC, with 2 alleles, among which the mutant base C was the minor allele; g.30088284G>A At the site, G mutated to A, and three genotypes were found, namely GG, GA and AA, with two alleles, of which the mutated base A was the minor allele; at the site g.30088228G>C, G mutated to C, and three genotypes were found, namely GG, GC and CC, with two alleles, of which the mutated base C was the minor allele; at the site g.30088210C>T, C mutated to T, and three genotypes were found, namely CC, CT and TT, with two alleles, of which the mutated base T was the minor allele; at the site g.30088004C>T, C mutated to T, and three genotypes were found, namely CC, CT and TT, with two alleles, of which the mutated base T was the minor allele.

[0228] 3. The analysis criteria for population genetic structure indicators were: a polymorphic information content (PIC) > 0.25 indicated that the locus was moderately polymorphic, and a PIC < 0.25 indicated that the locus was lowly polymorphic. A P > 0.05 indicated that the population genetic variation at the locus was in Hardy-Weinberg equilibrium (Table 5).

[0229] 4. This statistical analysis was based on the genotype statistics of a group of 142 Douro black pigs with a record of sexual maturity age. The one-way analysis of variance was used to analyze the association between the sexual maturity age and genotype of each individual (Table 6). There was no significant difference in the age of sexual maturity among different genotypes at the g.30089086C>T, g.30088991C>T, g.30088928A>G, g.30088852C>T, g.30088825A>C, g.30088774C>T, and g.30088715C>T loci. The age of sexual maturity of individuals with CT and TT genotypes at the g.30088855C>T locus was significantly earlier than that of individuals with CC genotypes. The age of sexual maturity of individuals with CT and TT genotypes at the g.30088669T>C locus was significantly earlier than that of individuals with CC genotypes. The age of sexual maturity of individuals with GG genotypes at the g.30088615G>A locus was significantly earlier than that of individuals with CC genotypes. The age of sexual maturity of individuals with g.30088475T>C TC genotype was significantly earlier than that of individuals with TT genotype; the age of sexual maturity of individuals with g.30088284G>A GA and AA genotype was significantly earlier than that of individuals with GG genotype; the age of sexual maturity of individuals with g.30088228G>C GC and CC genotype was significantly earlier than that of individuals with GG genotype; the age of sexual maturity of individuals with g.30088210C>T TT genotype was significantly earlier than that of individuals with CC and CT genotype; the age of sexual maturity of individuals with g.30088004C>T TT genotype was significantly earlier than that of individuals with CC and CT genotype.

[0230] 5. Jinkairui Bioengineering Co., Ltd. constructed the pGL3-basic vector containing the wild-type sequence and mutant sequence of the site. The wild-type and mutant vectors of g.30088284G>A site were named WT-8284 and Mut-8284, respectively; the wild-type and mutant vectors of g.30088004C>T site were named WT-8004 and Mut-8004, respectively. The above recombinant plasmids were transfected into sow ovarian granulosa cells, Mut-8284 was used as a control with WT-8284, and Mut-8004 was used as a control with WT-8004. The MMP2 gene promoter activity was detected using a dual fluorescence reporter enzyme assay. The results showed that the MMP2 gene promoter activity of the Mut-8284 group was significantly lower than that of the WT-8284 group; the MMP2 gene promoter activity of the Mut-8004 group was significantly lower than that of the WT-8004 group ( Figure 2 ).

[0231] The ovarian granulosa cells were derived from healthy commercial sows from Kongwangji Slaughterhouse in Huangpu District, Guangzhou (the same below).

[0232] 6. By transfecting 1000ng / mL of overexpression vector into sow ovarian granulosa cells, qRT-PCR was used to detect the expression of MMP2. It was found that the transfection efficiency of pcDNA3.1-MMP2 was good and the difference was significant. In subsequent studies, 1000ng / mL was selected as the transfection concentration of pcDNA3.1-MMP2 ( Figure 3 ).

[0233] The above-mentioned overexpression vector was synthesized by Guangzhou Dongze Biotechnology Co., Ltd.

[0234] 7. Synthesize MMP2 interference fragments / control (MMP2-siRNA / siRNA-NC), screen and test their interference efficiency. As shown in the attached figure, the MMP2-siRNA small fragment was transfected into the sow ovarian granulosa cells. By qRT-PCR, the MMP2-siRNA small fragment had a good interference effect and was used for subsequent experiments ( Figure 4 ).

[0235] MMP2-siRNA: 5′-GCAAACAGGACATCGTCTT-3′;

[0236] The above-mentioned small interfering RNA fragments were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.

[0237] 8. The above-mentioned pcDNA3.1-MMP2 or MMP2-siRNA was transfected into sow ovarian granulosa cells, respectively, and pcDNA3.1 or siRNA-NC was used as the control. The effects of MMP2 on the transcription level and ferroptosis of sow ovarian granulosa cells were detected by chain-specific transcriptome sequencing, total iron colorimetry, malondialdehyde (MDA) colorimetry, qRT-PCR, Western Blot and other experimental methods.

[0238] 9. In the pcDNA3.1-MMP2 group, 169 genes were significantly upregulated and 357 genes were significantly downregulated. The differentially expressed genes were mainly involved in biological processes such as the G protein-coupled receptor signaling pathway, ERBB signaling pathway, epidermal growth factor receptor signaling pathway, phospholipase-activated G protein-coupled signaling pathway, positive regulation of cytoplasmic calcium concentration, and negative regulation of leukocyte-mediated immunity. Figure 5 a, b).

[0239] 10. In the MMP2-siRNA group, 115 genes were significantly upregulated and 176 genes were significantly downregulated. The differentially expressed genes were mainly involved in signaling pathways such as cell differentiation, humoral immune response mediated by circulating immunoglobulins, and complement activation of activated immune response ( Figure 5 (c, d).

[0240] 11. The total iron ion level in the pcDNA3.1-MMP2 group was higher than that in the control group, but it did not reach a statistically significant level. The total iron ion level in the MMP2-siRNA group was significantly lower than that in the control group ( Figure 6 ).

[0241] 12. The MDA level of cells in the pcDNA3.1-MMP2 group was significantly higher than that in the control group, while the MDA level of cells in the MMP2-siRNA group was significantly lower than that in the control group ( Figure 7 ).

[0242] 13. Overexpression of MMP2 can significantly reduce the expression levels of GPX4 and SLC7A11 gene mRNA and protein, and significantly increase the expression levels of P53 mRNA and protein; while knockdown of MMP2 can significantly increase the mRNA levels of GPX4 and SLC7A11 genes, with no significant difference in protein levels, and significantly reduce the mRNA and protein expression levels of P53. In summary, MMP2 can promote cell ferroptosis ( Figure 8 ).

[0243] In summary, mutations at the g.30088284G>A site and the g.30088004C>T site of MMP2 changed its binding with transcription factors, resulting in changes in promoter activity, affecting the transcription and translation of target genes, and then regulating the conduction of the granulosa cell ferroptosis signaling pathway, affecting the sexual maturity of sows.

[0244] Table 4 Statistical results of SNP typing in the promoter region of MMP2 gene

[0245]

[0246]

[0247] Table 5 Analysis of population genetic structure indicators

[0248]

[0249] Table 6 Effects of MMP2 gene polymorphisms on the age of sexual maturity in Douro Black pigs

[0250]

[0251]

[0252] Note: The values ​​in the above table are expressed as arithmetic mean ± standard deviation. a and b in the table represent the intra-group variability.

[0253] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Detection MMP2 The application of the reagent for detecting SNP sites in gene promoter regions is characterized by: The SNP site is selected from one of the following SNP sites: g.30088284 site G>A, g.30088004 site C>T, g.30088855 site C>T, g.30088669 site T>C, g.30088615 site G>A, g.30088475 site T>C, g.30088228 site G>C, g.30088210 site C>T; the above SNP site is located on chromosome 6 of the pig reference genome Sscrofa11.1; Detecting the genotype of the g.30088284 locus, the age of puberty of individuals with the genotype of AA is shorter than that of GG and GA individuals; or detecting the genotype of the g.30088004 locus, the age of puberty of individuals with the genotype of TT is shorter than that of CC and CT individuals; or detecting the genotype of the g.30088855 locus, the age of puberty of individuals with the genotype of CC is shorter than that of CT and TT individuals; or detecting the genotype of the g.30088669 locus, the age of puberty of individuals with the genotype of CT and TT is shorter than that of CC individuals. or, detecting the genotype of the g.30088615 locus, the age of first puberty of individuals with the genotype of GG is shorter than that of AA individuals; or, detecting the genotype of the g.30088475 locus, the age of first puberty of individuals with the genotype of TC is shorter than that of TT individuals; or, detecting the genotype of the g.30088228 locus, the age of first puberty of individuals with the genotype of CC is shorter than that of GG and GC individuals; or, detecting the genotype of the g.30088210 locus, the age of first puberty of individuals with the genotype of TT is shorter than that of CC and CT individuals; The application is at least one of the following applications: A. Application in assessing the age of puberty in pigs; B. In the application of judging the onset of puberty in pigs, the pigs with the shortest age at puberty are judged as having the fastest onset of puberty; C. Application in breeding high-yield pigs, selecting pigs with a short age at puberty as breeding pigs; The pig is a binary hybrid pig of Duroc and Country Black pig.

Citation Information

Patent Citations

  • MMP2 gene polymorphism serving as genetic marker of pig litter size character and application of MMP2 gene polymorphism serving as genetic marker of pig litter size character

    CN114836544A

  • Method for regulating MMP2 gene expression of porcine ovarian granular cells

    CN114874993A