Haploid breeding marker related to pig feed utilization rate and meat traits and application of haplotype breeding marker

Abstract

The invention belongs to a bioengineering technology, and particularly relates to a haplotype breeding marker related to the utilization rate of pig feed and meat traits and application of the haplotype breeding marker. The genetic marker clones 19 sites of an SYISL gene promoter from a pig No.8 chromosome. Three pairs of primers are designed according to a pig genome sequence (NC010450.4) published by an NCBI (National Center of Biotechnology Information) database. 19 base substitutions exist in amplification sequences of the three pairs of primers. SNPs loci are typed through a direct sequencing technology, a linkage imbalance analysis result shows that 19 loci are all in a complete linkage imbalance state, and two haplotypes are generated through analysis. Association analysis shows that compared with other haplotype individuals, the combined haplotype H2-H2 individuals have the characteristics that the backfat thickness is small, the eye muscle thickness is large, the average feed intake of 30-100 kg of individuals is small, and the feed conversion ratio is small. The invention provides a new marker for molecular breeding of pig meat traits.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology, and in particular relates to a haplotype breeding marker related to pig feed utilization and meat production traits and its application. Background Art

[0002] With the rapid development of the global economy and the continuous growth of the population, the breeding industry plays an extremely critical role in meeting human demand for meat and its products. Among them, the pig farming industry occupies an important position in animal husbandry and is the main pillar industry of global meat production. The current industrial structure is dominated by large-scale breeding, supplemented by small and medium-sized breeding. my country is the largest producer and importer of pork, and my country has a large population base and a higher demand for pork. However, the industry also faces problems such as frequent diseases, environmental pollution, feed safety and unstable production benefits. Therefore, it is necessary to improve the breeding efficiency and meat production traits of pig breeds. [1-2] Most meat quality traits are quantitative traits, controlled by multiple genes with minor effects, and there are major gene effects. [3] There are scholars [4] With the help of animal genetics and molecular biology, the relationship between phenotype and inheritance of meat quality traits has been explored, and it has been further confirmed that genes can affect specific meat quality traits. Thousands of quantitative trait loci (QTL) have been identified in pigs, and these loci have a wide range of economically important phenotypes. QTL analysis now often uses high-density single nucleotide polymorphisms (SNPs), and by utilizing long-range linkage disequilibrium (LD), higher-resolution QTL positioning is achieved, and its application has been extended from experimental hybridization to inbred populations. Related phenotypes usually fall into categories such as growth, carcass, meat quality, reproduction and disease resistance. Some expression QTL (eQTL) studies have been conducted to identify genes that control important trait phenotypes by considering expression levels as response variables in QTL analysis. [5] Marker Assisted Selection (MAS) is a method that combines molecular genetics and traditional breeding techniques to accelerate the genetic improvement of crops and livestock. This technology can accurately predict the performance of adult traits even when plants or animals are young by identifying molecular markers that are closely linked to the target traits. Therefore, breeders can eliminate individuals that do not carry the desired traits in the early selection stage, thereby improving breeding efficiency and selection accuracy. [6]The meat production traits of pigs include specific indicators such as body length, back fat thickness, eye muscle area and daily weight gain, and many genetic genes will affect these traits. To achieve molecular breeding, the premise is to reveal the molecular mechanism of meat production traits and identify related genes. [7] In pig production, feed efficiency (FE) is an important trait, but FE measurement is cumbersome and expensive, and it is difficult to collect large amounts of data for accurate selection. Therefore, identifying single nucleotide polymorphisms (SNPs) related to FE traits, such as average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR), and using them for genetic evaluation is of great significance for improving prediction accuracy and promoting genetic progress in pig breeding programs. [8] .

[0003] Currently, the physiological functions and regulatory mechanisms of long non-coding RNA (lncRNA) in many muscles remain to be explored. [9] A systematic characterization of lncRNA expression during C2C12 myoblast differentiation identified the highly expressed intronic lncRNA SYISL. Functionally, SYISL promotes myoblast proliferation and fusion while inhibiting myogenic differentiation. Gene knockout significantly increases myofiber density and muscle mass in mice. Mechanistically, SYISL inhibits target gene expression by recruiting PRC2 proteins, leading to trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of target genes. In summary, SYISL is a muscle development inhibitor and plays a crucial role in PRC2-mediated myogenesis. Therefore, functional variation in the SYISL gene is crucial for studying the genetic basis of meat production traits in pigs. Summary of the Invention

[0004] The goal of this invention is to screen for genetic markers associated with pig feed utilization and meat production. By cloning the gene sequence of the pig chromosome 8 region 104827658-104830494 and using direct sequencing to identify SNPs and genotyping methods, the associations with feed utilization and meat production were analyzed. This approach, in turn, established new marker-assisted selection sites for feed utilization and meat production, potentially improving pig muscle yield.

[0005] The present invention is achieved through the following technical solutions:

[0006] The present invention obtains the gene sequence of the 104827658-104830494 segment of pig chromosome 8, as shown in the sequence list SEQ ID NO.1, and the fragment lengths are 714bp, 985bp and 787bp, respectively. The sequences are shown in the sequence list SEQ ID NO.2, the sequence list SEQ ID NO.3, and the sequence list SEQ ID NO.4, respectively. By performing BLAST comparison on the NCBI website, it was found that there were 19 nucleotide polymorphism (SNP) sites in the amplified fragment of this region, specifically as follows Figure 2 The mutation of this SNPs site is specifically at base 104828115 of chromosome 8, where the base changes from G to C, base 104828116, where the base changes from C to A, base 104828148, where the base changes from C to G, base 104828156, where the base changes from G to T, base 104828200, where the base changes from G to T, base 104828225, where the base changes from C to T, base 104828229, where the base changes from G to A, base 104828873, where the base changes from T to C, base 104829029, where the base changes from G to A, and base 104828300. At base 04829046, the base changed from C to T, at base 104829307, the base changed from T to A, at base 104829327, the base changed from A to G, at base 104829460, the base changed from A to G, at base 104829466, the base changed from A to G, at base 104829500, the base changed from A to G, at base 104829504, the base changed from T to C, at base 104829535, the base changed from T to G, at base 104829890, the base changed from C to A, and at base 104829970, the base changed from C to T.

[0007] According to the naming rules of the Ensembl database, the 19 mutation sites were named rs698837059, rs702511014, rs711300964, rs707052512, rs696375896, rs708902283, rs691749030, rs343701254, rs320380315, rs326529139, rs340588370, rs322564742, rs342333906, rs324114921, rs334145347, rs341513531, rs328108976, rs326445452, and rs346394676.

[0008] Large White pigs were used as the experimental material. Whole-genome DNA was extracted from the blood of Large White pigs, and three pairs of primers were designed based on the pig gene sequence published in the NCBI database (NC_010450.4). The sequences of the primer pairs are as follows:

[0009] Forward primer 1 (SEQ ID NO. 5): 5'-TAGGGTCAGTTTCAAGAGAAAGCATTC-3',

[0010] Reverse primer 1 (SEQ ID NO. 6): 5'-ACACAGGAGTTATGCACTTGTATCTCA-3'.

[0011] Forward primer 2 (SEQ ID NO. 7): 5'-CACTCATTCTGACTTGGCTGTTCC-3', reverse primer 2 (SEQ ID NO. 8): 5'-CCTAAATGATGTGACCTTGAGATTTCC-3'.

[0012] Forward primer 3 (SEQ ID NO. 9): 5'-AAGCAGATGCCAATTCAAGAAGTTCAG-3', reverse primer 3 (SEQ ID NO. 10): 5'-AACAGCCAAGTCAGAATGAGTGGTT-3'.

[0013] The above primer pair can detect and type the SNPs sites in the gene region of the 104827658-104830494 segment of pig chromosome 8.

[0014] After PCR amplification using the above primer pairs, purification of the PCR products, cloning and sequencing, and sequence comparison analysis, 19 genetic markers associated with pig feed utilization and meat production traits were screened. The nucleotide sequences of these genetic markers are shown below, with mutation sites located at positions 508, 509, 541, 549, 593, 618, and 621 of SEQ ID NO.2; positions 102, 258, 275, 536, 556, 689, 695, 729, 733, and 764 of SEQ ID NO.3; and positions 183 and 263 of SEQ ID NO.4. The specific sequences are as follows:

[0015] SEQ ID NO.1

[0016] TGTGTCCTCAATACGTGAACATAGAGTCGTTCCTCACTAAGGAGGACCCCGGTACA

[0017] CGGTCCGGTCCGACGGCCCGGACGGATGTCCGGGGAGACGTAGTGACTCTTGACT

[0018] TGTCATTTGGTCTCCACCGGTAAGAAGGTGTGAAGTATAATACATACATACTAGGG

[0019] AAAATAATACATACTAATTTTTATTAAATAGAAAAAGATTCTTGGTATGTTCAATCCT

[0020] CGCAAATTGATATAATATTGTAATATATTTGACATAATCTTTTATTTATGTCCAAAACG

[0021] TAACGAAAATATTTAATTTGGGGGGAGGTTTTTGATTTATTCTTAAGATTCTGAATTT

[0022] ACAGTTACTACCCCTCAAGGGCAGCACCACGTCACCAATTGCTTAAGCTGATCCTT

[0023] GGTACTCCAACGCCCAACCTAGGGACGGGAACGAGTCACCCAATTGCTAGGCCGC

[0024] AACGGCACTCGACCCCACATCCAACGTCTGCGCCGAGGCTAGGGCTTAACGACAC

[0025] CGAGACCGCATCCGGCCACCGATGTCGAGGCTAATCTGGGGATCGGACCCTTGGA

[0026] GGTATACGACGCCCTCGCCGGGTTCTTTATCGTTTTTTTTTTTTTTTTTTTTTCTGATT

[0027] TATTTATTAATTTATTTTCAAAGTAAATTTTTTTTAAAAAAAAAGTTACTACATAAAG

[0028] GATTTTCCTTACGAAAGAGAACTTTGACTGGGATATTGAAATCCTTTTATTATGATG

[0029] TTATTATAAATATTGTTATGAAAAACATATACAAGAAAGTACGTATGTTGGATGAAA

[0030] GTGTATATAAAGTTTTCTCTCTATCGTTCAAATTAATGAAGTTCTATCCAAAATTTTTT

[0031] TAGACTGAATAGGTTGAGATGATAGAACTATTAAGGTACCTTTCGACGTTCCGGATA

[0032] CTAAGGGATACGTAATATGGGATACTAAATAAAATTCTGTAACTGGTAGAAATCCGT

[0033] TTTAAAAACAGGACTTTGTTAGAACTTTAAATTATTTTAATTTATATACTCTTCTAAA

[0034] AAGGAGAGTTTTTAATAAGAAAGTCCTGTAAAATTTTTTCAATGTTTAGTGATAGTTA

[0035] TGTAAATTTACAAATCCTTACTTTCATATAATGGATTTACTACACTGGAACTCTAAAG

[0036] GAATAAAATATGCGGGTTTTCTTAATATGAATGATCATATTACTCATTGTACATGTATT

[0037] CTTTTAAATAGAAATACATATTATCAACAGGAGTTTAATTGAGTCTATTGGAAGTAA

[0038] AAGTGGTTTTTTTATATCGTATGAGAGTCATTAAGATGAAAATCCGTAATTAAGGTA

[0039] TCCTTACTAGTGTATTCACGTGTTTGTATAAAATATATATGTTTTCATAAGTAGGTCA

[0040] TGATAAACATTACCACTTCTTTAATATTAATTGAATGTACAAGTTATTCCTCATCCAAT

[0041] ATATTTAATGTCAGTTAGGTATGAGGGATTATGATACGTCAGTGATTTTTCTAAGTTT

[0042] TTTCCTAAGTAACTGTGTCTTTCTACAAGTATAACATACAAATTATTCTTTCGTATAA

[0043] ATCATGGTAAGGAATTGCACCTTAACTTACATTCGTATTGACATTCAACCACAAA

[0044] CACGTTCTCTCTCCCCTGACTCTTCAACAAGTGGTTCTACAATTATCACACAATAAA

[0045] GACCTACTATGCTAAAATGAAATAAAAATAGGAAGGACATTATAAACCCAAA

[0046] AAAAATGTTACTGTTACACAGTGAAAAAAAATATTAGGTTTTTATTTTCTGTAAAAGT

[0047] CAATATCAATAAAATTAAAAAAATTCGGTTGAGATTGCCTTTTTATTTTTAGTAAATT

[0048] TTTATATCTGACGTTACGTAAACACCCCATCTTAGTACTAAACTAAGGTTTATGGTG

[0049] TGAAACTCTACACCTCGATTTGATTAGTTCAGGTTCAAATGGTTCCTGACAGAGAA

[0050] AAAAGAAAAACTATGTAAAATGGGTTTACTCTCCCCAAATTTCTTATCTACTTCTTA

[0051] TCGTTTGTGTAAAGGAGAAGAGGTAGGTTTAATCCTATACAGTATCTACCCTTGTCGG

[0052] TTCAGTCTTACTCACCAAAATGAGATACTCTATTAGAGATAGGTGACAGAGAGACC

[0053] CACAAAGAACTTCCCGTTCCTTTTGTTTTGAATTTCCGACGCTTAGTATAGCCTACC

[0054] TCAAATTCATTTTCTTCAATCTATGTAGTTAACATAAATTTAGGTACTTAGGAATTATTA

[0055] TAAAAATTTTGTACAGCTAATATAAACATATACGATCCCTTGATAATCTTTTTATTATC

[0056] CCTTTCTCTTTCTTATTTCGTCAATGGTTTTTTTTTTTTTTTTTTCTTAGTAATCTTTTA

[0057] CGACTTAAAGTCATCTAAGTGACGTCATCTTAAAAGTCGTAGTTTTTTTCATTTTAG

[0058] ACCGTTTTAACTAGGGTAAAACTCTCAACAAAAAAAAATTGAGTAAAGAAAGAAA

[0059] TATTGTATATTTAGGTCGTTCACTAAACCTCTTTAATCTTATTTTCAAAGTATTTTTAC

[0060] GCCAGATTACTTAGCGGGAAAGGTCTTTTATGACGAAATAAAAAGGTTGAATTGTC

[0061] TCTTTTATGCTGGTAAGTACCCACAAAAGAAAGTAGATAGTAGAAGAACTAAATTG

[0062] TATCTGAGATCGATTTTTCCTTTGAGTTTTAATACATAAGATTTAGAAAGGAAAATGT

[0063] TTATCTCTTTAACTCTCGGTCTATGAAAATTATTATATCAATTCCCGTGCTCTCATTTTA

[0064] GTTCAATCTGGGTACGGATCTTAAATCCAGAGGATTAAGGGTCAAGTTAGTCACCG

[0065] GAAAAGCGACTTGAAGAACTTAACCGTAGACGAA

[0066] SEQ ID NO.2:

[0067] TGTTAGTTTTATGAAAAACAACTACGGATTTCCGACAAATTCTTACTTATGTGTCC

[0068] TCAATACGTGAACATAGAGTCGTTCCTCACTAAGGAGGACCCCGGTACACGGTCC

[0069] GGTCCGACGGCCCGGACGGATGTCCGGGGAGACGTAGTGACTCTTGACTTGTCAT

[0070] TTGGTCTCCACCGGTAAGAAGGTGTGAAGTATAATACATACATACTAGGGAAAATA

[0071] ATACATACTAATTTTTATTAAATAGAAAGATTCTTGGTATGTTCAATCCTCGCAAA

[0072] TTGATATAATATTGTAATATATTTGACATAATCTTTTATTTATGTCCAAAACGTAACGA

[0073] AAATATTTAATTTGGGGGGAGGTTTTTGATTTATTCTTAAGATTCTGAATTTACAGTT

[0074] ACTACCCCTCAAGGGCAGCACCACGTCACCAATTGCTTAAGCTGATCCTTGGTACTCCAACGCCCAACCTAGGGACGGGAACGAGTCACCCAATTGCTAGGCCGCAACGR(G / C)R(C / A)ACTCGACCCCACATCCAACGTCTGCGCCGAGR(C / G)CTAGGGCR(G / T)T AACGACACCGAGACCGCATCCGGCCACCGATGTCGAGGCTAAR(G / T)CTGGGGAT CGGACCCTTGGAGGTAR(C / T)ACR(G / A)ACGCCCTCGCCGGGTTCTTTATCGTTTTT TTTTTTTTTTTTTTTTCTGATTTATTTATTAATTTATTTTCAAAGTAAATTTTTTTTAAA AAAAAAGTTACTACATAAAGGATTTTCCTTACGAAAGAGAACTTTGACTGGGATSEQ ID NO.3:

[0075] GGATTTACTACACTGGAACTCTAAAGGAATAAAATAGTCGGGTTTTCTTAATATGAATGATCATATTACTCATTGTACATGTATTCTTTTAAATAGAAATAR(T / C)ATATTATCAAC AGGAGTTTAATTGAGTCTATTGGAAGTAAAAGTGGTTTTTTTATATCGTATGAGAGTCATTAAGATGAAAATCCGTAATTAAGGTATCCTTACTAGTGTATTCACGTGTTTGTATAAAATATATATGTTTTCATAAGTAGAGTCR(G / A)TGATAAACATTACCACR(C / T)TCTTAATATTAATTGAATGTACAAGTTATTCCTCATCCAATATATTTAATGTCAGTTAGGTATGAGGGATTATGATACGTCAGTGATTTTTCTAAGTTTTTTCCTAAGTAACTGTGTCTTTCTACAAGTATAACATACAAATTATTCTTTCGTATAAATCATGGTAAGGAAAATGCACCTTAACTTACATTCGTATTGACATTCAACCACAAACACGTTCTCTCTCCCCTGACTCTTCAACAAGTGGTTCTACAATTATCR(T / A)CACAATAAAGACCTACTATR(A / G)CTA AAATGAAATAAAAATAGGAAAAGACATTATAAACCCAAAAAAAAAATGTTACTGTTACACAGTGAAAAAAATATTAGGTTTTTATTTTCTGTAAAAGTCAATATCAATAAAATTAAAAAAATTCGGTTR(A / G)AGATTR(A / G)CCTTTTTTATTTTTAGTAAATTTTTATA TCTGACR(A / G)TTAR(T / C)GTAAACACCCCATCTTAGTACTAAACTAAGR(T / G)TTTATGGTGTGAAACTCTACACCTCGATTTGATTAGTTCAGGTTCAAATGGTTCCTGACAGAGAAAAAAGAAAAACTATGTAAAATGGGTTTACTCTCCCCAAATTTCTTATCTACTTCTTATCGTTTGTGTAAAGGAGAAGAGGTAGTTTAATCCTATACAGTATCTACCCTTGTCGGTTCAGTCTTACTCAC

[0076] SEQ ID NO.4:

[0077] TTGTCGGTTCAGTCTTACTCACCAAAATGAGATACTCTATTAGAGATAGGTGACAG

[0078] AGAGACCCACAAAGAACTTCCCGTTCCTTTTGTTTTGAATTTCCGACGCTTAGTAT

[0079] AGCCTACCTCAAATTCATTTCTTCAATCTATGTAGTTAACATAAATTTAGGTACTTAGGAATTATTATAAR(C / A)AATTTTGTACAGCTAATATAAACATATACGATCCCTTGATAA TCTTTTTATTATCCCTTTCTCTTTCTTATTTCGTCAAR(C / T)GGTTTTTTTTTTTTTTTT TTCTTAGTAATCTTTTACGACTTAAAGTCATCTAAGTGACGTCATCTTAAAAGTCGTAGTTTTTTTCATTTTAGACCGTTTTAACTAGGGTAAAACTCTCAACAAAAAAAAATTGAGTAAAGAAAGAAATATTGTATATTTAGGTCGTTCACTAAACCTCTTTAATTCTATTTTCAAAGTATTTTTACGCCAGATTACTTAGCGGGAAAGGTCTTTTATGACGAAATA AAAAGGTTGAATTGTCTCTTTTATGCTGGTAAGTACCCACAAAAGAAAGTAGATAGTAGAAGAACTAAATTGTATCTGAGATCGATTTTCCTTGAGTTTTAATACATAAGATTTAGAAAGGAAAATGTTTATCTCTTT AACTCTCGGTCTATGAAAATTATTATATCAATTCCCGTGTCTCATTTTAGTTCAATCTGGGTACGGATCTTAAATCCAGAGGATTAAGGGTCAAGTTAGTCACCGGAAAAGCGACTTGAAGAACTTAACCGTAGACGAA

[0080] The present invention provides a method for screening genetic markers associated with pig feed utilization and meat production traits, the method comprising the following steps:

[0081] Genomic DNA was extracted from Large White pigs. Primers were designed based on the genomic sequence from +95 to +2931 bp upstream of the SYISL transcription start site. The porcine genomic DNA was amplified using these primers, and the nucleotide sequence from +95 to +2931 bp upstream of the SYISL transcription start site was obtained by direct sequencing (see SEQ ID NO. 1). This sequence contains 19 single-nucleotide polymorphisms (SNPs). The haplotypes formed by these 19 mutation sites can be used as genetic markers for association analysis of traits related to feed utilization and meat production in pigs.

[0082] The present invention provides a genotyping method for detecting SNP sites in the above sequence.

[0083] The present invention provides an application of haplotype analysis for genotyping individuals by identifying 19 SNPs polymorphic sites

[0084] The present invention further provides an application of direct sequencing to determine the association analysis between individuals with different genotypes and feed utilization and meat production.

[0085] For more detailed technical solutions, please refer to the "Specific Implementation Methods".

[0086] Compared with the prior art, the present invention has the following beneficial effects: 19 SNPs located in the promoter region of the SYISL gene in the present invention. Through association analysis, these 19 SNPs were significantly associated with feed utilization and meat production in pigs. Further analysis found that these 19 SNPs were in a state of complete linkage disequilibrium. Haplotype analysis revealed that they could form two haplotypes, and there were significant differences in traits such as feed intake, lean meat percentage, and feed utilization. These haplotypes may affect the growth and differentiation of muscle cells by changing the expression level of the SYISL gene.

[0087] Given the important role of the haplotype composed of 19 SNPs in pig growth and meat production traits, this haplotype can be used as an effective molecular marker in pig genetic improvement. By using this haplotype for molecular marker-assisted selection, breeding efficiency can be significantly improved, and breeding pigs with excellent growth performance and meat quality characteristics can be bred, providing an efficient and accurate genetic improvement tool for pork production. This discovery provides a new target for molecular breeding of pigs, with broad application prospects and important economic value. Incorporating the haplotype loci composed of 19 SNPs into breeding strategies can further optimize the genetic structure of pigs and enhance the competitiveness of the pork industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Figure 1 : Results of cloning and detection of the porcine chromosome 8 segment 104827658-104830494. Agarose gel concentration: 1.5%. Reference numerals: Lanes 1-2, 3-4, 5-6: three pairs of PCR amplification products, respectively. Lane M: DL2000Maker.

[0089] Figure 2 : The nucleotide sequence of the segment 104827658-104830494 of porcine chromosome 8 is shown in the sequence listing as SEQ ID NO. 2 to SEQ ID NO. 4, respectively. Explanation of the reference numerals: There are 19 mutation sites in the sequence shown, which are specific sites that cause polymorphism in this segment.

[0090] Figure 3 : Sequencing results of the genetic marker sequence of the present invention. There are 19 double peak patterns, which are respectively caused by the mutation of base "G" to "C", base "C" to "A", base "C" to "G", base "G" to "T", base "G" to "T", base "C" to "T", base "G" to "A", base "T" to "C", base "G" to "A", base "C" to "T", base "T" to "A", base "A" to "G", base "A" to "G", base "A" to "G", base "A" to "G", base "T" to "C", base "T" to "G", base "C" to "A", and base "C" to "T".

[0091] Figure 4 :Linkage disequilibrium analysis diagram of 19 SNPs polymorphic sites of the present invention, the left figure represents D' value, the right figure represents r 2 value. DETAILED DESCRIPTION

[0092] Example 1: Obtaining DNA fragments from the 104827658-104830494 region of porcine chromosome 8 and establishing a SNP detection method

[0093] The experiment selected Large White pigs, and three pairs of primers were designed based on the genomic sequence of the pig chromosome 8 segment 104827658-104830494. The specific sequences are as follows:

[0094] Forward primer 1 (SEQ ID NO. 5): 5'-TAGGGTCAGTTTCAAGAGAAAGCATTC-3',

[0095] Reverse primer 1 (SEQ ID NO. 6): 5'-ACACAGGAGTTATGCACTTGTATCTCA-3'.

[0096] Forward primer 2 (SEQ ID NO. 7): 5'-CACTCATTCTGACTTGGCTGTTCC-3',

[0097] Forward primer 2 (SEQ ID NO. 8): 5'-CCTAAATGATGTGACCTTGAGATTTCC-3'.

[0098] Forward primer 3 (SEQ ID NO. 9): 5'-AAGCAGATGCCAATTCAAGAAGTTCAG-3',

[0099] Reverse primer 3 (SEQ ID NO. 10): 5'-AACAGCCAAGTCAGAATGAGTGGTT-3'.

[0100] The above primers were used to perform PCR amplification in genomic DNA of pigs from different experimental groups.

[0101] The PCR reaction system is shown in Table 1.

[0102] Table 1 PCR reaction system

[0103]

[0104] The PCR reaction conditions are shown in Table 2.

[0105] Table 2 PCR reaction conditions

[0106]

[0107] The resulting PCR products were purified and cloned, and then sequenced by Wuhan Hece Gene Technology Co., Ltd. BLAST analysis revealed 19 base mutations in the three sequences.

[0108] Example 2: Haplotype analysis and application of the genetic markers of the present invention and Large White pigs

[0109] To determine the linkage disequilibrium relationship of 19 SNPs within the region 104827658-104830494 of porcine chromosome 8, this example selected Large White pigs (1266 pigs) as experimental materials. Polymorphism detection was performed by direct sequencing, and the correlation between polymorphic sites and haplotypes was analyzed. Linkage disequilibrium analysis and haplotype analysis were performed using Haploview 4.1 software. All 19 polymorphic sites were in complete linkage disequilibrium, resulting in two haplotypes: H1: GACGGCGTGCTAAAATTCC and H2: CCGTTTACATAGGGGCGAT, as shown in Table 3.

[0110] Table 3 Haplotype analysis of SYISL gene in Large White pigs

[0111]

[0112] Example 3: Association analysis and application of the genetic markers of the present invention with feed utilization and meat production traits of Large White pigs

[0113] In order to determine the correlation between the haplotype composed of 19 SNPs in the region 104827658-104830494 of chromosome 8 and the phenotypic differences of pigs, this example selected Large White pigs (1266 heads) as experimental materials. Polymorphism detection was performed by direct sequencing, and the correlation between polymorphic sites and pig meat production traits and feed utilization was analyzed. The association between genotype and phenotypic values ​​was analyzed using a mixed linear model (Mixed) in SAS 8.0 statistical software. Among them, the analysis model of Large White pigs is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm , where Y ijkl is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; F j 、S k 、B l are fixed effects, namely family, gender, and batch effects; ε ijklm is a random error, assuming that it obeys N(0, σ 2 )distributed.

[0114] Polymorphism detection was performed on 19 loci in the 104827658-104830494 region of porcine chromosome 8. Three genotypes were detected in the aforementioned Large White pig population. The genotype frequencies and their distribution are shown in Table 4.

[0115] Table 4 Genotype frequencies and allele frequencies of polymorphic sites in Large White pig population

[0116]

[0117] It can be concluded from Table 4 that the frequency of the H1-H1 allele at the polymorphic site is higher than that of the H2-H2 allele in the Large White pig population.

[0118] Table 5 Association analysis between polymorphic sites and feed utilization and meat production traits

[0119]

[0120] Note: The above values ​​are least squares means ± standard errors. In each pig breed, capital letters in the same column indicate extremely significant differences (P<0.01), lowercase letters indicate significant differences (P<0.05), the same letters in the same column indicate no significant differences (P>0.05), different letters indicate significant differences (P<0.05), and unmarked letters indicate no significant differences (P>0.05).

[0121] Analysis in Table 5 revealed that the polymorphic loci were significantly correlated with backfat thickness, loin eye thickness, average feed intake (30-100 kg), and average feed-to-meat ratio (30-100 kg) in Large White pigs (P < 0.05). Individuals with the combined haplotype H2-H2 had significantly lower backfat thickness, average feed intake, and average feed-to-meat ratio than those with the combined haplotype H1-H1 (P < 0.05). Individuals with the combined haplotype H2-H2 had significantly higher loin eye thickness than those with the combined haplotype H1-H1 (P < 0.05). In terms of genetic stability and genetic progression, the combined haplotype H2-H2 demonstrated a clear advantage in reducing live backfat thickness, average feed intake (30-100 kg), average feed-to-meat ratio (30-100 kg), and increasing loin eye thickness. Based on the above results, the haplotype polymorphism loci composed of these 19 SNPs can be used as molecular breeding markers to increase feed utilization and pig meat production traits.

[0122] In summary of the specific implementation methods, it should be noted that the above embodiments are only used to explain the technical methods of the present invention, and the scope of application of the present invention is not limited to the examples listed. Through the explanation of the present invention by the above embodiments, researchers in this field should understand that researchers can modify the technical solutions described in the above embodiments, and make equivalent replacements for some or all of the technical features of the embodiment solutions. These modifications and replacements, as long as they do not deviate from the essence of the technical solution of the present invention, are all within the scope of implementation of the technical solution of the embodiment of the present invention.

Claims

1. A haploid breeding marker associated with pig feed utilization and meat production traits, characterized in that: The marker site is located in the gene sequence of the 104827658-104830494 segment of pig chromosome 8, and the nucleotide sequence of the segment is shown in SEQ ID NO.

1. There are 19 SNP sites in the segment.

2. A SNPs molecular marker associated with pig feed utilization and meat production traits, characterized in that: The marker site is located on three interval gene sequences in the 104827658-104830494 segment of pig chromosome 8, the nucleotide sequences of the two intervals are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and there are 19 SNP sites in the segment.

3. The SNPs haplotype locus according to claim 1 or 2, characterized in that: The mutations of the sites are respectively in the following positions of pig chromosome 8: at the 104828115th base of chromosome 8, the base changes from G to C; at the 104828116th base, the base changes from C to A; at the 104828148th base, the base changes from C to G; at the 104828156th base, the base changes from G to T; at the 104828200th base, the base changes from G to T; at the 104828225th base, the base changes from C to T; at the 104828229th base, the base changes from G to A; at the 104828873rd base, the base changes from T to C; at the 104829029th base, the base changes from G to A; At the 104829046th base, the base changed from C to T, at the 104829307th base, the base changed from T to A, at the 104829327th base, the base changed from A to G, at the 104829460th base, the base changed from A to G, at the 104829466th base, the base changed from A to G, at the 104829500th base, the base changed from A to G, at the 104829504th base, the base changed from T to C, at the 104829535th base, the base changed from T to G, at the 104829890th base, the base changed from C to A, and at the 104829970th base, the base changed from C to T.

4. Application of a haplotype marker related to pig feed utilization and meat production traits in pig breeding.

Images