A Bacillus subtilis with high cellulase production, its construction method and application

By introducing CRISPR/Cas9 gene editing and vector expression technology into Bacillus subtilis, cellulase gene expression is optimized, and the problem of low cellulase yield and activity is solved, achieving the effect of efficient degradation of wheat straw.

CN119530115BActive Publication Date: 2025-07-29NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411575837.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-06
Publication Date
2025-07-29
Estimated Expiration
2044-11-06

AI Technical Summary

Technical Problem

The cellulases produced in the prior art are single in types, have low yield and degradation activity, and are not safe in industrial applications, making it difficult to effectively degrade agricultural waste such as wheat straw.

Method used

Through CRISPR/Cas9 gene editing and vector expression technology, endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase genes were knocked into the Bacillus subtilis 168 strain of Bacillus subtilis, and knock-in site optimization, signal peptide optimization and terminator optimization were carried out to construct the Bacillus subtilis K3P2C with high cellulase yield.

Benefits of technology

The constructed Bacillus subtilis can produce cellulases with high yield and high activity, significantly improving the degradation efficiency of crop straw, improving its physical and chemical properties, and promoting the adsorption performance of microorganisms and digestive enzymes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119530115B_ABST
    Figure CN119530115B_ABST
Patent Text Reader

Abstract

The present invention relates to a Bacillus subtilis with high cellulase productivity, its construction method and application, belonging to the technical field of microbial genetic engineering. The present invention provides a Bacillus subtilis K3P2C with high cellulase productivity, which is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC No. M20241787. The Bacillus subtilis K3P2C of the present invention can produce cellulase with high yield and high activity, and can effectively degrade the lignocellulose structure on the surface of crop straws, which plays an important role in improving the physical and chemical properties of crop straws.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial genetic engineering, and particularly relates to a Bacillus subtilis with high cellulase production, a construction method thereof, and an application thereof. Background Art

[0002] Wheat straw is a common agricultural waste and biomass energy source, with its cellulose, hemicellulose, and lignin contents being 35% - 40%, 20% - 30%, and 8% - 15% respectively, and being rich in mineral elements such as calcium, phosphorus, potassium, and magnesium. However, due to the tight intertwining of components such as cellulose, hemicellulose, and lignin in it, the molecular structure of wheat straw is extremely stable, and it is difficult to effectively degrade and utilize it by mechanical methods. Therefore, it is usually burned or buried, causing waste of resources and environmental pollution.

[0003] Cellulase is a complex enzyme system composed of multiple enzymes with synergistic effects, belonging to glycoside hydrolases (GHs, EC3.2.1) in carbohydrate - active enzymes (CAZymes), and can catalyze and degrade cellulose and its derivatives. According to the functional differences of the cellulase system, it can be divided into endo - β - 1,4 - glucanase (EG, EC3.2.1.4), exo - β - 1,4 - glucanase (CBH, EC3.2.1.91), and β - glucosidase (CB, EC3.2.1.21). It has been found that the complete degradation of cellulose macromolecules into glucose requires the synergistic action of the above - mentioned enzyme system. Specifically, EG randomly cleaves the β - 1,4 glycosidic bonds in the amorphous region inside cellulose to produce oligosaccharides, which are then further degraded by CBH, and cellobiose is produced by degrading from the non - reducing sugar end of cellulose. Then, CB acts on cellobiose to produce glucose monomers, thus completing the entire degradation process. In the natural environment, cellulose present in organic waste or biomass is mainly degraded by cellulases produced by various bacteria, fungi, and animals and plants. However, the cellulases produced by microorganisms and animals and plants often have low contents and single enzyme systems, and cannot efficiently degrade cellulose.

[0004] Although Bacillus subtilis can be used to express heterologous cellulase genes, and even some wild Bacillus subtilis can produce cellulase, the metabolic mechanism and metabolites of wild strains have not been fully studied, and they have not passed the safety assessment. Therefore, there are certain risks in industrial applications. Summary of the Invention

[0005] The purpose of the present invention is to provide a Bacillus subtilis with high cellulase production, a construction method thereof, and an application thereof, so as to solve the problems of single type of cellulase produced by the prior art, low yield and degradation activity, and insufficient safety in industrial applications.

[0006] In order to achieve the above - mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a Bacillus subtilis with high cellulase production. The Bacillus subtilis is Bacillus subtilis K3P2C, which is deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, the deposit date being August 14, 2024, and the deposit number being CCTCC No. M20241787.

[0008] The present invention also provides the application of the above-mentioned Bacillus subtilis in the preparation of a preparation with high cellulase production;

[0009] The cellulase includes one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase, and β-glucosidase.

[0010] The present invention also provides a construction method of the above-mentioned Bacillus subtilis, which includes the following steps:

[0011] (1) Knock the gene expression cassettes P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4, and P 43 -YwbN-Bf1-TH1 into the Bacillus subtilis 168 strain to obtain a recombinant bacterium BSKI3Cel;

[0012] (2) Transform the cellulase expression vector pJOE2006Bf into the recombinant bacterium BSKI3Cel to obtain Bacillus subtilis K3P2C.

[0013] Preferably, the nucleotide sequence of P 12 -BglC-2006-TB4 is as shown in SEQ ID NO.1;

[0014] The nucleotide sequence of P 12 -LipA-2006-TB4 is as shown in SEQ ID NO.2;

[0015] The nucleotide sequence of P 43 -YwbN-Bf1-TH1 is as shown in SEQ ID NO.3.

[0016] Preferably, knock P 12 -BglC-2006-TB4 into the sprE locus of the Bacillus subtilis 168 strain;

[0017] Knock P 12-LipA-2006-TB4 was knocked into the lacZ locus of Bacillus subtilis 168 strain;

[0018] P 43 -YwbN-Bf1-TH1 was knocked into the thrC locus of Bacillus subtilis 168 strain.

[0019] Preferably, the construction method of the cellulase expression vector pJOE2006Bf described in step (2) is: ligating the gene expression cassettes P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 with the pJOE8999 shuttle expression vector to obtain the cellulase expression vector pJOE2006Bf.

[0020] The present invention also provides the application of the described construction method in the preparation of a preparation with high cellulase yield;

[0021] The cellulase includes one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

[0022] The present invention also provides a bacterial agent with high cellulase yield, and the bacterial agent includes the described Bacillus subtilis.

[0023] The present invention also provides the application of the described Bacillus subtilis, the Bacillus subtilis K3P2C prepared by the described construction method, and the bacterial agent in degrading crop straw.

[0024] The present invention has the following technical effects and advantages:

[0025] Based on the Bacillus subtilis 168 strain, the present invention expresses different cellulase genes in this strain through CRISPR / Cas9 gene editing and vector expression technologies, and improves the expression level of cellulase by optimizing the knock-in site, signal peptide, terminator, etc., thereby constructing a Bacillus subtilis K3P2C with high cellulase yield;

[0026] The Bacillus subtilis K3P2C constructed in the present invention can produce endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase with high yields and high activities, can effectively degrade hemicellulose, neutral detergent fiber and acid detergent fiber in crop straw, significantly increase the pH of the fermentation product, and can cause the loss of components such as cellulose, hemicellulose, lignin and pectin on the surface of crop straw during enzymatic hydrolysis and fermentation, and can more effectively degrade the lignocellulose structure on the surface of crop straw, promoting the increase of voids and the enlargement of pore diameters, thereby helping to improve the adsorption performance of crop straw for microorganisms and digestive enzymes, and playing an important role in improving the physical and chemical properties of crop straw. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the vector map of JOEKI2006;

[0028] Figure 2 is the construction process of each vector and strain;

[0029] Figure 3 is the endo-β-1,4-glucanase activity of each strain, where A is the EG activity of each single-site gene-edited strain, and B is the EG activity of each double-site gene-edited strain;

[0030] Figure 4 is the β-glucosidase activity of each strain, where A is the CB activity of each single-site gene-edited strain, and B is the CB activity of each double-site gene-edited strain;

[0031] Figure 5 is the cellulase activity of the strain expressing multiple cellulases, where A is the EG activity of each strain, B is the CBH activity of each strain, and C is the CB activity of each strain;

[0032] Figure 6 is the cellulase activity of the recombinant strain BSKI3Cel and Bacillus subtilis K3P2C at different times, where A is the EG activity of the recombinant strain BSKI3Cel and Bacillus subtilis K3P2C at different times, B is the CBH activity of the recombinant strain BSKI3Cel and Bacillus subtilis K3P2C at different times, and C is the CB activity of the recombinant strain BSKI3Cel and Bacillus subtilis K3P2C at different times;

[0033] Figure 7 is the surface structure of wheat straw degraded by Bacillus subtilis, where A is the EB0 group, B is the EB4 group, C is the EB8 group, and D is the WT8 group. Detailed implementation manners

[0034] The present invention provides a Bacillus subtilis with high cellulase productivity. The Bacillus subtilis is Bacillus subtilis K3P2C, which is deposited at the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, the deposit date being August 14, 2024, and the deposit number being CCTCC No. M20241787.

[0035] The present invention also provides the application of the above-mentioned Bacillus subtilis in the preparation of a preparation with high cellulase productivity;

[0036] The cellulase includes one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase, and β-glucosidase.

[0037] The present invention also provides a construction method of the above-mentioned Bacillus subtilis, including the following steps:

[0038] (1) Knock the gene expression cassettes P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4, and P 43 -YwbN-Bf1-TH1 into the Bacillus subtilis 168 strain to obtain a recombinant strain BSKI3Cel;

[0039] (2) Transform the cellulase expression vector pJOE2006Bf into the recombinant strain BSKI3Cel to obtain Bacillus subtilis K3P2C.

[0040] In the present invention, the nucleotide sequence of P 12 -BglC-2006-TB4 is as shown in SEQ ID NO.1;

[0041] The nucleotide sequence of P 12 -LipA-2006-TB4 is as shown in SEQ ID NO.2;

[0042] The nucleotide sequence of P 43 -YwbN-Bf1-TH1 is as shown in SEQ ID NO.3.

[0043] In the present invention, P 12 -BglC-2006-TB4 is knocked into the sprE site of the Bacillus subtilis 168 strain;

[0044] P 12-LipA-2006-TB4 was knocked into the lacZ locus of Bacillus subtilis 168 strain;

[0045] P 43 -YwbN-Bf1-TH1 was knocked into the thrC locus of Bacillus subtilis 168 strain.

[0046] In the present invention, the construction method of the cellulase expression vector pJOE2006Bf described in step (2) is as follows: the gene expression cassettes P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 were ligated with the pJOE8999 shuttle expression vector to obtain the cellulase expression vector pJOE2006Bf.

[0047] The present invention also provides the application of the described construction method in the preparation of a preparation with high cellulase yield;

[0048] The cellulase includes one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase, and β-glucosidase.

[0049] The present invention also provides a bacterial agent with high cellulase yield, and the bacterial agent includes the described Bacillus subtilis.

[0050] The present invention also provides the application of the described Bacillus subtilis, the Bacillus subtilis K3P2C prepared by the described construction method, and the bacterial agent in degrading crop straw.

[0051] The technical solutions provided by the present invention will be described in detail below with reference to the examples, but they should not be construed as limiting the protection scope of the present invention.

[0052] Among the strains of the present invention, the Bacillus subtilis RLI2019 strain and the B. subtilis 168 strain are both from Northwest A&F University, and the Escherichia coli JM109 competent cells and E. coli JM110 competent cells are both purchased from Shanghai Angyu Biotechnology Co., Ltd.;

[0053] In the reagents of the present invention, the LB medium was purchased from Haibo Biotechnology Co., Ltd. in Qingdao High-Tech Industrial Park. The 2×PhantaMax MasterMix (product number: P515) used for amplifying the target fragment, the 2×RapidTaq MasterMix (product number: P222) used for vector identification, and the Mut ExpressⅡ Fast Mutagenesis Kit V2 (product number: C214) used for site-directed mutagenesis were purchased from Nanjing Novozymes Biotech Co., Ltd. The seamless cloning kit (product number: 10912ES) used for vector ligation was purchased from Yeasen Biotech Co., Ltd. (Shanghai). The SanPrep Column Plasmid Mini-Preps Kit (product number: B518191) used for plasmid extraction and the SanPrep Column DNA Gel Extraction Kit (product number: B518131) used for gel extraction were purchased from Sangon Biotech (Shanghai) Co., Ltd. The hemicellulose content detection kit (product number: BC4440) and the lignin content detection kit (product number: BC4200) were purchased from Beijing Solarbio Science & Technology Co., Ltd. The conductive adhesive was purchased from Nisshin Co., Ltd. in Japan. The pET-Bf vector was synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0054] In the instruments of the present invention, the A200I fiber analyzer was purchased from ANKOM Corporation in the United States, and the Nano SEM-450 field emission scanning electron microscope was purchased from Thermo Corporation in the United States;

[0055] All the primer sequences of the present invention were commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0056] Example 1: Construction and transformation of the gene editing vector JOEKI2006

[0057] The coding sequences of the endoglucanase gene 2006 from Bacillus subtilis RLI2019 strain (NCBI GenBank ID: CP123621.1) and the endoglucanase gene from B. subtilis 168 strain (NCBI GenBank ID: CP136402.1) were downloaded from NCBI for comparison. The sgRNA primers sgeglSF / sgeglSR targeting the eglS locus of B. subtilis 168 strain were designed, and after annealing, sgeglS (as shown in SEQ ID NO.4) was obtained. Referring to the method disclosed by Altenbuchner in the literature (Altenbuchner J. Editing of the Bacillus subtilis genome by the CRISPR-Cas9 system[J]. Appl Environ Microb, 2016, 82(17): 1-7), sgeglS was ligated to the backbone of the pJOE8999 shuttle expression vector. After identification with the primer JDsgRNA, the vector JOEsgeglS was obtained; using B. subtilis RLI2019 strain as a template, the 2006 gene expression cassette, upstream homologous arm and downstream homologous arm were amplified with primers FUHA2006F / FDHA2006R, and the backbone of the JOEsgeglS vector was amplified with primers FDHAJOEF2 / FJOE2006R using the JOEsgeglS vector as a template. After ligation of the two, the vector JOEKI2006 (as Figure 1 shown) was obtained; the JOEKI2006 vector was transformed into Escherichia coli JM109 competent cells. After identification with primers JDKIF / JDKIR, the plasmid was extracted, and then the plasmid was transformed into E. coli JM110 competent cells to obtain a demethylated plasmid; the demethylated plasmid was transformed into B. subtilis 168 strain and inoculated in LB medium containing 0.2% D-mannose for culture and induction of Cas9 gene expression. Then, the B. subtilis 168 strain was cultured at 50 °C for 20 h to obtain the BSKI2006 strain; the BSKI2006 strain was subcultured continuously 10 times at 37 °C and 220 rpm, with each culture for 24 h. Then, the cellulase activity of the BSKI2006 strain was detected to identify the genetic stability. The sequences of each primer and the strains are shown in Tables 1-2.

[0058] The nucleotide sequence of sgeglS is as shown in SEQ ID NO.4.

[0059] SEQ ID NO.4: TTAGTTAAGCTTTTTTTTGG

[0060] Example 2: Expression and optimization of endoglucanase gene 2006

[0061] sgRNA primers sgsprEF / sgsprER, sgnprEF / sgnprER, sgthrCF / sgthrCR, sglacZF / sglacZR targeting the sprE, nprE, thrC, and lacZ loci of B. subtilis 168 strain were designed respectively, annealed to obtain sgsprE, sgnprE, sgthrC, sglacZ (as shown in SEQ ID NO.5 - 8), and each sgRNA was ligated to the pJOE8999 shuttle expression vector backbone according to the method described in Example 1 to obtain vectors JOEsgsprE, JOEsgnprE, JOEsgthrC, JOEsglacZ; using B. subtilis 168 strain as a template, primers FJOEUHAsprF / FP 43 UHAsprR, FUHAsprP 43 F / FblCP 43 R, F2006DHAsprF / FJOEDHAsprR were used to amplify the upstream homologous arm, P 43 promoter, and downstream homologous arm targeting the sprE locus respectively. Using B. subtilis RLI2019 strain as a template, primers FP 43 blCF / FDHA2006R2 were used to amplify the 2006 gene (containing signal peptide BglC), and using the JOEsgsprE vector as a template, primers FDHAJOEF / FUHAJOER2 were used to amplify the JOEsgsprE vector backbone. After ligation, vector JOEsprP 43 BglC2006 was obtained, and the BSsprP 43 BglC2006 strain was transformed according to the method described in Example 1.

[0062] Using B. subtilis 168 strain as a template, primers FP 43 PhoBF / F2006PhoBR, FP 43 PhoDF / F2006PhoDR, FP 43 YwbF / F2006YwbR, FP 43 LipF / F2006LipR were used to amplify signal peptides PhoB, PhoD, YwbN, LipA respectively. Using the JOEsprP 43 BglC2006 vector as a template, primers FSP2006F / FSPP 43 R were used to amplify the JOEsprP for ligating signal peptides PhoB, YwbN, LipA 43BglC2006 vector backbone, using primers FSP2006F / FphoDP 43 R to amplify JOEsprP for ligating the signal peptide PhoD 43 BglC2006 vector backbone, after ligation, vectors JOEsprP 43 PhoB2006, JOEsprP 43 PhoD2006, JOEsprP 43 Ywb2006, JOEsprP 43 Lip2006, were separately transformed to obtain BSsprP 43 PhoB2006, BSsprP 43 PhoD2006, BSsprP 43 Ywb2006, BSsprP 43 Lip2006 strains.

[0063] Using B. subtilis 168 strain as a template, primers FJOEUHAlacF / FP 43 UHAlacR, F2006DHAlacF / FJOEDHAlacR were used to amplify the upstream homologous arm targeting the lacZ locus and the downstream homologous arm targeting the lacZ locus respectively. Using JOEsprP 43 BglC2006 vector as a template, primer FUHAlacP 43 F / FDHA2006R2 to amplify the P 43 -BglC-2006 gene expression cassette. Using the JOEsglacZ vector as a template, primers FDHAJOEF / FUHAJOER2 were used to amplify the JOEsglacZ vector backbone. After ligation, vector JOElacP 43 BglC2006 was obtained, and BSlacP was transformed 43 BglC2006 strains.

[0064] Using B. subtilis 168 strain as a template, primers FJOEUHAthrF / FP 43 UHAthrR, F2006DHAthrF / FJOEDHAthrR were used to amplify the upstream homologous arm targeting the thrC locus and the downstream homologous arm targeting the thrC locus respectively. Using JOEsprP 43 BglC2006 vector as a template, primer FUHAthrP 43 F / FDHAthr2006R to amplify the P 43-BglC-2006 gene expression cassette. Using the JOEsgthrC vector as a template, the backbone of the JOEsgthrC vector was amplified with primers FDHAJOEF / FUHAJOER2, and after ligation, the vector JOEthrP was obtained. 43 BglC2006 was transformed to obtain BSthrP. 43 BglC2006 strain.

[0065] Using B. subtilis 168 strain as a template, the upstream homologous arm targeting the nprE locus and the downstream homologous arm targeting the nprE locus were amplified with primers FJOEUHAnprF / FP 43 UHAnprR, F2006DHAnprF / FJOEDHAnprR respectively. Using the JOEsprP 43 BglC2006 vector as a template, primers FUHAnprP 43 F / FDHAnpr2006R were used to amplify P 43 -BglC-2006 gene expression cassette. Using the JOEsgnprE vector as a template, the backbone of the JOEsgnprE vector was amplified with primers FDHAJOEF / FUHAJOER2, and after ligation, the vector JOEnprP was obtained. 43 BglC2006 was transformed to obtain BSnprP. 43 BglC2006 strain.

[0066] Using the JOEsprP 43 BglC2006 vector as a template, primers M2006TB9F / M2006TB9R, M2006TB4F / M2006TB4R, M2006TB5F / M2006TB5R, M2006TH1F / M2006TH1R were used to introduce terminators TB9, TB4, TB5, TH1 at the 2006 gene end of the JOEsprP 43 BglC2006 vector respectively, thus obtaining vectors JOEsprP 43 BglC2006TB9, JOEsprP 43 BglC2006TB4, JOEsprP 43 BglC2006TB5, JOEsprP 43 BglC2006TH1, which were transformed to obtain BSsprP 43 BglC2006TB9, BSsprP 43 BglC2006TB4, BSsprP 43 BglC2006TB5, BSsprP 43 BglC2006TH1 strains.

[0067] Refer to the method disclosed by Xiao et al. in the literature (Xiao J, Peng B, Su Z, et al. Facilitating protein expression with portable 5'-UTR secondary structures in Bacillus licheniformis [J]. Acs Synth Biol, 2020, 9(5): 1051-1058), and use the primer MP 4312 eglSF / MP 4312 R to replace the 5'-UTR of the JOEsprP 43 BglC2006TB4 vector with UTR-12, thereby optimizing the P 43 promoter to P 12 promoter, and obtain the vector JOEsprP 12 BglC2006TB4, and transform to obtain BSsprP 12 BglC2006TB4 strain.

[0068] Using the JOEsprP 12 BglC2006TB4 vector as a template, use the primers PJOEP 12 F / PJOETB4R to amplify the P 12 -BglC-2006-TB4 gene expression cassette (as shown in SEQ ID NO.1), using the pJOE8999 shuttle expression vector as a template, use the primers PTerJOEF / PP 12 JOER to amplify the pJOE8999 shuttle expression vector backbone without the Cas9 gene, and after ligation, obtain the vector pJOEP 12 BglC2006TB4, and after transformation, obtain BSpP 12 BglC2006TB4 strain.

[0069] Using the JOEsprP 12 BglC2006TB4 vector as a template, use the primers FUHAlacP 12 F / FDHAlacTB4R to amplify the P 12 -BglC-2006-TB4 gene expression cassette, using the JOElacP 43 BglC2006 vector as a template, use the primers FTH1DHAlacF / FP 12 lacR to amplify the JOElacP 43 BglC2006 vector backbone, and after ligation, obtain the vector JOElacP 12 BglC2006TB4. Using the B. subtilis 168 strain as a template, use the primer FP12 PhoBF / F2006PhoBR, FP 12 PhoDF / F2006PhoDR, FP 12 YwbF / F2006YwbR, FP 12 LipF / F2006LipR were used to amplify the signal peptides PhoB, PhoD, YwbN, and LipA respectively, with JOElacP 12 BglC2006TB4 vector as the template and primers FSP2006F / FSPP 12 R to amplify the JOElacP 12 BglC2006TB4 vector backbone for connecting the signal peptides PhoB, PhoD, YwbN, and LipA. After connection, vectors JOElacP 12 PhoB2006TB4, JOElacP 12 PhoD2006TB4, JOElacP 12 Ywb2006TB4, JOElacP 12 Lip2006TB4 were obtained; JOElacP 12 BglC2006TB4, JOElacP 12 PhoB2006TB4, JOElacP 12 PhoD2006TB4, JOElacP 12 Ywb2006TB4, JOElacP 12 Lip2006TB4, JOEKI2006 vectors were respectively expressed in the BSsprP 12 BglC2006TB4 strain to obtain BSsprlacBglC2006, BSsprlacPhoB2006, BSsprlacPhoD2006, BSsprlacYwb2006, BSsprlacLip2006, and BSspreglS2006 strains. The results are as Figure 2 shown. The sequences of each primer and the strains are shown in Tables 1 - 2.

[0070] P 12 The nucleotide sequence of the -BglC-2006-TB4 gene expression cassette is shown in SEQ ID NO.1.

[0071] SEQ ID NO.1:

[0072]

[0073] The nucleotide sequence of sgsprE is shown in SEQ ID NO.5.

[0074] SEQ ID NO.5: GAGTGAGAAGCAAAAAATTG

[0075] The nucleotide sequence of sgnprE is shown in SEQ ID NO.6.

[0076] SEQ ID NO.6: GAAAGCACGACTGATGCCCT

[0077] The nucleotide sequence of sgthrC is shown in SEQ ID NO.7.

[0078] SEQ ID NO.7: GAGCTTCATGTCAAAACGGA

[0079] The nucleotide sequence of sglacZ is shown in SEQ ID NO.8.

[0080] SEQ ID NO.8: GGCGTAAATGTTGTGCGGAT

[0081] Example 3: Expression and Optimization of Bifunctional Cellulase Gene Bf1

[0082] Using the B. subtilis 168 strain as a template, primers FJOEUHAnprF2 / FP 43 UHAnprR, FUHAnprP 43 F / FSPP 43 R, FP 43 LipF / FBfLipR, FBfDHAnprF / FJOEDHAnprR2 were used to amplify the upstream homologous arm UHAnpr targeting the nprE locus, promoter P 43 、signal peptide LipA, the downstream homologous arm DHAnpr targeting the nprE locus. Using the pET-Bf vector as a template, primers FLipBfF / FDHAnprBfR were used to amplify the bifunctional cellulase gene Bf1. Using the JOEsgnprE vector as a template, primers FDHAJOEF2 / FUHAJOER were used to amplify the JOEsgnprE vector backbone. After ligation, the vector JOEnprP 43 LipBf was obtained, and BSnprP 43 LipBf strain was transformed.

[0083] Using JOEnprP 43Using the LipBf vector as a template, primers MBfTB9F / MBfTB9R, MBfTB5F / MBfTB5R, MBfTH1F / MBfTH1R, and MBfTB4F / MBfTB4R were used to introduce terminators TB9, TB5, TH1, and TB4 at the ends of the Bf1 gene of the LipBf vector, respectively, to obtain vectors JOEnprP 43 At the end of the Bf1 gene of the LipBf vector, terminators TB9, TB5, TH1, and TB4 were introduced by site-directed mutagenesis to obtain vectors JOEnprP 43 LipBfTB9, JOEnprP 43 LipBfTB5, JOEnprP 43 LipBfTH1, JOEnprP 43 LipBfTB4, and they were separately transformed to obtain BSnprP 43 LipBfTB9, BSnprP 43 LipBfTB5, BSnprP 43 LipBfTH1, BSnprP 43 LipBfTB4 strains.

[0084] Using the B. subtilis 168 strain as a template, primers FJOEUHAlacF2 / FP 43 UHAlacR, FTH1DHAlacF / FJOEDHAlacR2 were used to amplify the upstream homologous arm UHAlac targeting the lacZ locus and the downstream homologous arm DHAlac targeting the lacZ locus. Using the JOEnprP 43 LipBfTH1 vector as a template, primers FUHAlacP 43 F / FDHAlacTH1R were used to amplify the P 43 -LipA-Bf1-TH1 gene expression cassette. Using the JOEsglacZ vector as a template, primers FDHAJOEF2 / FUHAJOER were used to amplify the JOEsglacZ vector backbone. After ligation, vector JOElacP 43 LipBfTH1 was obtained and transformed to obtain BSlacP 43 LipBfTH1 strains.

[0085] Using the B. subtilis 168 strain as a template, primers FJOEUHAthrF2 / FP 43 UHAthrR, FTH1DHAthrF / FJOEDHAthrR2 were used to amplify the upstream homologous arm UHAthr targeting the thrC locus and the downstream homologous arm DHAthr targeting the thrC locus. Using the JOEnprP 43 LipBfTH1 vector as a template, primers FUHAthrP 43F / FDHAthrTH1R Amplification P 43 -LipA-Bf1-TH1 gene expression cassette. Using the JOEsgthrC vector as a template, the backbone of the JOEsgthrC vector was amplified with primers FDHAJOEF2 / FUHAJOER, and after ligation, the vector JOEthrP was obtained 43 LipBfTH1, and BSthrP was transformed 43 LipBfTH1 strain

[0086] Using B. subtilis 168 strain as a template, primers FJOEUHAsprF2 / FP 43 UHAsprR, FTH1DHAsprF / FJOEDHAsprR2 were used to amplify the upstream homologous arm UHAspr targeting the sprE locus and the downstream homologous arm DHAspr targeting the sprE locus respectively. Using JOEnprP 43 Using the LipBfTH1 vector as a template, primer FUHAsprP 43 F / FDHAsprTH1R Amplification P 43 -LipA-Bf1-TH1 gene expression cassette. Using the JOEsgsprE vector as a template, the backbone of the JOEsgsprE vector was amplified with primers FDHAJOEF2 / FUHAJOER, and after ligation, the vector JOEsprP was obtained 43 LipBfTH1, and BSsprP was transformed 43 LipBfTH1 strain

[0087] Using B. subtilis 168 strain as a template, primers FP 43 blCF2 / FBfblCR, FP 43 YwbF / FBfYwbR, FP 43 phoDF / FBfphoDR, FP 43 phoBF / FBfphoBR were used to amplify the signal peptides BglC, YwbN, PhoD, PhoB respectively. Using JOEthrP 43 Using the LipBfTH1 vector as a template, primers FblCBfF / FSPP 43 R were used to amplify the JOEthrP 43 LipBfTH1 vector backbone for ligating the signal peptides BglC, YwbN, PhoD, PhoB respectively. After ligation, the vectors JOEthrP 43 BglCBfTH1, JOEthrP 43 YwbBfTH1, JOEthrP 43 PhoDBfTH1, JOEthrP 43PhoBBfTH1 was respectively transformed to obtain BSthrP 43 BglCBfTH1, BSthrP 43 YwbBfTH1, BSthrP 43 PhoDBfTH1, BSthrP 43 PhoBBfTH1 strain.

[0088] Referring to the method described in Example 2, using primer MP 43 YwbF / MP 4312 R replaced the 5'-UTR of the JOEthrP 43 YwbBfTH1 vector with UTR-12, thereby optimizing the P 43 promoter to P 12 promoter, obtaining the vector JOEthrP 12 YwbBfTH1, and transforming to obtain BSthrP 12 YwbBfTH1 strain.

[0089] Using B. subtilis 168 strain as a template and using primers FP 43 PhoBF / FBfPhoBR, FP 43 PhoDF / FBfPhoDR were used to amplify the signal peptides PhoB and PhoD respectively. Using the JOElacP 43 LipBfTH1 vector as a template and using primers FblCBfF / FSPP 43 R to amplify the JOElacP 43 LipBfTH1 vector backbone for connecting the signal peptides PhoB and PhoD. After ligation, the vectors JOElacP 43 PhoBfTH1 and JOElacP 43 PhoDBfTH1 were obtained respectively; the JOElacP 43 LipBfTH1, JOElacP 43 PhoBfTH1, and JOElacP 43 PhoDBfTH1 vectors were respectively expressed in the BSthrYwbBfTH1 strain to obtain the BSthrlacLipBf, BSthrlacPhoBBf, and BSthrlacPhoDBf strains.

[0090] Using the JOEthrP 43 YwbBfTH1 vector as a template and using primer PJOEP 43 F / PJOETH1R to amplify P 43-YwbN-Bf1-TH1 gene expression cassette (as shown in SEQ ID NO.3), using the pJOE8999 shuttle expression vector as a template and primers PTerJOEF / PP 43 JOER to amplify the pJOE8999 shuttle expression vector backbone, and after ligation, the vector pJOEP was obtained 43 YwbBfTH1, and after transformation, BSpP was obtained 43 YwbBfTH1 strain, and the results are as Figure 2 shown. The sequences of each primer and the strains are shown in Tables 1-2

[0091] P 43 -The nucleotide sequence of the -YwbN-Bf1-TH1 gene expression cassette is as shown in SEQ ID NO.3

[0092] SEQ ID NO.3:

[0093]

[0094] Example 4: Co-expression of cellulase and construction of Bacillus subtilis K3P2C

[0095] Using JOEsprP 12 BglC2006TB4 vector as a template, use primers PJOEP 43 F / PP 43 TB4R to amplify the P 12 -BglC-2006-TB4 gene expression cassette. Using JOEthrP 43 YwbBfTH1 vector as a template, use primers PTB4P 43 F / PJOETH1R to amplify the P 43 -YwbN-Bf1-TH1 gene expression cassette. Using pJOE8999 shuttle expression vector as a template, use primers PTerJOEF / PP 43 JOER to amplify the pJOE8999 shuttle expression vector backbone. After ligation, the cellulase expression vector pJOE2006Bf is obtained. Transform the cellulase expression vector pJOE2006Bf into B. subtilis 168 strain to obtain BSp2006Bf strain.

[0096] Express the JOEthrP 43 YwbBfTH1 vector in BSSprP 12 BglC2006TB4 strain, so as to realize the integration of the P 43 -YwbN-Bf1-TH1 gene expression cassette into the thrC locus of BSSprP 12 BglC2006TB4 strain to obtain BSSpr2006thrBf strain.

[0097] Express the JOElacP 12 Lip2006TB4 vector in BSSpr2006thrBf strain, so as to realize the integration of the P 12 -LipA-2006-TB4 gene expression cassette into the lacZ locus of B. subtilis 168 strain to obtain the recombinant strain BSKI3Cel.

[0098] Transform the cellulase expression vector pJOE2006Bf into the recombinant strain BSKI3Cel to obtain Bacillus subtilis K3P2C, and the results are as Figure 2 shown. The primer sequences and strains are shown in Tables 1 - 2.

[0099] P 12The nucleotide sequence of the -LipA-2006-TB4 gene expression cassette is shown in SEQ ID NO.2.

[0100] SEQ ID NO.2:

[0101]

[0102] Table 1 Primer sequences for constructing each vector

[0103]

[0104]

[0105]

[0106]

[0107]

[0108] Table 2 Transformed strains and their characteristics

[0109]

[0110]

[0111] Experimental Example 1: Determination of endo-β-1,4-glucanase activity in cellulase

[0112] Each strain was cultured in LB medium containing 1% CMC-Na (carboxymethyl cellulose sodium) at 37 °C and 220 rpm for 24 h. After centrifugation of the bacterial solution, the enzyme solution of each strain was obtained. Referring to the DNS method disclosed by Wang et al. in the literature (Wang Z, Tang H, Liu G, et al. Compound probiotics producing cellulase could replace cellulase preparations during solid-state fermentation of millet bran[J]. Bioresour Technol, 2023, 385:129457), the endo-β-1,4-glucanase (EG) activity of each strain was measured using 1% CMC-Na as the substrate. The results are as Figure 3 shown in Table 3, where 168WT represents the B. subtilis 168 strain.

[0113] Definition of EG enzyme activity unit: The amount of enzyme solution required to release 1 μg of reducing sugar from 1% CMC-Na per minute at 50 °C.

[0114] The results showed that the gene expression cassette containing the endoglucanase gene 2006 from B. subtilis RLI2019 was knocked into the eglS locus of B. subtilis 168 strain, and the EG activity of the obtained BSKI2006 strain was increased by 59.18% compared with that of B. subtilis 168 strain; BSsprP 43 The EG activity of BglC2006 strain was increased by 6.82 times compared with that of B. subtilis 168 strain, indicating that P 43 The promoter synergistically with the signal peptide BglC from B. subtilis RLI2019 had the best EG secretion effect on the 2006 gene; P 43 -BglC-2006 gene expression cassette was knocked into the sprE locus to obtain BSsprP 43 BglC2006 strain had the highest expression efficiency of the 2006 gene. There was no significant difference in the expression efficiency of the 2006 gene after being knocked into the nprE and lacZ loci respectively; At P 43 -BglC-2006 gene expression cassette adding the terminator TB4 at the end had the best promoting effect on the secretion of EG by the 2006 gene; P 43 The P of the -BglC-2006-TB4 gene expression cassette 43 Promoter optimized to P 12 Promoter could improve the EG activity; In BSsprP 12 The eglS and lacZ loci of BglC2006TB4 strain were knocked into P 12 -YwbN-2006 and P 12 -LipA-2006 gene expression cassettes respectively, which could increase the EG activity by 6.42% and 12.96% respectively; In addition, to verify the expression effect of the -BglC-2006-TB4 gene expression cassette, the Cas9 gene on the backbone of the pJOE8999 shuttle expression vector was knocked out and P 12 -BglC-2006-TB4 gene expression cassette was added, and the obtained BSpP 12 The EG activity of BglC2006TB4 strain was only 73.32 U / mL. 12 BglC2006TB4 strain was only 73.32 U / mL.

[0115] Table 3 Endo-β-1,4-glucanase activities of each strain

[0116]

[0117]

[0118] Experimental example 2: Determination of β-glucosidase activity in cellulase

[0119] Cultivate each strain in LB medium containing 1% CMC-Na at 37°C and 220 rpm for 24 h, and centrifuge the bacterial solution to obtain the enzyme solution of each strain; Take 100 μL of the enzyme solution of each strain and react with 50 μL of 5 mmol / L 4-nitrophenyl-D-glucopyranoside (pNPG) at 50°C for 30 min, then add 200 μL of 1 moL / L Na2CO3 to each to terminate the reaction and measure the OD 410nm value to obtain the β-glucosidase (CB) activity of each strain. The results are as Figure 4 shown in and Table 4, where 168WT represents B. subtilis 168 strain.

[0120] Definition of CB enzyme activity unit: The amount of enzyme solution required to release 1 μg pNP from pNPG per minute at 50°C.

[0121] The results showed that the B. subtilis 168 strain had no CB activity; The BSnprP 43 obtained by knocking the P-LipA-Bf1-TB9 gene expression cassette into the nprE locus of the B. subtilis 168 strain 43 LipBfTB9 strain had CB activity, which was 57.46 U / mL; Optimizing the terminator TB9 of the P-LipA-Bf1-TB9 gene expression cassette to TH1 could improve the CB activity; After knocking the P-LipA-Bf1-TH1 gene expression cassette into the thrC locus of the B. subtilis 168 strain, the expression efficiency of the Bf1 gene was the highest; The signal peptide YwbN had the best promoting effect on the secretion of CB by the Bf1 gene; After expressing the Bf1 gene using the P 43 promoter, the CB activity did not change significantly. 43 -LipA-Bf1-TH1 gene expression cassette knocked into the thrC locus of the B. subtilis 168 strain, the expression efficiency of the Bf1 gene was the highest; The signal peptide YwbN had the best promoting effect on the secretion of CB by the Bf1 gene; After expressing the Bf1 gene using the P 12 promoter, the CB activity did not change significantly.

[0122] Table 4 β-Glucosidase activity of each strain

[0123] Strain Name CB Activity (U / mL) Strain Name CB Activity (U / mL) 168WT 0 <![CDATA[BSthrP 43 YwbBfTH1]]> 349.26 <![CDATA[BSnprP 43 LipBfTB9]]> 57.46 <![CDATA[BSthrP 43 phoDBfTH1]]> 106.78 <![CDATA[BSnprP 43 LipBfTB5]]> 84.31 <![CDATA[BSthrP 43 phoBBfTH1]]> 125.10 <![CDATA[BSnprP 43 LipBfTH1]]> 136.32 <![CDATA[BSthrP 12 YwbBfTH1]]> 358.03 <![CDATA[BSnprP 43 LipBfTB4]]> 116.50 <![CDATA[BSpP 43 YwbBfTH1]]> 203.62 <![CDATA[BSlacP 43 LipBfTH1]]> 127.42 BSthrlacLipBf 330.91 <![CDATA[BSthrP 43 LipBfTH1]]> 181.11 BSthrlacPhoBBf 329.75 <![CDATA[BSsprP 43 LipBfTH1]]> 148.12 BSthrlacPhoDBf 342.13 <![CDATA[BSthrP 43 blCBfTH1]]> 112.04

[0124] Experimental Example 3: Determination of cellulase activity

[0125] Cultivate each strain in LB medium containing 1% CMC-Na at 37°C and 220 rpm for 24 h, and centrifuge the bacterial solution to obtain the enzyme solution of each strain; Take 100 μL of the enzyme solution of each strain and react with 50 μL of 1 mg / mL 4-nitrophenyl-β-D-cellobioside (HPLC) at 50°C for 30 min, then add 200 μL of 1 moL / L Na2CO3 to each to terminate the reaction and measure the OD 410nmValues were obtained for the exo-β-1,4-glucanase (CBH) activity of each strain, and the EG and CB activities of each strain were determined according to the methods described in Examples 1-2. The results are as Figure 5 shown in Table 5, where 168WT represents the B. subtilis 168 strain and BSK3P2C represents Bacillus subtilis K3P2C.

[0126] Definition of CBH enzyme activity unit: The amount of enzyme solution required to release 1 μg pNP from HPLC degradation per minute at 50°C.

[0127] The cellulase activities of the recombinant strain BSKI3Cel and Bacillus subtilis K3P2C at different times were measured. The results are as Figure 6 shown in Tables 6-7.

[0128] The results showed that in the B. subtilis 168 strain, the BSp2006Bf strain obtained by co-expressing the P 12 -BglC-2006-TB4 and P 43 -YwbN-Bf1-TH1 gene expression cassettes had EG, CBH, and CB activities of 59.51 U / mL, 247.99 U / mL, and 183.08 U / mL, respectively; the BSpr2006thrBf strain obtained by knocking the P 12 -BglC-2006-TB4 and P 43 -YwbN-Bf1-TH1 gene expression cassettes into the sprE and thrC loci of the B. subtilis 168 strain had EG, CBH, and CB activities of 106.85 U / mL, 453.70 U / mL, and 359.25 U / mL, respectively; the recombinant strain BSKI3Cel obtained by knocking the P 12 -LipA-2006-TB4 gene expression cassette into the lacZ locus of the BSpr2006thrBf strain had EG, CBH, and CB activities of 129.59 U / mL, 596.75 U / mL, and 447.42 U / mL, respectively; Bacillus subtilis K3P2C obtained by transforming the cellulase expression vector pJOE2006Bf into the recombinant strain BSKI3Cel had EG, CBH, and CB activities of 267.82 U / mL, 1413.84 U / mL, and 943.66 U / mL, respectively.

[0129] The recombinant strain BSKI3Cel and Bacillus subtilis K3P2C both had relatively high cellulase activities on the 7th - 9th day. Among them, the recombinant strain BSKI3Cel had the highest EG and CBH activities on the 7th day, which were 407.89 U / mL and 2291.45 U / mL respectively, and had the highest CB activity on the 9th day, which was 2168.45 U / mL; Bacillus subtilis K3P2C had the highest EG and CB activities on the 9th day, which were 536.78 U / mL and 3510.75 U / mL respectively, and had the highest CBH activity on the 7th day, which was 3078.46 U / mL.

[0130] Table 5 Cellulase activities of each strain

[0131]

[0132]

[0133] Table 6 Cellulase activities of the recombinant strain BSKI3Cel at different times

[0134] Time (d) EG Activity (U / mL) CBH Activity (U / mL) CB Activity (U / mL) 1 129.59 596.75 447.42 2 217.79 698.46 662.44 3 334.79 963.62 1323.94 4 366.81 1149.37 1575.79 5 388.55 1176.25 1592.98 6 393.15 1447.00 1800.15 7 407.89 2291.45 2127.29 8 404.53 2240.52 2084.96 9 396.58 1700.39 2168.45 10 343.07 783.01 882.75

[0135] Table 7 Cellulase activities of Bacillus subtilis K3P2C at different times

[0136] Time (d) EG Activity (U / mL) CBH Activity (U / mL) CB Activity (U / mL) 1 267.82 1413.84 943.66 2 293.10 1513.51 1145.21 3 329.88 1590.47 1435.11 4 436.37 1830.31 1581.59 5 487.73 2394.52 1720.82 6 485.82 2656.54 2159.45 7 518.09 3078.46 2390.09 8 533.16 2959.83 2829.61 9 536.78 2847.00 3510.75 10 344.29 928.89 962.46

[0137] Experimental Example 4: Straw degradation effect of Bacillus subtilis K3P2C

[0138] With a viable cell concentration of 5.0×10 8The Bacillus subtilis K3P2C bacterial solution with a concentration of CFU / mL was inoculated into 112.5 mL of an infiltration medium containing 0.5% NH4NO3, 0.1% MgSO4·7H2O, and 0.1% NaCl at a ratio of 5%. The infiltration medium was prepared according to the method disclosed by Liu et al. in the literature (Liu G, Zhang K, Gong H, et al. Whole genome sequencing and the lignocellulose degradation potential of Bacillus subtilis RLI2019 isolated from the intestine of termites [J]. Biotechnol Biofuels Bioprod, 2023, 16(1):130); 30 g of wheat straw that had been sterilized, dried to a constant weight, and passed through a 2-mm sieve was added to the infiltration medium and mixed evenly, and solid-state fermentation was carried out at 37°C; fermentation samples were collected on the 0th day, 4th day, and 8th day of solid-state fermentation as the EB0 group, EB4 group, and EB8 group, respectively. At the same time, the fermentation sample obtained by solid-state fermentation of the B. subtilis 168 strain under the same conditions for 8 days was used as a control (WT8 group).

[0139] The water content, dry matter, and pH in each fermentation sample were measured according to the method disclosed by Su et al. in the literature (Su W, Jiang Z, Wang C, et al. Dynamics of defatted rice bran in physicochemical characteristics, microbiota and metabolic functions during two-stage co-fermentation [J]. Int J Food Microbiol, 2022, 362:109489); the lignin content and hemicellulose content in each fermentation sample were measured using a lignin content detection kit and a hemicellulose content detection kit, respectively; the neutral detergent fiber (NDF) content and acid detergent fiber (ADF) content in each fermentation sample were measured using an A200I fiber analyzer. The results are shown in Table 8.

[0140] After drying, crushing, and sieving each fermentation sample through a 400-mesh sieve, it was fixed on an operating table with conductive adhesive. Gold spraying was carried out according to the method disclosed by Liu et al. in the literature (Liu G, Zhang K, Gong H, et al. Whole genome sequencing and the lignocellulose degradation potential of Bacillus subtilis RLI2019 isolated from the intestine of termites[J]. Biotechnol Biofuels Bioprod, 2023, 16(1):130). Then, a Nano SEM-450 field emission scanning electron microscope was used to observe the morphology of each fermentation sample, and the results are as Figure 7 shown.

[0141] The results of solid-state fermentation showed that compared with the EB0 group, the contents of hemicellulose, NDF, and ADF in the fermentation samples of the EB8 group were significantly reduced by 26.42%, 7.46%, and 9.93% respectively, and the pH increased significantly by 37.84%; compared with the WT8 group, the contents of hemicellulose, NDF, and ADF in the fermentation samples of the EB8 group were significantly reduced by 17.08%, 6.71%, and 8.92% respectively, and the pH increased significantly by 2.93%. This indicates that Bacillus subtilis K3P2C can effectively degrade hemicellulose, NDF, and ADF in wheat straw and significantly increase the pH of the fermentation products.

[0142] The results of scanning electron microscopy observations showed that the surface of the wheat straw in the EB0 group was relatively smooth and flat. Concave and convex structures appeared on the surface of the wheat straw in the EB4 group, and there were a small number of corrugated textures. The concave and convex structures and corrugated textures on the surface of the wheat straw in the EB8 group increased significantly and showed a loose and porous shape. This is because the enzymatic hydrolysis and fermentation processes of Bacillus subtilis K3P2C led to the loss of components such as cellulose, hemicellulose, lignin, and pectin on the surface layer of wheat bran, resulting in an increase in voids and a larger pore size, which helps to improve its adsorption performance for cellulose biomass; only a small number of corrugated structures appeared on the surface layer of the wheat straw in the WT8 group. This indicates that Bacillus subtilis K3P2C can more effectively degrade the lignocellulose structure on the surface layer of crop straw and plays an important role in improving the physical and chemical properties of crop straw.

[0143] Table 8 Degradation results of Bacillus subtilis K3P2C on wheat straw

[0144]

[0145]

[0146] As can be seen from the above embodiments, the present invention provides a Bacillus subtilis with high cellulase productivity, and its construction method and application. The Bacillus subtilis K3P2C constructed by the present invention can produce endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase with high yield and high activity, can effectively degrade hemicellulose, NDF and ADF in crop straw, significantly increase the pH of the fermentation product, and can cause the loss of components such as cellulose, hemicellulose, lignin and pectin on the surface of crop straw during the enzymatic hydrolysis and fermentation processes, more effectively degrade the lignocellulose structure on the surface of crop straw, and promote the increase of voids and the enlargement of pore size, thereby helping to improve the adsorption performance of crop straw to microorganisms and digestive enzymes, and playing an important role in improving the physicochemical properties of crop straw.

[0147] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A Bacillus subtilis with high cellulase productivity, characterized in that, The Bacillus subtilis is Bacillus subtilis K3P2C, which is deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, the deposit date being August 14, 2024, and the deposit number being CCTCC No. M20241787.

2. Use of the Bacillus subtilis according to claim 1 in the preparation of a preparation with high cellulase yield; The cellulase includes endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

3. A microbial agent with high cellulase productivity, characterized in that, The bacterial agent includes the Bacillus subtilis according to claim 1.

4. Use of the Bacillus subtilis according to claim 1 or the bacterial agent according to claim 3 in the degradation of crop straw.

Citation Information

Patent Citations

  • Cloning, expression and application of a β-glucosidase gene

    CN102268421A

  • Bacillus subtilis for co-expressing multi-element cellulase gene as well as construction method and application of bacillus subtilis

    CN117264861A