SgRNA for targeted knockout of LPA gene, recombinant expression vector and method for knocking out LPA gene

Abstract

The invention provides sgRNA for targeted knockout of an LPA gene, a recombinant expression vector and a method for knocking out the LPA gene, and relates to the technical field of gene engineering. According to the sgRNA for targeted knockout of the LPA gene, the nucleotide sequence of the sgRNA is selected from any one of the sequences as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 14 and SEQ ID No. 15. According to the present invention, by using the characteristics of the CRISPR / Cas9 gene editing system, aiming at all exons and introns of the LPA gene, all the targets capable of gene knockout are designed, and the editing efficiency and the expression level are evaluated, such that the new target is provided for the new clinical drug in the future.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and specifically to sgRNA for targeted knockout of LPA gene, a recombinant expression vector, and a method for knocking out LPA gene. Background Art

[0002] Cardiovascular disease is the most important disease threatening human health worldwide. The mortality rate of cardiovascular disease, mainly atherosclerotic cardiovascular disease (ASCVD), accounts for more than 40%, and there is still a trend of increasing year by year. Risk factors for ASCVD include smoking, hypertension, diabetes, hyperlipidemia, etc., among which low-density lipoprotein cholesterol (LDL-c) is the pathogenic risk factor for ASCVD. A large number of clinical research experimental evidences have confirmed that the degree of reduction of LDL-c level is positively correlated with the incidence of ASCVD events. However, with the in-depth study of lipoproteins in recent years, more and more evidence shows that lipoprotein a [Lp(a)] is also an important factor involved in the pathophysiological mechanism of ASCVD.

[0003] Lp(a) is composed of two proteins, apo(a) and apoB-100, of which apo(a) is mainly encoded by the LPA gene. The LPA gene encodes two kringle domains (KIV and KV), and KIV further expands to 10 subtypes, among which KIV2 has gene copy number variations in different populations, resulting in 1 to 40 repeated copies. All KIV copies can be transcribed and translated. The fewer the number of KIV copies, the faster the synthesis and secretion of apo(a) protein, thus resulting in the polymorphism of apo(a) protein size and the high heritability of LP(a) plasma concentration. The level of plasma LP(a) is skewed in the population, ranging from <0.1mg / dl to >300mg / dl, and there are also large differences between different races. For every 50nmol / L increase in LP(a) level, the risk of ASCVD increases by 10%. Even when LDL-c levels are low, increased LP(a) levels will increase the risk of ASCVD.

[0004] Currently, the most common lipid-lowering methods include improving lifestyle, statins, ezetimibe, PCSK9 inhibitors, etc., which can effectively reduce LDL-C levels in the vast majority of patients, thereby reducing the risk of cardiovascular events. However, these lipid-lowering methods do not have a significant effect on reducing plasma Lp(a). Among them, statins not only do not reduce LP(a) levels, but increase them by 20%; although PCSK9 inhibitors can slightly reduce LP(a) levels (about 20-30%), they still do not meet the needs of most patients in clinical practice. Therefore, there is an urgent need for a treatment method that can reduce LP(a) levels in a long-term and sustainable manner. Summary of the invention

[0005] In order to overcome the above-mentioned defects in the prior art, the present application provides sgRNA, a recombinant expression vector and a method for knocking out the LPA gene for targeted knockout of the LPA gene. By utilizing the characteristics of the CRISPR / Cas9 gene editing system, all targets for gene knockout are designed for all exons and introns of the LPA gene, and their editing efficiency and expression level are evaluated, providing new targets for the screening of new drugs in the clinic in the future.

[0006] In order to achieve the above-mentioned invention object, this application provides the following technical solutions:

[0007] On the one hand, the present application provides an sgRNA for targeted knockout of the LPA gene, wherein the nucleotide sequence of the sgRNA is selected from any one of the sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.9, SEQ ID No.11, SEQ ID No.3, SEQ ID No.4, SEQID No.5, SEQ ID No.14, and SEQ ID No.15.

[0008] In a second aspect, the present application provides a recombinant expression vector for targeted knockout of the LPA gene, wherein the recombinant expression vector comprises the above-mentioned sgRNA.

[0009] In a third aspect, the present application provides a method for constructing the above-mentioned recombinant expression vector for targeted knockout of the LPA gene, comprising the following steps:

[0010] (1) designing and synthesizing the sgRNA;

[0011] (2) adding the BbsI restriction site caccg to the 5' end of the sgRNA sequence to obtain the sequence 5'-caccg-sgRNA-3', and synthesizing its complementary sequence 5'-aaac-sgRNA-c-3';

[0012] (3) annealing the sequences 5'-caccg-sgRNA-3' and 5'-aaac-sgRNA-c-3' to obtain a double-stranded DNA molecule;

[0013] (4) Connecting the double-stranded DNA molecule to a vector to obtain a recombinant expression vector for targeted knockout of the LPA gene.

[0014] Optionally, in step (3), the annealing temperature is 94-96° C.;

[0015] The annealing time is 4 to 6 minutes.

[0016] Optionally, in step (3), the annealing temperature is independently selected from any value among 94° C., 95° C., 96° C., or any range between the two.

[0017] Optionally, in step (3), the annealing time is independently selected from any value among 4 min, 5 min, 6 min, or any range between the two.

[0018] Optionally, in step (4), the vector contains Cas9 protein.

[0019] Optionally, in step (4), the vector comprises a PX459 vector digested with BbsI.

[0020] In a fourth aspect, the present application provides a method for specifically knocking out the LPA gene based on the CRISPR-Cas9 system, comprising the following steps:

[0021] The above-mentioned recombinant expression vector is introduced into cells, and LPA is gene-edited to knock out the LPA gene.

[0022] Optionally, the introduction method includes liposome transfection.

[0023] Optionally, the transfection amount of the liposome transfection method is 2 to 4 μg.

[0024] Optionally, the transfection amount of the liposome transfection method is independently selected from any value among 2 μg, 3 μg, 4 μg, or any range between the two.

[0025] Optionally, the cells include HEK293T cells or HepG2 cells.

[0026] Preferably, the cells are HepG2 cells.

[0027] Optionally, the cells introduced with the recombinant expression vector are cultured for 48 hours, the genomic DNA of the cells obtained in the above step is extracted, and gene sequencing is performed after PCR to observe the gene editing efficiency; at the same time, the RNA of the cells obtained in the above step is extracted, and the mRNA level of LPA is detected after real-time PCR.

[0028] The present application also provides a pharmaceutical composition, which comprises:

[0029] A delivery vector and the above-mentioned sgRNA, or the expression vector.

[0030] Exemplarily, the delivery vehicle is selected from one or more of polymer liposomes, nanoparticles, viral vectors or extracellular vesicles.

[0031] The present application also provides the use of the sgRNA described herein, the expression vector described herein, or the pharmaceutical composition described herein in preparing one of the following products:

[0032] 1) Products of LPA gene editing in vitro;

[0033] 2) products that reduce apolipoprotein(a) and lipoprotein(a);

[0034] 3) Drugs for the treatment of cardiovascular diseases.

[0035] Exemplarily, the cardiovascular disease is selected from one or more of hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease or aortic atherosclerosis.

[0036] The present application also provides a method for specifically knocking out the LPA gene in vitro, characterized in that it comprises the following steps:

[0037] The sgRNA described in this article and the recombinant expression vector described in this article are introduced into cells, and LPA is gene-edited to knock out the LPA gene in a targeted manner.

[0038] Exemplarily, the introduction method includes one or more of liposome transfection, viral transduction, electroporation, microinjection, particle bombardment or gene gun transformation.

[0039] In the present application, the CRISPR-Cas9 system refers to a CRISPR-Cas system suitable for artificial modification, which is a nuclease system derived from the archaeal type II (CRISPR)-CRISPR-associated protein (Cas) system. Compared with ZFN and TALEN, this system is simpler and easier to operate.

[0040] In the present application, RNA-guided endonucleases (RGENs) are used to achieve specific cutting of the target gene sequence. RGENs are composed of chimeric guide RNA and Cas9 protein, wherein the former fuses the CRISPR RNAs (crRNAs) and trans-activating crRNA (tracrRNA) in the naturally occurring type II CRISPR-Cas system into a single-stranded guide RNA (sgRNA), thereby binding to the Cas9 protein and guiding the latter to simultaneously perform specific cutting of two target DNA sequences upstream and downstream of the target gene site. The cutting will form a double strand break (DSB), which can cause the deletion of large DNA fragments, thereby achieving the destruction or deletion of pathogenic genes.

[0041] Compared with the prior art, the beneficial effects of this application include:

[0042] 1. This application designs sgRNA for the full length of the LPA gene, i.e., all introns and exons, and screens sgRNA with high editing efficiency. The gene editing efficiency of this application can be as high as 86%, and large fragments of DNA are deleted in the exon region of the LPA gene, which is significantly higher than the mutation rate that can be achieved using ZFN, TALEN or Cas12a / Cpf1RNP.

[0043] 2. Due to the characteristics of the LPA gene having different KIV2 copy numbers, the DNA editing efficiency involved in this application is the average efficiency. Therefore, it is speculated that for people with low KIV2 copy numbers, the gene editing efficiency is higher and the lipid-lowering effect is also greater; the high gene editing efficiency achieved by this application is of great significance in saving time and investment in manpower and material resources; the sgRNA of this application can achieve efficient gene editing efficiency and effective lipid-lowering effect.

[0044] 3. Although SEQ ID No. 3, 4, 5, 14, and 15 showed lower editing efficiency in vitro, they showed stronger knockout effects in vivo and had stronger lipid-lowering effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0046] Figure 1 Schematic diagram of the working principle of the CRISPR / Cas9 system in this application;

[0047] Figure 2 This is the sequencing diagram of the plasmid connected with different sgRNAs of the PX459 vector of this application;

[0048] Figure 3 This is the peak diagram of genomic DNA sequencing after PCR amplification of sgRNA 1, 9, 11 transfected into HEK293T cells in this application;

[0049] Figure 4 This is the peak diagram of genomic DNA sequencing after PCR amplification of sgRNA 11 transfected HepG2 cells in this application;

[0050] Figure 5Schematic diagram of the LPA mRNA level after real-time PCR amplification of sgRNA 11 transfected HepG2 cells in this application (Note: *** indicates P < 0.001);

[0051] Figure 6 This is the sequencing peak diagram and editing efficiency diagram after PCR amplification of sgRNA 11 transfected into the liver genomic DNA of the humanized mouse model for this application (Note: *** indicates P < 0.001);

[0052] Figure 7 Schematic diagram of the real-time PCR amplification of LPA mRNA levels in the liver of the humanized mouse model transfected with sgRNA 11 in this application (Note: *** indicates P < 0.001);

[0053] Figure 8 Schematic diagram of ELISA detection of LPA expression level in plasma of humanized mouse model transfected with sgRNA 11 in this application (Note: ** indicates P < 0.01);

[0054] Fig. 9 Schematic diagram of ELISA detection of blood glucose and blood lipid levels in plasma of humanized mouse model transfected with sgRNA 11 in this application (Note: ns means no significant difference);

[0055] Fig.10 Schematic diagram of the expression level of inflammatory factors in the liver of humanized mouse model transfected with sgRNA 11 by real-time PCR amplification in this application (Note: ns indicates no significant difference);

[0056] Fig.11 Schematic diagram of HE staining of the liver of the humanized mouse model transfected with sgRNA 11 for this application;

[0057] Fig.12 Schematic diagram of Masson staining of the liver of the humanized mouse model transfected with sgRNA 11 for this application. DETAILED DESCRIPTION

[0058] The present application is further described below in conjunction with specific embodiments. The following are only a few embodiments of the present application, and are not intended to limit the present application in any form. Although the present application discloses the following preferred embodiments, they are not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the above disclosed technical content to make some changes or modifications are equivalent to equivalent implementation cases and are within the scope of the technical solution.

[0059] Unless otherwise specified, the raw materials in the examples of the present application were purchased from commercial sources and used directly without any special treatment.

[0060] Unless otherwise specified, the analysis methods in the examples all adopt conventional settings and conventional analysis methods of instruments or equipment.

[0061] Example 1

[0062] Construction and detection of CRISPR-Cas9 vector targeting LPA gene:

[0063] 1. Design sgRNAs as shown in Table 1 within the full length of the LPA gene (132.794 kb) (wherein, LPA gene ID: 4018 (https: / / www.ncbi.nlm.nih.gov / gene / 4018); the NCBI accession number of the full-length sequence is NC_000006; the ENSEMBL accession number of the CDS sequence of the LPA gene (all exons) is ENST00000316300). After knocking out the target sequence of the LPA gene shown in Table 1, the mutant protein produced will not retain most of the functional domains, so that LPA loses the function of binding to APOB100, thereby reducing the level of LP(a). Design restriction sites based on the two ends of the BbsI restriction endonuclease, add the caccg engineering oligo to the 5' end of the sgRNA, and the sequence is caccg-sgRNA; the reverse complementary sequence is aaac-sgRNA-c.

[0064] Table 1 sgRNA sequences of LPA gene

[0065]

[0066]

[0067] 2. PX459 vector was prepared with restriction enzyme system and digested according to the instructions of BbsI restriction enzyme (NEB, Ipswich, MA, USA). After digestion, 1% agarose gel electrophoresis was performed and the digestion product was recovered according to the gel recovery kit (Vazyme). Annealing and ligation (metal bath, 95°C, 5 min) were performed according to the instructions of T4 DNA Ligase (Thermo Scientific, Waltham, MA, USA). The ligation product was transformed into DH5α Escherichia coli competent cells (Invitrogen, Waltham, MA, USA), plated on ampicillin-resistant solid LB medium and cultured overnight. A single colony was sent to a sequencing company for sequencing using the U6 promoter forward primer to verify whether it was successfully constructed. Figure 2 After successful connection, the correct colony was expanded and cultured to extract the plasmid for subsequent experiments. The sgRNA designed in this application is shown in Table 1.

[0068] Example 2

[0069] Screening of LPA gene sgRNA:

[0070] 1. According to the LPA gene sequence designed by CRISPR-Cas9 based on gene editing in Example 1, after obtaining the PX459-LPA plasmid, the amount of transfection of HEK293T cells needs to be optimized. We used 2 μg, 3 μg, and 4 μg of PX459-LPA plasmid to transfect 1×10 5 HEK293T cells. The culture conditions of HEK293T cells were 37°C, 5% CO2, and the culture medium was 90% DMEM ( Life Technologies, Eggstein, Germany) plus 10% fetal bovine serum ( The medium was changed 24 h before transfection to keep the cells in exponential growth state.

[0071] 2. In this application, when the amount of CRISPR-Cas9 plasmid is greater than 4 μg, HEK293T cells die in large numbers; when the amount of CRISPR-Cas9 used is less than 2 μg, the efficiency of gene editing in cells is less than 30%; when the amount of CRISPR-Cas9 plasmid transfection is 3 μg, HEK293T cells are in good condition and the gene editing efficiency is 60%, so the amount of CRISPR-Cas9 plasmid is set to 3 μg in subsequent operations.

[0072] 3. Different PCR primers were designed according to different sgRNA sites, as shown in Table 2. After transfection of HEK293T cells for 48 hours, the cell genome was collected and PCR amplification was performed (95°C for 3 min, [95°C for 15 s, 62°C for 15 s, 72°C for 40 s] for 35 cycles, 72°C for 5 min). The amplified products were sequenced and the proportion of gene-edited DNA was calculated. The editing efficiency of all sgRNAs is shown in Table 3.

[0073] Table 2 PCR primer sequences corresponding to LPA gene sgRNA

[0074]

[0075]

[0076] Table 3 LPA gene sgRNA editing efficiency of HEK293T cells

[0077]

[0078] 4. As shown in Table 3, SEQ ID No. 1, 2, 9 and 11 sgRNAs have higher editing efficiency. Figure 3 shown.

[0079] Example 3

[0080] Verification of sgRNA editing effect in HepG2 cells in vitro:

[0081] 1. According to the SEQ ID No. 11 selected in Example 2, HepG2 cells were transfected and genome amplified according to the above method. 1×10 5 HepG2 cells. The culture conditions of HepG2 cells are 37°C, 5% CO2, and the culture medium is 90% MEM ( Life Technologies, Eggstein, Germany) plus 10% fetal bovine serum ( Life Technologies, Eggstein, Germany) and 1% penicillin-streptomycin (PAA, Coelbe, Germany), and the medium was changed 24 hours before transfection to keep the cells in an exponential growth state. 48 hours after transfection, the cell genome was collected for PCR amplification, and the efficiency of gene editing was calculated after sequencing the amplified products. Figure 4 As shown, the editing efficiency of SEQ ID No. 11 was about 59%, which was similar to that of HEK293T cells.

[0082] 2. Cell RNA was collected 48 hours after transfection of HepG2 cells according to the method of Example 2. The mRNA was reverse transcribed into cDNA using a reverse transcription kit (Thermo Scientific, Waltham, MA, USA), and the level of LPA mRNA was detected by real-time PCR under the action of SYBR green luciferase (Vazyme), as shown in Figure 2. Figure 5 As shown, the expression of LPA mRNA in transfected HepG2 cells decreased by about 76% compared with the control group.

[0083] The qPCR primer sequences used are as follows:

[0084] qPCR-F: CTGCCGTCATCACTGACAAAGTAA (as shown in SEQ ID No. 34);

[0085] qPCR-R: GTAACATTCAGTCCTGGCGGTG (as shown in SEQ ID No. 35).

[0086] Example 4

[0087] Humanized LPA mouse model verifies the editing effect of sgRNA:

[0088] 1. Humanized LPA mice were purchased from Jicui Yaokang Co., Ltd. (Jiangsu, China). SEQ ID No. 11 selected in Example 2 was sent to Paizhen Co., Ltd. (Guangzhou, China) for AAV8 vector construction. AAV8-SpCas9 (AVV expressing SpCas9) and AAV8-sgRNA 11, 3, 4, 5, 14, 15 were obtained and then injected into the tail vein (AAV8-SpCas9: 1×10 12 / pc, AAV8-sgRNA: 1×10 12 AAV was introduced into 6-8 week old humanized LPA mice ( / mouse), and liver genomic DNA of mice was collected 4 weeks after injection, sequenced after PCR amplification, and the editing efficiency was calculated. SEQ ID No.11, 3, 4, 5, 14, 15 can all achieve LPA gene editing in humanized mouse models. Therefore, although SEQ ID No.3, 4, 5, 14, 15 showed lower editing efficiency in vitro, they showed stronger knockout effects in vivo. Exemplarily, Figure 6 The editing efficiency of SEQ ID No. 11 is demonstrated.

[0089] 2. Using the same method as above, 4 weeks after the tail vein injection of AAV8-SpCas9 and AAV8-sgRNA11, 3, 4, 5, 14, 15, the livers of 6-8 week old humanized LPA mice were collected, and the mRNA was extracted and reverse transcribed into cDNA according to the method of Example 3, and the level of LPA mRNA was detected by real-time PCR. As a result, compared with the control group mice, the LPA mRNA level of humanized LPA mice after gene editing of LPA in SEQ ID No. 11, 3, 4, 5, 14, 15 decreased by about 90%. Therefore, although SEQ ID No. 3, 4, 5, 14, 15 showed lower editing efficiency in vitro, they showed stronger knockout effect in vivo, among which SEQ ID No. 4 and 5 were better, and the LPA mRNA level decreased by about 94%. For example, Figure 7 As shown, the LPA mRNA level of humanized LPA mice decreased by about 90% after AAV8-sgRNA11 gene editing of LPA compared with the control group mice.

[0090] 3. Similarly, 4 weeks after the tail vein injection of AAV8-SpCas9 and AAV8-sgRNA11, 3, 4, 5, 14, 15, the blood of 6-8 week old humanized LPA mice was collected, and the plasma was extracted under heparinized conditions. According to the instructions of the LP(a) ELISA kit (Abcam, Cambridge, USA), the changes in plasma LP(a) levels of the humanized LPA mouse model before and after gene editing were detected. As a result, compared with the control group mice, the plasma LP(a) level of humanized LPA mice after gene editing of LPA by AAV8-sgRNA11, 3, 4, 5, 14, 15 decreased by about 90%, corresponding to the decreased level of LPA mRNA. Therefore, although SEQ ID No. 3, 4, 5, 14, 15 showed lower editing efficiency in vitro, they showed stronger knockout effects in vivo, among which SEQ ID No. 4 and 5 were better, with LPA mRNA levels decreased by about 93%. Figure 8 As shown, compared with the control group mice, the plasma LP(a) level of humanized LPA mice after AAV8-sgRNA11 gene editing of LPA decreased by about 90% (corresponding to the decreased level of LPA mRNA).

[0091] 4. Similarly, 4 weeks after the tail vein injection of AAV8-SpCas9 and AAV8-sgRNA11, 3, 4, 5, 14, 15, the blood of 6-8 week-old humanized LPA mice was collected, and the plasma was extracted under heparinized conditions. According to the instructions of the ELISA kits (Abcam, Cambridge, USA) with different detection indicators, the changes in blood glucose and blood lipid (triglycerides, cholesterol, low-density lipoprotein, high-density lipoprotein) levels of the humanized LPA mouse model before and after gene editing were detected. As a result, compared with the control group, there was no significant change in blood glucose, triglycerides, cholesterol, high-density lipoprotein and low-density lipoprotein in the experimental group of mice. Exemplary results are as follows Fig. 9 shown.

[0092] Example 5

[0093] Safety assessment of LPA for in vivo gene editing:

[0094] 1. According to the method described in Example 4, 4 weeks after the tail vein injection of AAV8-SpCas9 and AAV8-sgRNA11, the livers of 6-8 week-old humanized LPA mice were harvested, and the mRNA was extracted and reverse transcribed into cDNA according to the method of Example 3, and the level of inflammatory factor mRNA was detected by real-time PCR. The results are shown in Fig.10As shown, compared with the control group mice, there was no significant change in the levels of inflammatory factors in humanized LPA mice after gene editing of LPA, indicating that the gene editing system does not cause obvious inflammatory response in the body and has good safety in the body.

[0095] The qPCR primer sequences used are as follows:

[0096] IL-6:

[0097] qPCR-F:TAGTCCTTCCTACCCCAATTTCC (as shown in SEQ ID No.36)

[0098] qPCR-R:TTGGTCCTTAGCCACTCCTTC (as shown in SEQ ID No.37)

[0099] TNF-α:

[0100] qPCR-F: ATGGCCTCCCTCTCATCAGT (as shown in SEQ ID No. 38)

[0101] qPCR-R:TTTGCTACGACGTGGGCTAC (as shown in SEQ ID No.39)

[0102] IL-1β:

[0103] qPCR-F:TGCCACCTTTTGACAGTGATG (as shown in SEQ ID No.40)

[0104] qPCR-R: AAGGTCCACGGGAAAGACAC (as shown in SEQ ID No.41)

[0105] 2. Four weeks after the tail vein injection of AAV8-SpCas9 and AAV8-sgRNA11, the livers of 6-8 week-old humanized LPA mice were harvested and fixed in 4% paraformaldehyde for 24 hours and then dehydrated in 30% sucrose. The tissues were sent to Sewell for H&E staining to observe whether there was obvious inflammatory cell infiltration, such as Fig.11 Compared with the control mice, the livers of humanized LPA mice after gene editing of LPA showed no obvious inflammatory infiltration, which was similar to the results of the mRNA of the above-mentioned inflammatory factors, indicating that the gene editing system does not cause obvious inflammatory response in vivo and has good safety in vivo.

[0106] 3. Four weeks after the tail vein injection of AAV8-SpCas9 and AAV8-sgRNA11, the livers of 6-8 week-old humanized LPA mice were harvested. The tissues were fixed and sent to Sewell for Masson staining to observe whether there were obvious fibrosis changes, such as Fig.12 Compared with the control group mice, the livers of humanized LPA mice after gene editing of LPA showed no obvious fibrosis, indicating that the gene editing system does not cause obvious inflammatory response in vivo and has good safety in vivo.

[0107] 4. Similar to 1, 2, and 3 above, AAV8-sgRNA13, 4, 5, 14, and 15 also have good in vivo safety.

[0108] Example 6

[0109] This application used a humanized LPA mouse model to verify the in vivo editing efficiency of the corresponding sgRNA, extracted RNA and plasma from mice, and evaluated the effectiveness and safety of LPA gene editing in vivo, providing a good therapeutic strategy for further reducing plasma LP(a).

[0110] The above description is only an embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions, improvements, etc. made within the principles of the present application shall be included in the protection scope of the present application.

Claims

1. sgRNA targeting LPA gene knockout, characterized in that: The nucleotide sequence of the sgRNA comprises any one selected from the sequence shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.9, SEQ ID No.11, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.14, and SEQ ID No.

15.

2. The sgRNA for targeted knockout of LPA gene according to claim 1, characterized in that: The nucleotide sequence of the sgRNA comprises the sequences shown in SEQ ID No.11, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.14, and SEQ ID No.

15.

3. A recombinant expression vector for targeted knockout of LPA gene, characterized in that: The recombinant expression vector contains the sgRNA according to claim 1 or 2.

4. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: A delivery vector and the sgRNA according to any one of claims 1-2 or the expression vector according to claim 3.

5. The pharmaceutical composition according to claim 4, characterized in that The delivery vehicle is selected from one or more of polymer liposomes, nanoparticles, viral vectors or extracellular vesicles.

6. Use of the sgRNA according to any one of claims 1-2, the expression vector according to claim 3, or the pharmaceutical composition according to any one of claims 4-5 in the preparation of one of the following products: 1) Products of LPA gene editing in vitro; 2) products that reduce apolipoprotein(a) and lipoprotein(a); 3) Drugs for the treatment of cardiovascular diseases.

7. The use according to claim 6, characterized in that The cardiovascular disease is selected from one or more of hypercholesterolemia, coronary heart disease, hypertension, myocardial infarction, stroke, peripheral vascular disease or aortic atherosclerosis.

8. A method for specifically knocking out the LPA gene in vitro, characterized in that: The steps include: The sgRNA according to claim 1 or 2 and the recombinant expression vector according to claim 3 are introduced into cells to perform gene editing on LPA to knock out the LPA gene in a targeted manner.

9. The method for specifically knocking out the LPA gene in vitro according to claim 8, characterized in that: The introduction method includes one or more of liposome transfection, virus transduction, electroporation, microinjection, particle bombardment or gene gun transformation.

10. The method for specifically knocking out the LPA gene in vitro according to claim 8, characterized in that: The cells include HEK293T cells or HepG2 cells.

Images