Medicago truncatula plant type development control protein as well as encoded gene and application thereof

Abstract

The invention discloses medicago truncatula plant type development control protein as well as a gene coded by the medicago truncatula plant type development control protein and application. The method comprises the following steps: firstly, finding a Tnt1 insertion mutant mini-1 with a changed plant type from a medicago truncatula Tnt1 insertion mutant library, cloning a control gene MINI for plant type development by combining whole genome re-sequencing with flanking sequence analysis, and then inversely screening a natural mutant mini-2 of the MINI gene in the mutant library in order to prove that the MINI is the control gene for plant type development. Meanwhile, a MINI gene knockout strain mini-3 is also constructed, and analysis finds that phenotypes of mini-2 and mini-3 are completely the same as those of a mini-1 mutant. The results prove that the MINI gene provided by the invention can regulate and control the plant type. The method lays a foundation for plant type development research of leguminous plants such as alfalfa and other dicotyledonous plants.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Medicago truncatula plant type development control protein and a gene encoding the protein and application thereof. Background Art

[0002] Plant type is a comprehensive agronomic trait and an important trait that affects plant population structure and yield formation. Research on forage plant type mainly focuses on leaf morphology, plant height, number of branches, branch angle, etc. Plant type works together at both the individual and group levels. Under a specific natural environment, the individual development of plants interacts with the group structure to obtain a reasonable individual plant type and group structure, which can not only increase biological yield, but also improve light and ventilation conditions, reduce the occurrence of pathogens and pests, and reduce the use of pesticides. Plant type determines the yield potential, harvest index, disease resistance and adaptability of plants to the growth environment.

[0003] Leaves are important nutritional organs of plants and the main site for photosynthesis. They can convert solar energy and inorganic matter into organic matter for their own growth and development through a series of photosynthetic processes. Leaf development is an important issue in developmental biology. The size and shape of leaves are very important in forage production, mainly reflected in the following aspects: (1) Leaves are the main site for photosynthesis and are closely related to forage yield. (2) The amount of leaves directly determines the nutritional value and quality of forage. (3) Appropriate leaf shape helps to improve photosynthetic efficiency and increase yield, and is also closely related to the response to adverse stress. Given the important value of leaf development in improving forage yield and quality, the molecular mechanisms that affect leaf development have always attracted much attention.

[0004] Leguminosae plants are widely distributed throughout the world and are one of the important sources of protein and oil in human food. In addition, some leguminous species are excellent forage and provide a large amount of protein for livestock. Therefore, it is of great significance to carry out research on the gene function of leguminous species. Medicago truncatula belongs to the genus Alfalfa of the Leguminosae family. It has the advantages of small ploidy (2n=16), small genome, self-pollination, and high genetic transformation efficiency. It is very suitable for genetic mechanism research. Moreover, because Medicago truncatula has good colinearity with plants such as alfalfa and soybean, most of the research results can be directly applied. In recent years, with the completion of the Medicago truncatula genome sequencing and the establishment of a variety of artificial mutant libraries, Medicago truncatula has become an ideal model material for studying leguminous plants.

[0005] At present, some genes related to plant type development of Medicago truncatula have been cloned through forward and reverse genetics research methods, but most of them are studies on single traits and have not formed a complete regulatory network. Therefore, it is necessary to provide a plant type development control gene and its encoded protein. Summary of the invention

[0006] The purpose of the present invention is to provide a protein related to plant type and application thereof.

[0007] In the first aspect, the present invention protects a protein related to plant type, the name of the protein is MINI, and the MINI protein is any one of the following proteins (a1)-(a4):

[0008] (a1) the protein shown in Sequence 2 in the sequence listing;

[0009] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0010] (a3) a protein associated with plant architecture obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1);

[0011] (a4) A protein derived from alfalfa, having 98% or more identity with (a1) and associated with plant architecture.

[0012] In the protein described in (a2) above, the tag refers to a polypeptide or protein that is fused and expressed together with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0013] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0014] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and performing a search, the identity of the amino acid sequence can be calculated, and then the identity value (%) can be obtained.

[0015] Any of the proteins described in (a1)-(a4) above can be synthesized artificially, or the encoding gene can be synthesized first and then expressed biologically.

[0016] In a second aspect, the present invention protects a nucleic acid molecule encoding a MINI protein.

[0017] The nucleic acid molecule is a DNA molecule as described in (b1) or (b2):

[0018] (b1) the DNA molecule shown in Sequence 1 in the sequence listing;

[0019] (b2) A DNA molecule derived from alfalfa and having a homology of more than 75% with (b1) and encoding the MINI protein.

[0020] A person skilled in the art can easily mutate the nucleotide sequence encoding the MINI protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the MINI nucleotide sequence isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the MINI protein and have the same function.

[0021] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0022] In a third aspect, the present invention protects an expression cassette, a recombinant vector or a recombinant microorganism containing the above-mentioned nucleic acid molecule.

[0023] The expression cassette refers to a DNA capable of expressing MINI protein in a host cell, and the DNA may include not only a promoter for initiating MINI transcription, but also a terminator for terminating MINI transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0024] The vector may be a plasmid, cosmid, phage or viral vector. The recombinant vector may be a vector containing a DNA molecule encoding the MINI protein shown in Sequence 1. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used may be processed, such as adding genes (GUS gene, luciferase gene, etc.) that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes, antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc.

[0025] The recombinant microorganism may be yeast, bacteria, algae and fungi containing the above nucleic acid molecule or the above expression cassette or the above recombinant vector.

[0026] In a fourth aspect, the present invention protects new uses of the above-mentioned MINI protein or the above-mentioned nucleic acid molecule or the above-mentioned expression cassette, recombinant vector or recombinant microorganism.

[0027] The present invention protects the use of the above MINI protein or the above nucleic acid molecule or the above expression cassette, recombinant vector or recombinant microorganism in any of the following c1) to c6):

[0028] c1) regulating plant morphology;

[0029] c2) regulating plant height;

[0030] c3) regulating plant leaf size;

[0031] c4) regulating the number of plant branches;

[0032] c5) Cultivating transgenic plants with altered plant types;

[0033] c6) Cultivating transgenic plants with increased plant height and / or larger leaves and / or reduced branch number.

[0034] In a fifth aspect, the present invention protects new uses of substances that inhibit the above-mentioned MINI protein.

[0035] The present invention protects the use of the substance that inhibits the above-mentioned MINI protein in any of the following d1)-d6):

[0036] d1) regulating plant type;

[0037] d2) reducing plant height;

[0038] d3) Make plant leaves smaller;

[0039] d4) Increase the number of plant branches;

[0040] d5) cultivating transgenic plants with altered plant types;

[0041] d6) cultivating transgenic plants with reduced plant height and / or smaller leaves and / or increased number of branches;

[0042] The substance that inhibits the above MINI protein may be a substance that inhibits or reduces the activity and / or content of MINI protein in plants.

[0043] Furthermore, the substance that inhibits or reduces the activity and / or content of MINI protein in plants may be a substance that inhibits the activity of the above MINI protein, or a substance that inhibits the expression of a gene encoding the above MINI protein, or a substance that knocks out a gene encoding the above MINI protein.

[0044] The substance inhibiting the activity of the MINI protein can be any substance that can cause the loss of the activity of the MINI protein in plants, such as proteins, polypeptides or small molecule compounds (such as protein activity inhibitors) that inhibit the synthesis of the MINI protein, promote the degradation of the MINI protein or inhibit the function of the MINI protein.

[0045] The substance that inhibits the expression of the gene encoding the MINI protein can be any substance that can prevent the gene encoding the MINI protein in plants from being expressed, such as a substance that silences the gene encoding the MINI protein in plants (such as miRNA, siRNA, dsRNA, shRNA, etc.).

[0046] The substance for knocking out the gene encoding the MINI protein can be any substance that enables the host cell to not produce the functional protein product of the gene in any manner, such as removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing regulatory components (such as promoter editing) so that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Usually, the knockout is performed at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout.

[0047] Furthermore, the substance for knocking out the gene encoding the above-mentioned MINI protein may be any substance that can cause the gene encoding the above-mentioned MINI protein in the plant to mutate (the mutation may be a deletion mutation and / or an insertion mutation and / or a base substitution) and thereby lose its activity, such as a zinc finger protein ZFN gene editing system or a TALENs gene editing system or a CRISPR / Cas9 gene editing system or a biological mutagenesis system, etc.

[0048] Furthermore, the biological mutagenesis system may be a substance for T-DNA insertion, a substance for transposon insertion, or a substance for retromer insertion.

[0049] The CRISPR / Cas9 gene editing system includes sgRNA and Cas9 nuclease.

[0050] In a specific embodiment of the present invention, the substance for retrotranscript insertion is a substance for Tnt1 retrotranscript insertion.

[0051] In another specific embodiment of the present invention, the target sequence of the sgRNA is TTCACCGCCATAAGAAGATG, ATGGCGGATATCACCGATGA and CGACCTCGAGGTTCTGACGA.

[0052] In a sixth aspect, the present invention protects a method for cultivating transgenic plants with altered plant shape and / or reduced plant height and / or smaller leaves and / or increased number of branches.

[0053] The method for cultivating transgenic plants with changed plant shape and / or reduced plant height and / or smaller leaves and / or increased number of branches protected by the present invention comprises the steps of reducing the content and / or activity of MINI protein in a recipient plant to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant.

[0054] Furthermore, the method for reducing the content and / or activity of MINI protein in a recipient plant comprises introducing the substance for reducing the content and / or activity of MINI protein into the recipient plant.

[0055] Furthermore, the substance that reduces the content and / or activity of MINI protein is a substance used for Tnt1 retrotransposon insertion or a CRISPR / Cas9 gene editing system.

[0056] In a specific embodiment of the present invention, the transgenic plant is a mini-1 homozygous mutant.

[0057] The difference between the mini-1 homozygous mutant and the wild type Medicago truncatula R108 is that the Tnt1 sequence is inserted between the 5th and 6th positions of the MINI gene sequence (sequence 1); the Tnt1 sequence is shown as sequence 3 in the sequence listing.

[0058] In another specific embodiment of the present invention, the transgenic plant is the MINI gene knockout strain mini-3.

[0059] The only difference between the MINI gene knockout strain mini-3 and the wild-type Medicago truncatula R108 is that a 5 bp base deletion occurs at positions 32-36 of the MINI gene sequence (sequence 1).

[0060] In a seventh aspect, the present invention provides a method for preparing a transgenic plant.

[0061] The method for preparing the transgenic plant provided by the present invention can be any one of the following e1) or e2):

[0062] e1) inserting the DNA molecule shown in sequence 3 between the 5th and 6th positions in the MINI gene (sequence 1) of the recipient plant to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant;

[0063] e2) replacing "CCTCATCTTCTTATGGCGG" in the MINI gene (sequence 1) of the recipient plant with "CCTCATTATGGCGG" to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant.

[0064] Any of the above substitutions is a homozygous substitution, that is, the same substitution occurs in the homologous chromosome.

[0065] The leaf area of ​​any of the transgenic plants is smaller than that of the recipient plant, which is reflected in that the leaf area of ​​the transgenic plant is smaller than that of the recipient plant. The leaf area refers to the leaf area of ​​the leaflet at the top of the compound leaf.

[0066] Any of the above-mentioned branch numbers includes the primary branch number and / or the secondary branch number.

[0067] In any of the above uses or methods, the plant is any one of the following d1)-d5):

[0068] d1) monocots;

[0069] d2) dicotyledons;

[0070] d3) Leguminosae;

[0071] d4) Alfalfa;

[0072] d5) Medicago truncatula.

[0073] The present invention first finds a Tnt1 insertion mutant mini-1 with a changed plant type from a Tnt1 insertion mutant library of Medicago truncatula, clones the control gene MINI of the plant type development through whole genome resequencing combined with gene-phenotype linkage analysis, and then screens a natural mutant mini-2 of the MINI gene in the mutant library to prove that MINI is a control gene of plant type development, and also constructs a MINI gene knockout strain mini-3. After analysis, it is found that the phenotypes of mini-2 and mini-3 are exactly the same as those of the mini-1 mutant. The above results prove that the MINI gene in the present invention can regulate plant type.

[0074] Compared with the prior art, the present invention can achieve the following technical effects:

[0075] 1) The present invention cloned a MINI gene for the first time in Medicago truncatula that controls the plant type development of Medicago truncatula. After the gene mutates, the plant height is reduced, the leaves become smaller, and the number of branches increases.

[0076] 2) The MINI gene cloned in the present invention can provide evidence for the study of plant type development of leguminous plants such as alfalfa and other dicotyledonous plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 The phenotypes of wild-type Medicago truncatula R108 and mini mutants. Figure A and Figure B are phenotypes of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant plants, respectively. Figure C and Figure D are phenotypes of eight-week-old wild-type Medicago truncatula R108 and mini-1 mutant plants, respectively. Figure E and Figure F are the top parts of wild-type Medicago truncatula R108 and mini-1 mutant plants, respectively. Figure G is a comparison of eight-week-old wild-type Medicago truncatula R108 and mini-1 mutant plants. Figure H is a phenotype of four-week-old mini-3 mutant plants. Figure I is a phenotype of four-week-old mini-2 mutant plants. Figure J is a pattern diagram of eight-week-old wild-type Medicago truncatula R108 and mini-1 mutant plants. Bar=1cm.

[0078] Figure 2Figure 1 is the structure diagram of the MINI gene and the expression level of the MINI gene in the mutant. Figure A is the structure diagram of the MINI gene and the insertion position of the Tnt1 retrotransposon in the mini-1 mutant. Figure B is the DNA level identification result, in which a fragment of 1143bp in length was amplified in the wild-type Medicago truncatula R108 using the MINI gene primer, and a fragment of 952bp in length was amplified in mini-1 using the Tnt1 specific primer LTR6 and the MINI gene R-end primer. Figure C is the RT-PCR detection of the expression level of the MINI full-length gene in the wild-type Medicago truncatula R108 and the mini-1 mutant. Compared with the wild-type Medicago truncatula R108, the MINI gene in the mini-1 mutant is not expressed. Figure D is the base mutation of the MINI gene knockout strain mini-3.

[0079] Figure 3 Figure 1 shows the statistical results of plant height, leaf area and branch number of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant. Figure A shows the statistical results of plant height of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant. Figure B shows the statistical results of leaf area of ​​the top leaflets of the same part of the compound leaves of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant. Figure C and Figure D show the statistical results of the primary branch number and secondary branch number of four-week-old wild-type Medicago truncatula R108 and mini-1 mutant, respectively. DETAILED DESCRIPTION

[0080] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0081] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0082] The wild type Medicago truncatula R108 in the following examples is described in the document “WOX family transcriptional regulators modulate cytokinin homeostasis during leaf blade development in Medicago truncatula and Nicotiana sylvestris”.

[0083] The pGREB31 vector in the following examples is described in the document “Multiplex CRISPR / Cas9-mediated mutagenesis of alfalfa FLOWERING LOCUS Ta1 (MsFTa1) leads to delayed flowering time with improved forage biomass yield and quality”.

[0084] Example 1. Obtaining MINI protein and its encoding gene

[0085] 1. RNA Extraction

[0086] The RNA of wild-type Medicago truncatula R108 was extracted by the following steps:

[0087] 1. Take about 0.1g of plant material and quickly put it into liquid nitrogen. After grinding the sample into powder with liquid nitrogen, immediately add 1mL Trizol and shake to mix. If there are a lot of samples, put them on ice first and wait for subsequent samples.

[0088] 2. Add 200 μL of chloroform, shake well, let stand at room temperature for 2 min, and centrifuge at 4°C and 12,000 × g for 10 min.

[0089] 3. Pipette the supernatant into a new 1.5 mL centrifuge tube, add 500 μL of isopropanol, mix by inversion, let stand at room temperature for 5 min, and centrifuge at 4°C and 12,000 × g for 15 min.

[0090] 4. Discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 7500 × g for 5 min at 4°C, and repeat this process.

[0091] 5. Leave it in the air for 2 minutes, use the gun tip to absorb all the ethanol, dry it at room temperature for 10 minutes or blow dry the ethanol on a clean bench.

[0092] 6. Add 30-50 μL DEPC H2O to dissolve. If the precipitate is large, oscillate to aid dissolution.

[0093] 7. After the precipitate is completely dissolved, take 1 μL and use NANO DROP 2000 to detect the concentration and purity of RNA. The remaining RNA is stored at -80°C.

[0094] 2. Reverse Transcription

[0095] The RNA extracted in step 1 was used as a template and reverse transcribed into cDNA using a kit from TRANS. The specific steps are as follows:

[0096] Add 5000ng RNA and 1μL Primer Oligo(dTs) to a 200μL centrifuge tube, add DEPC H2O to 8μL, mix well, and react in a PCR instrument. The reaction conditions are as follows: denaturation at 65℃ for 5min, ice bath for 2min. After the reaction is completed, add the following components in sequence: 2×Ts Uni Reaction Mix 10μL, RI Enzyme Mix 1μL, GDNA Remover 1μL, mix well, incubate at 50℃ for 30min, react at 85℃ for 5s, and store at -20℃ for later use.

[0097] 3. PCR Amplification

[0098] Using the cDNA obtained in step 2 as a template, a primer pair consisting of primer MINI-5'UTR-F and primer MINI-3'UTR-R was used for amplification to obtain a PCR amplification product. The primer sequences are as follows:

[0099] MINI-5UTR-F: 5'-TTCGTACCGTAATCTCAACC-3';

[0100] MINI-3UTR-R: 5'-CACAGGTCAAATGTCCAAAG-3'.

[0101] IV. PCR amplification product detection

[0102] The PCR amplification product obtained in step 3 is connected to the T vector and sequenced to obtain the coding region sequence (CDS sequence) of the MINI gene. The sequence is shown in sequence 1 in the sequence table, and the coding sequence is the MINI protein shown in sequence 2 in the sequence table. The MINI protein consists of 666 amino acid residues.

[0103] Example 2. Acquisition of mini mutants and phenotypic analysis

[0104] The present invention found a Tnt1 insertion mutant mini-1 with a changed plant type from the Medicago truncatula Tnt1 insertion mutant library (medicago-mutant.dasnr.okstate.edu), and cloned the control gene MINI of the plant type development through whole genome resequencing combined with flanking sequence analysis. In order to prove that MINI is a control gene for plant type development, a natural mutant of the MINI gene, mini-2, was screened in the mutant library, and a MINI gene knockout strain mini-3 was also constructed. It was found that the phenotypes of mini-2 and mini-3 are exactly the same as those of the mini-1 mutant. The specific steps are as follows:

[0105] I. Obtaining mini-1 and mini-2 mutants

[0106] The invention obtains two mutants, mini-1 and mini-2, with changed plant types from a Tnt1 insertion mutant library of Medicago truncatula, and the mutants are numbered NF2946 and NF18721 respectively.

[0107] 1. Acquisition and analysis of mini-1 mutants

[0108] By screening the Tnt1 insertion mutant library of Medicago truncatula, a mutant with reduced plant height, smaller leaves and increased number of branches was obtained, and it was named mini-1 (numbered NF2946). To identify the functional gene causing this phenotype, the pollen of the mini-1 heterozygous mutant (+ / -) was first smeared on the stigma of the wild-type Medicago truncatula R108, and backcrossing was performed. After two consecutive backcrossing generations, the segregation ratio of the wild-type and mutant phenotypes of the offspring was statistically close to 3:1, and it was speculated that the mini-1 phenotype was caused by a single gene recessive mutation. Then, based on the flanking sequences published on the website of the Medicago truncatula mutant library, a linkage analysis of the gene and phenotype was performed (gene-typing), and no insertion site linked to the mini-1 phenotype was found.

[0109] The MINI heterozygote was backcrossed with the parent R108 for one generation, and the mini-1 homozygous mutant was isolated from the offspring. The mixed pool samples of the mutant were resequenced by ONT three generations, and the resequencing results were compared and analyzed with the wild-type R108, and the linkage between the phenotype and the genotype of the possible Tnt1 insertion site was verified. Gene primers F and R were designed at the position across the Tnt1 insertion site, and the mutant and other wild-type-like DNA were used as templates. Gene primers F / R and gene primers F or R were used with Tnt1 upper primer LTR for amplification, and the results determined which gene insertion was linked to the mutant, and finally locked to the MINI gene (Medtr4g102120) linked to the mutant phenotype.

[0110] Compared with the wild type Medicago truncatula R108, the mutant was used as a template and the MINI gene specific primer combined with the Tnt1 specific primer could amplify a specific band ( Figure 2 B), and sequencing comparison confirmed that it was caused by Tnt1 insertion. The CDS sequence of the MINI gene is shown in sequence 1 in the sequence list. Analysis shows that Tnt1 in the mini-1 mutant is inserted in the first exon of the MINI gene ( Figure 2A). The difference between the mini-1 homozygous mutant and the wild-type Medicago truncatula R108 is that the Tnt1 sequence is inserted between the 5th and 6th positions of the MINI gene (sequence 1). The Tnt1 sequence is shown as sequence 3 in the sequence list. RT-PCR was used to detect the expression of the mini full-length gene in the wild-type Medicago truncatula R108 and the mini-1 mutant. The results showed that compared with the wild-type Medicago truncatula R108, the MINI gene in the mini-1 mutant was not expressed ( Figure 2 C).

[0111] 2. Acquisition and analysis of mini-2 mutants

[0112] The MINI genomic DNA was further used to reverse screen other insertion strains in the Medicago truncatula Tnt1 mutant library. The MINI genomic sequence was searched on the mutant library website (medicago-mutant.dasnr.okstate.edu), and NF18721 was ordered based on the search results and alignment results. It was found that mutants with the same phenotype as mini-1 could also be isolated from this strain, and it was named mini-2 ( Figure 1 I) Sequencing revealed that the phenotypic change of the strain was not caused by Tnt1 insertion, but by an error in the transcription of MINI, resulting in the lack of 42 bp of bases in the eighth and ninth exons of the translated RNA.

[0113] The only difference between the mini-2 homozygous mutant and the wild-type Medicago truncatula R108 is that a 42 bp base deletion occurs at positions 566-607 of the MINI gene (SEQ ID 1), which results in the inability to translate the MINI protein.

[0114] 2. Obtaining mini-3 mutants

[0115] In order to prove that the MINI gene is the controlling gene of the mutant, the MINI gene knockout strain mini-3 was constructed. The specific steps are as follows:

[0116] 1. According to the sequence of the MINI gene, the gRNA target sequence was designed. Finally, three gRNA target sequences were selected. The specific target sequences are as follows:

[0117] gRNA-1 target sequence: TTCACCGCCATAAGAAGATG;

[0118] gRNA-2 target sequence: ATGGCGGATATCACCGATGA;

[0119] gRNA-3 target sequence: CGACCTCGAGGTTCTGACGA.

[0120] 2. Entrust Qingke Biotechnology Co., Ltd. to synthesize the DNA molecule shown in sequence 4 (containing the coding gene sequence of three gRNAs) and connect it to -Blunt Zero vector (TransGen Biotech, catalog number CB501-01) to obtain a vector containing the target sequence -Blunt Zero vector; then primers M13F and M13R were used to clone the target sequence -Blunt Zero vector was used for PCR amplification to obtain PCR amplification products. The primer sequences are as follows:

[0121] M13F: 5'-TGTAAAACGACGCGCCAGT-3';

[0122] M13R: 5'-CAGGAAACAGCTATGACC-3'.

[0123] 3. Use restriction endonuclease BsaⅠ to digest the PCR amplification product and CRISPR vector pGREB31 respectively, and then use SolutionⅠ to connect to obtain vector pGREB31-MINI.

[0124] 4. The vector pGREB31-MINI was transferred into the leaves of wild-type Medicago truncatula R108 by Agrobacterium transformation, and transgenic plants were obtained by tissue culture. Then, the MINI gene knockout strain was obtained by molecular identification and sequencing, which was recorded as mini-3.

[0125] The specific method of the above-mentioned Agrobacterium transformation is as follows:

[0126] 1) Preparation of Agrobacterium infection solution

[0127] The Agrobacterium strain used for transformation in this experiment is AGL1. The strain stored at -80℃ was activated two days in advance, and the strain activated overnight was shaken on the second day until saturated. The next day, the strain was transferred 4 hours in advance at a ratio of 1:100, and the OD was measured. 600 Between 0.6-1.2, the blades are ready for processing.

[0128] 2) Leaf treatment

[0129] Select healthy leaves that have grown in the greenhouse for 4 to 6 weeks, dilute the sodium hypochlorite solution with an effective chlorine content of 3%-5% to 3% of the original solution, and then disinfect the leaves. Treat for 7-12 minutes depending on the condition of the leaves.

[0130] Use a sharp blade to cut 5-6 horizontal lines / leaf of the disinfected leaves. Place the cut leaves into SH3a liquid culture medium. Collect the bacteria at this time, centrifuge at 6000rpm at room temperature for 15 minutes, discard the supernatant, and resuspend the bacteria in the prepared SH3a liquid culture medium. Add 0.1mM AS to the SH3a liquid culture medium. This bacterial liquid is the infection liquid.

[0131] 3) Infection

[0132] Mix the leaves with the infection solution to ensure that the leaves are completely submerged in the infection solution and infect for 20 minutes. Depending on the state of the leaves, ultrasonic treatment can be performed before infection.

[0133] 4) Co-culture

[0134] Pour off the bacterial solution, absorb the excess bacterial solution on the leaves with sterile filter paper, place the adaxial surface of the leaves against the co-cultivation medium, and incubate at 25°C in the dark for 2 days.

[0135] 5) Subculture

[0136] After co-cultivation, the leaves were transferred to SH3a medium containing antibiotics. The original leaves were transferred to new medium every 2-3 weeks, and yellow callus would grow on the original leaves.

[0137] 6) Differentiation and emergence

[0138] After new callus grows, callus tissue is transferred to SH9 medium, exposed to light, and moved to new medium every 2-3 weeks until the aerial part of seedlings is differentiated. Then, callus tissue is transferred to 1 / 2MS medium for rooting culture.

[0139] 7) Transplanting

[0140] Remove the healthy seedlings from the culture medium and transplant them into vermiculite, paying attention to moisture retention. After the seedlings' root systems are fully developed, they can be transplanted into the soil and cultured normally.

[0141] The sequencing results showed that the only difference between the MINI gene knockout strain mini-3 and the wild type Medicago truncatula R108 was a 5 bp deletion at positions 32-36 of the MINI gene (sequence 1). Figure 2 D).

[0142] 3. Phenotypic Analysis

[0143] Phenotypic observations were conducted on the wild-type Medicago truncatula R108, mini mutants (mini-1, mini-2), and MINI gene knockout strain mini-3 grown for four and eight weeks, respectively, and the plant height, leaf area, number of primary branches, and number of secondary branches were counted.

[0144] The results are as follows Figure 1As shown. Among them, Figure A and Figure B are the phenotypes of wild-type Medicago truncatula R108 and mini-1 mutant plants at the fourth week of growth, respectively; Figure C and Figure D are the phenotypes of wild-type Medicago truncatula R108 and mini-1 mutant plants at the eighth week of growth, respectively; Figure E and Figure F are the top parts of wild-type Medicago truncatula R108 and mini-1 mutant plants, respectively, and it can be observed that the leaves of the mini mutant are significantly smaller; Figure G is a comparison of wild-type Medicago truncatula R108 and mini-1 mutant plants at the eighth week of growth; Figure H is a phenotype of mini-3 mutant plants; Figure I is a phenotype of mini-2 mutant plants at the fourth week of growth; Figure J is a pattern diagram of wild-type Medicago truncatula R108 and mini-1 mutant plants at the eighth week of growth, and it can be seen that the number of branches of the mini-1 mutant is significantly increased compared with that of the wild-type Medicago truncatula R108.

[0145] The measurement results of plant height, leaf area, primary branch number and secondary branch number are shown in Tables 1 to 4, respectively. The statistical results are shown in Figure 3 The results showed that compared with the wild-type Medicago truncatula R108, the plant height and leaf area of ​​the mini-1 mutant plants were significantly reduced, and the number of primary and secondary branches was significantly increased.

[0146] Table 1. Plant height (cm) of wild-type R108 and mini-1 mutant

[0147] R108 8.1 5.5 7.7 8.1 7.8 7.3 7.1 7.8 9 8 8.4 mini-1 0.8 1.1 1 1.2 1.5 1.0 2.1 1.5 2.0

[0148] Table 2. Leaf area of ​​wild type R108 and mini-1 mutant (cm 2 )

[0149] R108 1.074 1.572 1.572 0.889 0.916 1.542 1.55 1.125 1.125 2.022 1.359 mini-1 0.028 0.005 0.021 0.057 0.007 0.016 0.077 0.033 0.046 0.02 0.034

[0150] Table 3. Number of primary branches of wild-type R108 and mini-1 mutant

[0151] R108 4 3 4 4 4 4 3 4 4 4 2 mini-1 6 7 6 6 7 6 8 5 9

[0152] Table 4. Number of secondary branches of wild-type R108 and mini-1 mutant

[0153] R108 0 0 0 0 0 0 0 0 0 0 mini-1 16 14 15 16 15 14 10 16

[0154] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, which is the protein described in any one of the following a1)-a4): a1) the protein shown in sequence 2 in the sequence listing; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in a1); a3) a protein associated with plant architecture obtained by replacing and / or deleting and / or adding one or more amino acid residues in a1); a4) A protein derived from alfalfa that has more than 98% identity with a1) and is associated with plant architecture.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is a DNA molecule as described in b1) or b2) below: b1) the DNA molecule shown in Sequence 1 in the sequence listing; b2) a DNA molecule derived from alfalfa and having more than 75% identity with b1) and encoding the protein.

4. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2, or the expression cassette, recombinant vector or recombinant microorganism according to claim 3 in any one of the following c1) to c6): c1) regulating plant morphology; c2) regulating plant height; c3) regulating plant leaf size; c4) regulating the number of plant branches; c5) Cultivating transgenic plants with altered plant types; c6) Cultivating transgenic plants with increased plant height and / or larger leaves and / or reduced branch number.

6. Use of the substance for inhibiting the protein according to claim 1 in any one of the following d1) to d6): d1) regulating plant type; d2) reducing plant height; d3) Make plant leaves smaller; d4) Increase the number of plant branches; d5) cultivating transgenic plants with altered plant types; d6) cultivating transgenic plants with reduced plant height and / or smaller leaves and / or increased number of branches; The substance that inhibits the protein according to claim 1 is a substance that inhibits or reduces the activity and / or content of the protein according to claim 1 in plants.

7. A method for cultivating transgenic plants with changed plant shape and / or reduced plant height and / or smaller leaves and / or increased number of branches, comprising the steps of reducing the content and / or activity of the protein according to claim 1 in a recipient plant to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaves of the transgenic plant are smaller than that of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant.

8. The method according to claim 7, characterized in that: The method for reducing the content and / or activity of the protein of claim 1 in a recipient plant comprises introducing a substance that reduces the content and / or activity of the protein of claim 1 into the recipient plant; Or, the substance that reduces the content and / or activity of the protein according to claim 1 is a substance that inhibits the activity of the protein according to claim 1 or a substance that inhibits the expression of the gene encoding the protein according to claim 1 or a substance that knocks out the gene encoding the protein according to claim 1.

9. A method for preparing a transgenic plant, comprising any one of the following e1) or e2): e1) inserting the DNA molecule shown in sequence 3 between the 5th and 6th positions in the MINI gene of the recipient plant to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant; e2) replacing "CCTCATCTTCTTATGGCGG" in the MINI gene of the recipient plant with "CCTCATTATGGCGG" to obtain a transgenic plant; the plant height of the transgenic plant is lower than that of the recipient plant and / or the leaves of the transgenic plant are smaller than those of the recipient plant and / or the number of branches of the transgenic plant is more than that of the recipient plant.

10. The use according to claim 5 or 6 or the method according to any one of claims 7 to 9, characterized in that: The plant is any one of the following d1)-d5): d1) Monocotyledons; d2) dicotyledons; d3) Leguminosae; d4) Alfalfa; d5) Medicago truncatula.

Images