Bacillus subtilis and application thereof in corn disease control

Abstract

The invention belongs to the technical field of biological prevention and control of plant diseases, and provides bacillus subtilis and application thereof in prevention and control of corn diseases. The preservation number of the bacillus subtilis SEB-34 is CGMCC (China General Microbiological Culture Collection Center) No. 26419. The invention also provides a microbial agent produced by using the SEB-34 strain, and the microbial agent can be used for preventing and treating plant diseases caused by fusarium graminearum or pelamys maydis. The bacillus subtilis provided by the invention is applied through seed treatment before sowing or root drip irrigation after seedling emergence, has the effects of preventing diseases, promoting growth and increasing yield, and can effectively reduce the occurrence of corn southern leaf blight and basal stem rot. The microbial agent provided by the invention is in a semi-dormant state, has relatively strong stress resistance, is more stable to store, ensures the effect, and effectively reduces the production and transportation cost at the same time. The invention also provides beneficial microbial resources for green prevention and control of corn diseases, and has good application prospect and high application value.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control of plant diseases, and particularly relates to a Bacillus subtilis and an application thereof in controlling corn diseases. Background Art

[0002] The disclosure of this background information is intended to enhance understanding of the general background of the invention and should not necessarily be taken as an acknowledgment or any form of suggestion that this information constitutes the prior art already known to a person skilled in the art.

[0003] Corn production plays a vital role in my country's food security. The occurrence of corn diseases seriously affects the yield and quality of corn. Corn leaf blight is a fungal disease that occurs widely worldwide and can seriously affect corn yield and quality. It occurs in major corn producing areas in my country. It is common and harmful in the Huanghuaihai and East North China corn producing areas. Effective prevention and control of the occurrence of corn leaf blight is an important issue that needs to be addressed in corn production. In recent years, with the adjustment of planting structure, changes in tillage and cultivation methods, and the replacement of corn varieties, the occurrence of corn leaf blight has continued to increase. With the adjustment of planting structure and changes in tillage and cultivation methods, the occurrence of corn stem base rot has gradually increased in recent years. Corn stem base rot, also known as corn stem rot and corn bacterial wilt, is a typical soil-borne disease that harms the roots and stem base of corn. The disease occurs widely in corn producing areas around the world. After the corn plant becomes ill, the stem base and pith of the diseased plant rot, turn brown and soften, the leaves wither, and the ears droop. In severe cases, the whole plant may wilt and die. A variety of pathogens, either alone or in combination, can cause corn root and stem rot. Among them, fungal stem rot is the most harmful type, and the most common one is Fusarium ( Fusarium moniliforme ) and Pythium ( Pythium aphanidermatum ), of which Fusarium graminearum ( Fusarium graminearum ) is the dominant pathogen in Shandong, Henan, Shaanxi and northern regions.

[0004] At present, the prevention and control of corn diseases mainly adopt disease-resistant varieties and chemical control measures. For example, chemical agents can be used for seed treatment before sowing or spraying and root irrigation after emergence. However, chemical control has problems such as environmental pollution, easy to induce drug resistance, pesticide residues, and high costs. The prevention and control of crop diseases through beneficial microorganisms has attracted more and more attention from all parties. Rhizosphere antagonistic bacteria have strong adaptability to the soil environment. Using them as biological antagonists to prevent and control plant diseases has the advantages of strong target conversion, good prevention effect, long-lasting efficacy, and environmental friendliness. It is one of the main ways to prevent and control plant diseases in a green way. Due to the co-evolutionary characteristics of biodiversity and organisms, more different types of microorganisms need to be screened to deal with different types and continuous evolution of pathogenic microorganisms. At present, there is still a lack of biological preparations with strong targeting and good prevention effect on the market, which cannot meet the biological control needs in production. It is still necessary to develop microbial control products suitable for corn disease prevention and control. Summary of the invention

[0005] In view of the problem that the prior art lacks microbial agents for controlling corn diseases, the present invention provides a strain of Bacillus subtilis ( Bacillus subtilis ), which can effectively antagonize Helicoverpa spp. ( Bipolaris maydis (Nisikado et Miyake) Shoemaker) and Fusarium graminearum ( Fusarium graminearum ), used to prevent and control corn leaf blight and corn stem rot.

[0006] Another object of the present invention is to provide a biological preparation prepared by the above-mentioned Bacillus subtilis, which can effectively prevent and control corn leaf blight and corn stalk rot caused by Fusarium graminearum.

[0007] To achieve the above purpose, the present invention adopts the following technical solution.

[0008] A strain of Bacillus subtilis ( Bacillus subtilis )SEB-34, the deposit number is CGMCC No. 26419.

[0009] The present invention also provides a fermentation product produced by using the above-mentioned Bacillus subtilis SEB-34, wherein the fermentation product is SEB-34 cell-free fermentation liquid, a dried product or a concentrated liquid of SEB-34 cell-free fermentation liquid.

[0010] The present invention also provides a microbial agent, wherein the active ingredient of the microbial agent is at least one of the bacteria, spores and fermentation products of SEB-34.

[0011] The above-mentioned microbial agent is a liquid preparation or a solid preparation.

[0012] Preferably, the amount of Bacillus subtilis SEB-34 in the liquid preparation is not less than 1×10 8cfu / mL; the number of Bacillus subtilis SEB-34 in the solid preparation is not less than 1×10 9 cfu / g, preferably (5-10)×10 9 cfu / g.

[0013] The microbial preparation may also include other inert ingredients such as absorbents, stabilizers, surfactants, etc. for formulation.

[0014] A method for preparing the above-mentioned microbial agent comprises the following steps: culturing the seed liquid of Bacillus subtilis SEB-34 in a fermentation medium to obtain a fermentation liquid; obtaining a fermentation product after solid-liquid separation of the fermentation liquid; and selecting at least one of the SEB-34 bacterial body, spores and fermentation products to obtain a microbial agent.

[0015] The fermentation medium comprises the following components in percentage by weight: 1% bran, 1% corn flour, 0.5% sodium chloride, 0.1% potassium dihydrogen phosphate, 0.05% manganese sulfate, and the remainder is water.

[0016] Specifically, the above preparation method comprises the following steps: (1) Bacillus subtilis SEB-34 strain was activated on LB plate medium, and a single colony was picked and cultured on LB slant medium at 25°C-30°C to obtain an activated strain; (2) Inoculate the activated strain into LB liquid culture medium and culture with stirring at 35°C for 24 hours to obtain seed solution; (3) Inoculate the seed liquid into the fermentation medium at a volume ratio of 1:(25-50), and ferment and culture at 35°C and a shaking speed of 150 rpm to obtain a fermentation liquid; (4) After solid-liquid separation of the fermentation liquid, bacteria, spores and cell-free fermentation liquid can be obtained; (5) concentrating or drying the cell-free fermentation broth to obtain a dry product or concentrated solution of the SEB-34 cell-free fermentation broth; (6) Select at least one of the cells, spores and fermentation products of SEB-34 and mix them to obtain a microbial agent.

[0017] In the above step (1), the composition and content of the LB plate medium and the LB slant medium are: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder.

[0018] In the above step (2), the composition and content of the LB liquid culture medium are: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0019] During the preparation of the LB plate medium, LB slant medium and LB liquid medium, NaOH was used to adjust the pH value to 7.0 after the solute was dissolved, and other operations and sterilization were prepared according to conventional methods.

[0020] In the above step (3), the end point of the fermentation culture is when the mature spores in the fermentation broth account for 90% of the total number of spores and bacterial cells.

[0021] The present invention also provides an application of the Bacillus subtilis, fermentation product and microbial agent in preventing and controlling plant diseases and promoting plant growth.

[0022] The plant disease is caused by Fusarium graminearum ( Fusarium graminearum ) or Helminthosporium maydis ( Bipolaris maydis (Nisikado et Miyake) Shoemaker). Preferably, the plant is corn.

[0023] The present invention has the following advantages: The Bacillus subtilis CGMCC No.26419 provided by the present invention can be colonized and maintain a high abundance through seed treatment before corn sowing or root drip irrigation after corn emergence, has disease prevention, growth promotion and yield increase effects, can effectively reduce the occurrence of corn leaf spot and corn stem base rot, has good prevention effect on corn leaf spot and corn stem base rot, and can effectively reduce the use of chemical fungicides. The microbial agent can directly contact corn seeds or be applied around the corn rhizosphere, without any adverse effect on plant growth and development. In the microbial agent prepared by the fermentation liquid of the strain, the thalli is in a semi-dormant state, and the spores have strong stress resistance, more stable storage, and while ensuring the effect, it also effectively reduces the production and transportation costs. The present invention also provides beneficial microbial resources for the green prevention and control of corn diseases, with good application prospects and high application value.

[0024] Biological deposit information Bacillus subtilis ( Bacillus subtilis ) SEB-34, deposited on January 6, 2023 in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, with the deposit number: CGMCC No. 26419. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a strain quantity distribution diagram that is effective for identifying pathogenic bacteria; Figure 2 is the antagonistic effect of SEB-34 against three identified pathogenic bacteria, among which A is Fusarium graminearum, B is Verticillium dahliae, and C is Helicoverpa serrata; Figure 3 This is the colony morphology of SEB-34 on LB plate; Figure 4 is the phylogenetic tree of SEB-34 constructed based on 16s rRNA sequence; Figure 5 SEB-34 is based on ikB Phylogenetic tree constructed from sequences; Figure 6 This is the potted control effect of SEB-34 microbial agent on corn stem rot, where a is the control and b is the treatment with SEB-34 microbial agent; Figure 7 The effect of SEB-34 microbial agent on corn growth, where A is the effect on seedling emergence and B is the effect on fresh weight; Figure 8 The field control effect of SEB-34 microbial agent on corn stem rot in three fields over two years; Fig. 9 The effect of SEB-34 microbial agent on corn stem rot control on yield in two years and three fields; Fig.10 The field control effect of SEB-34 microbial agent on corn leaf blight in two years and three fields; Fig.11 The effect of SEB-34 microbial agent on corn leaf blight control on yield in two years and three places. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0027] Example 1 Isolation and identification of target strains 1. Isolation and screening of target bacteria In August 2022, healthy soybean stalks were collected in Linqing City, Shandong Province, and Bacillus strains were isolated and preserved ( Bacillus sp. ) 233 strains.

[0028] The specific separation and purification process is as follows: wash the surface soil of the collected samples with clean water, peel them, disinfect them with 75% alcohol for 60 s, disinfect them with 1.05% sodium hypochlorite for 10 min, and wash them with sterile water three times. To detect whether the surface sterilization is thorough, take the final rinse liquid of each sample in 10 mL LB medium, and culture at 37°C for 3 days without microbial growth. The surface disinfection is considered to be thorough. Cut the sample into pieces with sterile scissors, add 10 mL sterile water to grind it thoroughly, let it stand for 10 min, then absorb 1 mL of supernatant, and then dilute it 10 times four times, and take 100 μL of the dilution to spread on the LB plate. Culture it in the dark at 37°C for 2 days, pick out the different bacterial colonies that have grown and transfer them to a new LB plate for streaking and purification in time.

[0029] The purified strains were selected from the maize stalk rot pathogen Fusarium graminearum ( Fusarium moniliforme ), Verticillium dahliae, the pathogen of Verticillium wilt Verticillium dahliae ) and Helicoverpa spp., the pathogen of corn leaf blight ( Bipolaris maydis The plate confrontation method was used to screen the target strains of Nisikado et Miyake Shoemaker. It was found that many strains had antibacterial effects on a single target pathogen (Table 1). Five strains had antibacterial effects on three pathogens at the same time, and the inhibition rate was higher than 50% ( Figure 1 ), respectively SEB-34, SEB-45, SEB-69, SEB-147, SEB-195. The inhibition rates of the five strains on different selected pathogens are shown in Table 2. Among them, SEB-34 has the best comprehensive inhibition effect ( Figure 2 ).

[0030] Table 1 Statistical table of the antibacterial activity of the screened strains against a single identified pathogen Table 2 Statistical table of inhibition rate of screened strains against three identified pathogens Depend on Figure 1 As can be seen from the data in Table 1-2, not all Bacillus strains have antagonistic effects on the three pathogens.

[0031] 2. Identification of target strains SEB-34 colonies on LB plates are milky white, opaque, irregular, and have uneven edges ( Figure 3 ).

[0032] The DNA of cultured SEB-34 was extracted by CTAB method. The DNA was used as a template to amplify the 16S rDNA gene of the strain with universal primers F27: GGTTACCTTGTTACGACTT and R1492: AGAGTTTGATCCTGGCTCAG. The PCR product was then sequenced to obtain a gene sequence fragment with a length of 1499 bp, as shown in SEQ ID NO: 1. Finally, the sequencing data was subjected to BLAST on NCBI, and the phylogenetic tree was constructed using MEFA7.0 software ( Figure 4 ), analysis showed that SEB-34 and Bacillus subtilis (Accession number: AB325584) are in the same branch and have the closest relationship.

[0033] The gyrB gene was further used to further identify SEB-34. The gyrB gene of the strain was amplified by PCR using gyrB-F: GGATAACGCGATTGACGAAG; gyrB-R: GCCGTGARCAAARTCRAA as upstream and downstream primers, and then sequenced to obtain a gene sequence fragment with a length of 671 bp, the sequence of which is shown in SEQ ID NO: 2. Finally, the sequencing data was subjected to BLAST on NCBI, and the phylogenetic tree was constructed using MEFA7.0 software ( Figure 5 ), analysis showed that SEB-34 and Bacillus subtilis (Accession number: EU711067) are in the same branch and have the closest relationship.

[0034] Through morphological observation and 16S rDNA and gyrB gene sequence analysis, strain D-34 was finally identified as Bacillus subtilis ( Bacillus subtilis ); deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on January 6, 2023, with the deposit number: CGMCC No. 26419.

[0035] Example 2 Preparation of Bacillus subtilis SEB-34 microbial agent Prepare LB solid medium according to the following formula and method: Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, water 1000 mL, fully dissolve the above ingredients in water, then use 5 mol / L NaOH to adjust the pH value to 7.0, add agar powder 15 g, and sterilize by high-pressure steam.

[0036] Prepare LB liquid medium according to the following formula and method: Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, water 1000 mL, fully dissolve the above ingredients in water, then use 5 mol / L NaOH to adjust the pH value to 7.0, and sterilize by high-pressure steam after packaging.

[0037] Prepare the fermentation medium according to the following formula and method: Bran 1%, corn flour 1%, sodium chloride 0.5%, potassium dihydrogen phosphate 0.1%, manganese sulfate 0.05%, the rest is water; Mix bran, corn flour, sodium chloride, potassium dihydrogen phosphate and manganese sulfate, add water and stir evenly, adjust the pH value to 7.0 with 5 mol / L NaOH, and sterilize by high-pressure steam.

[0038] (1) Activate the cryopreserved SEB-34 strain on LB plate medium, pick a single colony on LB slant medium, and culture it at 30°C for 24 h to obtain the activated strain; (2) Use a sterile inoculation loop to scrape the activated strain and inoculate it into 100 mL of LB liquid culture medium. Incubate at 35°C and 150 rpm for 24 h to obtain seed solution. (3) The seed liquid was inoculated into the fermentation medium at a volume ratio of 1:50, and the fermentation was carried out at 35°C and a shaking speed of 150 rpm. The number of spores in the fermentation liquid was detected. When the mature spores in the fermentation liquid accounted for 90% of the total number of spores and bacteria, the fermentation was stopped to obtain the fermentation liquid; the fermentation liquid can be directly used as a liquid preparation, and the number of SEB-34 in the preparation is 10 9 cfu / mL.

[0039] The fermentation liquid is filtered and sterilized to obtain a sterile fermentation liquid, thereby obtaining a liquid microbial agent preparation 1; The obtained filter residue contains spores and bacteria, which are counted and adsorbed by peat and vermiculite, and then dried at low temperature to obtain a solid preparation. The number of SEB-34 in the preparation is 10 8 cfu / g; In order to maintain the activity of SEB-34, the spores and bacteria in the filter residue were counted, adsorbed by peat and vermiculite, and then mixed with the sterile fermentation liquid again to obtain liquid microbial agent preparation 2.

[0040] Example 3 Antibacterial effect of Bacillus subtilis SEB-34 fermentation broth The Oxford cup method was used to determine the control effect of SEB-34 fermentation liquid on the pathogenic bacteria Fusarium graminearum and Helicoverpa spp., which are the pathogenic bacteria of corn stalk rot. The specific steps are as follows: Pick a bacterial block from the edge of the activated pathogenic bacteria colony, inoculate it into a triangular flask containing 200 mL of PDB, and culture it on a shaker at 25°C and 150 rpm for 7 days. Then filter the hyphae with sterile gauze to obtain a spore suspension, and adjust the spore suspension to 1×10 7 cfu / mL for future use.

[0041] The fermentation broth of Bacillus subtilis SEB-34 was prepared according to the method in Example 2 to obtain a liquid microbial agent, and sterile water was added to adjust the spore concentration to 10 6 cfu / mL, 10 7 cfu / mL, 10 8 cfu / mL, and then filtered and sterilized to obtain sterile fermentation broths of corresponding low, medium and high concentrations for later use.

[0042] Spread 200 μL of pathogenic bacteria spore suspension (1×10 7 cfu / mL), air-dried, and then placed in a sterile Oxford cup. 200 μL of SEB-34 sterile fermentation liquid was added to the Oxford cup and cultured in the dark at 25°C for 3 d. The size of the inhibition zone was observed and determined.

[0043] The results showed that the three concentrations of fermentation broth had significant inhibitory effects on Fusarium graminearum and Helminthosporium graminearum. The diameters of the inhibition zones of Fusarium graminearum treated with high, medium and low concentrations were 2.35 cm, 1.94 cm and 1.91 cm respectively; the diameters of the inhibition zones of Helminthosporium graminearum treated with high, medium and low concentrations were 2.93 cm, 2.61 cm and 2.31 cm respectively.

[0044] Example 4 Effect of Bacillus subtilis SEB-34 on corn diseases in potted plants 1. Corn stalk rot Preparation of conidia of Fusarium graminearum CMC medium was used. The activated Fusarium graminearum was inoculated into a 250 mL sterile Erlenmeyer flask containing 100 mL CMC medium and cultured in a shaking incubator at 25 °C and 200 rpm for 3-5 days to obtain conidia. The mycelium was filtered out with sterile filter paper, and the conidia suspension was collected and its concentration was adjusted to 1 × 10 using a hemocytometer. 7 cfu / mL.

[0045] SEB-34 microbial agent 1 was adjusted to a concentration of 1×10 7 cfu / mL.

[0046] Maize seedlings were planted in high-temperature sterilized peat soil as the culture medium. The maize variety was Zhengdan 958. When the maize grew to 20 cm, the root base of the healthy maize plants was inoculated with a spore suspension of Fusarium graminearum, the pathogen of maize stem rot (1×10 7 cfu / mL), and 20 mL of sterile water and SEB-34 fermentation liquid (1×10 6 cfu / mL), routine management was performed during the experiment, and the disease index was calculated twice 14 d and 21 d after the application of SEB-34 fermentation liquid. After the second calculation, the aboveground part of the plant was weighed, and the LSD method was used to analyze the significance of the difference in aboveground plant weight between SEB-34 treated and untreated corn.

[0047] The grading standards for corn stalk rot at the seedling stage are as follows: Level 0: The whole plant grows normally and is disease-free; Level 1: Normal growth, with lesions on the roots, accounting for less than 1 / 4, and a little brown in the white roots; Level 2: Growth is stunted, lateral roots are few and short, fibrous roots are few or no, lesions appear in patches, lesions occupy about 1 / 4-1 / 2 of the area, white roots and brown roots are equal; Level 3: Abnormal growth, extremely small lateral roots, large lesions, 1 / 2-3 / 4 of the area, and the root mass is mainly brown; Level 4: The plant germinates but does not seedling, the roots are covered with lesions, the lesions account for more than 3 / 4 of the plant, and the roots show symptoms of rot.

[0048] The disease rate, disease index and control effect are calculated according to the following formulas: Incidence rate (%) = (number of diseased plants / total number of plants) × 100; Disease index (%) = (∑ (number of diseased plants at each level × disease level) / (total number of plants × highest disease level)) × 100; Control effect (%) = (control disease rate - treatment disease rate) / control disease rate × 100.

[0049] Table 4 Control effect of Bacillus subtilis SEB-34 on corn stalk rot in potted plants Note: The plant weights in the table are mean ± standard error, * indicates significant difference at P < 0.05 level.

[0050] Compared with the control group ( Figure 6), the disease index of corn stalk rot 14 days after application of SEB-34 fermentation liquid was 11.67, and the disease index of the unused control group was 24.17, with a control efficiency of 51.72%; the disease index of corn stalk rot 21 days after application of SEB-34 fermentation liquid was 8.33, and the disease index of the unused control group was 34.17, with a control efficiency of 75.61%; 21 days after application of SEB-34 fermentation liquid, the fresh weight of the aboveground part of corn plants was 21.51 g, which was significantly different from the average weight of 18.57 g in the control group (P<0.05). This shows that Bacillus subtilis SEB-34 has a preventive effect on corn stalk rot caused by Fusarium graminearum.

[0051] 2. Corn leaf spot The preparation of the inoculation plate of Helminthosporium umbilicalis was carried out by using PDA medium, inoculating the activated Helminthosporium umbilicalis on the sterilized PDA plate, culturing at 25°C to obtain the inoculation plate of Helminthosporium umbilicalis.

[0052] SEB-34 microbial agent preparation 1 was adjusted to a concentration of 1×10 7 cfu / mL.

[0053] The maize seedlings were planted in high temperature sterilized peat soil as the culture medium. The maize variety was Zhengdan 958. When the maize grew to 30 cm, the greenhouse inoculation experiment was started. First, the SEB-34 fermentation liquid (1×10 6 cfu / mL) 20 mL, and then the flat navel spore culture plate was attached to the corn leaves for pathogen inoculation. The contact time between the leaves and the pathogen was 5 min at each test point. After inoculation, the test period was managed according to routine management. 14 days after the application of SEB-34 fermentation liquid, the incidence was counted and the diseased plant rate and disease index were calculated. The LSD method was used to analyze the significance of the small spot disease incidence between SEB-34 treatment and untreatment. Calculation formula: incidence (%) = (number of diseased plants / total number of plants) × 100.

[0054] Table 5 The potted control effect of Bacillus subtilis SEB-34 on corn leaf blight Note: The plant weights in the table are mean ± standard error, * indicates significant difference at P < 0.05 level.

[0055] Compared with the control group, the incidence rate of corn leaf blight was 27.33% 14 days after the application of SEB-34 fermentation liquid, while the incidence rate of the control group was 48.67%, and the prevention efficiency was 43.84%. This shows that the Bacillus subtilis has a preventive and therapeutic effect on corn leaf blight caused by Helicoverpa maydis.

[0056] Example 5 Effects of Bacillus subtilis SEB-34 on corn germination and plant growth SEB-34 microbial agent (fermentation broth) was prepared according to the method of Preparation 1 in Example 2, and the concentration of the fermentation broth was adjusted to 1×10 6 cfu / mL to obtain SEB-34 bacterial suspension.

[0057] Healthy corn seeds were selected, soaked in the above-mentioned SEB-34 bacterial suspension for 2 h, and then air-dried in a cool place for later use. For the control, clean water was used instead of bacterial suspension to soak the seeds.

[0058] The seeds were sown in a culture box (19 cm × 13 cm × 12 cm), sterilized soil was used for the soil, and Hogland nutrient solution was used for the nutrient solution. Fifteen seeds were sown in each culture box as one treatment, and each treatment was repeated 3 times. After sowing, the seeds were cultured in a greenhouse with an ambient temperature of 20°C-30°C and good light. The emergence of corn was investigated after 7 days, and the growth of corn was investigated after 15 days.

[0059] The results are as follows Figure 7 As shown: after the corn was treated with bacterial suspension, the germination rate of the treatment group was 100%, and the germination rate of the control group was 97.78%. The germination rate of the treatment group was higher than that of the control group, but the difference between the two was not significant (P<0.05); the fresh weight of the plant in the treatment group was 11.29g, and the fresh weight of the plant in the control group was 9.17g, and the plant height of the treatment group was significantly higher than that of the control group (P<0.05). The above results show that SEB-34 treatment has a promoting effect on corn germination and growth.

[0060] Application Example 1 Field control effect of Bacillus subtilis SEB-34 microbial preparation on corn stalk rot From May to November 2023 and May to November 2024, field control efficacy tests were conducted in Linqing, Juye and Guangrao. The corn varieties in Guangrao and Linqing were Fengle 520, and in Juye they were Nongda 372. The test fields were selected in plots where corn had been planted for many consecutive years and where the incidence of stem base rot was more serious. A randomized block distribution design was adopted with three replications, and each plot had an area of ​​33.3m 2 The planting density is 5,000 plants per mu, and there are protection rows between the plots.

[0061] The fermentation liquid (microbial agent) was produced according to the method of microbial agent preparation 1 in Example 2. When sowing, corn seeds with full grains and uniform size were selected, and fermentation liquids of different concentrations (10 6 , 10 7 , 10 8 cfu / mL) for 2 hours and then air-dried in a cool place overnight. For the blank control, clean water was used instead of fermentation liquid to soak the seeds. For the drug treatment, 25 g / L fludioxonil suspension seed coating agent was used to coat the corn seeds.

[0062] Field management was carried out according to field standards, with adequate water supply during the growth period and timely prevention and control of weeds and pests. When corn grew to the late milky stage, 50 corn plants were randomly selected from each treatment and the condition of corn stalk rot was investigated according to the following standards: Level 0: The leaves and stem base of the plant grow normally; Level 1: Leaves show blight symptoms, covering less than 1 / 4 of the area, and there are no symptoms between the bases of 1-2 nodes of the stem; Level 2: The number of withered leaves increases, accounting for about 1 / 2, and 1-2 nodes at the base of the stem appear water-soaked; Level 3: A large number of leaves appear withered, accounting for about 2 / 3, the base of the stem becomes soft, and the fruit clusters droop; Level 4: All leaves of the plant are dead, the hole at the base of the stem is loose and it is very easy to fall over.

[0063] The morbidity, disease index and control effect were calculated with reference to the formula in Example 3.

[0064] Effectiveness will be seen in 2023 Figure 8 , Juye SEB-34 fermentation broth high concentration 10 8 cfu / mL treatment had the highest control effect of 74.65%, followed by the control agent fludioxonil seed dressing treatment with a control effect of 59.15%, and the difference between the two was not significant; Linqing SEB-34 fermentation broth with a high concentration of 10 8 cfu / mL treatment had the highest control effect of 69.52%, followed by the control agent fludioxonil seed dressing treatment with 68.57%, and the difference between the two was not significant; Guangrao control agent fludioxonil seed dressing treatment had the highest control effect of 65.45%, followed by SEB-34 fermentation broth high concentration 10 8 The control efficiency of the treatment was 58.18% with a cfu / mL treatment, and the difference between the two was not significant. 6 The control effects of the treatments with cfu / mL were the lowest, at 40.85%, 55.24% and 41.82% respectively. The control effects of the three points were significantly lower than those of the high-concentration treatment of SEB-34 and the control agent. 7 The control efficiencies of the treatments with cfu / mL were 50.7%, 60.0% and 50.91%, respectively, which were significantly lower than those of the high concentration of SEB-34 fermentation broth. 8 cfu / mL treatment, but there was no significant difference in control effect compared with the control agent fludioxonil seed dressing treatment.

[0065] Effectiveness will be seen in 2024 Figure 8 , Juye SEB-34 fermentation broth high concentration 10 8cfu / mL treatment had the highest control effect of 58.9%, followed by the control agent fludioxonil seed dressing treatment with a control effect of 54.79%, and the difference between the two was not significant; Linqing and Guangrao SEB-34 fermentation liquid with a high concentration of 10 8 The treatment with cfu / mL had the highest control effect, which was 68.97% and 58.83% respectively. The third was the control agent fludioxonil seed dressing treatment, with control effects of 54.02% and 50.59% respectively, with significant differences between the two. 6 The control effect of the treatment with cfu / mL was the lowest, which was 45.21% and 45.98%, respectively, and was significantly lower than the other two concentrations of SEB-34 and the control agent. 6 The control effect of the treatment with cfu / mL was higher than that of the control agent fludioxonil, but the difference was not significant. 7 The efficacy of the treatment with cfu / mL was the third, at 52.05%, which was significantly lower than the high concentration of SEB-34 fermentation broth of 10 8 cfu / mL treatment, but the difference in control effect between the treatment with the control agent myclobutanil and the treatment with the control agent was not significant; the concentration of 10 7 The protective efficiencies of the cfu / mL treatments were 57.47% and 57.65%, respectively, which were significantly higher than those of the control agent.

[0066] The 2023 production results are shown in Fig. 9 , Juye SEB-34 fermentation broth high concentration 10 8 The yield of the treatment with cfu / mL was the highest, which was 631.96 kg, significantly higher than the other treatments, followed by the SEB-34 fermentation broth with a concentration of 10 7 cfu / mL treatment and the control agent fludioxonil treatment were 601.36 kg and 588.86 kg, respectively. There was no significant difference in the yield between the two treatments. The low concentration of SEB-34 fermentation broth was 10 6 The yields of cfu / mL treatment and ck control decreased successively, which were 542.94 kg and 518.68 kg, respectively. There was no significant difference between the two treatments and both were significantly lower than other treatments. 8The yield of the cfu / mL treatment was the highest, which was 574.79 kg, followed by the control agent treatment and the SEB-34 fermentation broth medium concentration treatment, which were 568.45 kg and 556.84 kg, respectively. There was no significant difference among the three treatments. The yield of the SEB-34 fermentation broth low concentration treatment was slightly lower, which was 541.43 kg, significantly lower than the SEB-34 fermentation broth high concentration treatment, but there was no significant difference in yield between the control agent treatment and the SEB-34 fermentation broth medium concentration treatment. The yield of the ck treatment was the lowest, which was 515.07 kg, significantly lower than the other treatments except the SEB-34 fermentation broth low concentration treatment. 8 The cfu / mL treatment had the highest yield of 536.71 kg, which was significantly higher than the other treatments, followed by the control treatment and the SEB-34 fermentation broth medium concentration treatment, which were 507.75 kg and 491.82 kg respectively. There was no significant difference in yield between the two treatments. The yield of the SEB-34 fermentation broth low concentration treatment was slightly lower, at 541.43 kg, which was significantly lower than the control treatment but not significantly different from the SEB-34 fermentation broth medium concentration treatment. The ck treatment had the lowest yield of 451.05 kg, which was significantly lower than the other treatments except the SEB-34 fermentation broth low concentration treatment. The 2024 production results are shown in Fig. 9 The yields of Juye control agent treatment, SEB-34 fermentation broth high and medium concentration treatments decreased in turn, which were 691.95 kg, 688.18 kg and 674.78 kg, respectively. The yields of the three treatments were not significantly different. The yields of SEB-34 fermentation broth low concentration treatment and ck treatment were the lowest, which were 629.18 kg and 624.48 kg, respectively. The difference between the two was not significant and significantly lower than the other three treatments. Linqing SEB-34 fermentation broth high concentration 10 8 The yield of the cfu / mL treatment was the highest, which was 685.93 kg, followed by the control agent treatment at 680.78 kg, with no significant difference between the two treatments. The yields of the low, medium concentration treatments and ck treatment of SEB-34 fermentation broth decreased in turn, which were 654.07 kg, 649.30 kg and 635.29 kg, respectively. The differences among the three treatments were not significant and significantly lower than the yields of other treatments. The high concentration treatment of SEB-34 fermentation broth in Guangrao had the highest yield of 551.76 kg, and the yields of the control agent treatment and the medium concentration treatment of SEB-34 fermentation broth decreased in turn, which were 535.25 kg and 528.38 kg, respectively. The differences among the three treatments were not significant. The yields of the low concentration treatment of SEB-34 fermentation broth and ck treatment decreased in turn, which were 486.24 kg and 461.95 kg, respectively. The differences among the three treatments were not significant and significantly lower than the other three treatments.

[0067] Application Example 2 Field Control Effect of Bacillus subtilis SEB-34 Microbial Preparation on Corn Leaf Spot From May to November 2023 and from May to November 2024, field control efficacy tests were conducted in Linqing, Juye, and Guangrao. The maize varieties in Guangrao and Linqing were Fengle 520, and in Juye, Nongda 372. The experimental fields were selected in plots where maize had been planted for many consecutive years and where the disease was more severe. A randomized block distribution design was used with three replicates, and each plot had an area of ​​33.3 m 2 The planting density is 5,000 plants per mu, and there are protection rows between the plots.

[0068] When sowing, choose corn seeds with full grains and uniform size. Use fermentation liquid of different concentrations (10 6 , 10 7 , 10 8 cfu / mL) for 2 hours and then air-dried in a cool place overnight. For the blank control, clean water was used instead of fermentation liquid to soak the seeds. For the drug treatment, 60 g / L tebuconazole suspension seed coating agent was used to coat the corn seeds.

[0069] Field management was carried out according to field standards, with adequate water supply during the growth period and timely prevention and control of weeds and pests. When corn grew to the late milky stage, 50 corn plants were randomly selected from each treatment and the condition of corn leaf spot was investigated according to the following standards: Level 0: no disease; Level 1: The lesion area accounts for less than 5% of the leaf area; Level 3: The lesion area accounts for 6%-10% of the leaf area; Level 5: The lesion area accounts for 11%-25% of the leaf area; Level 7: The lesion area accounts for 26%-50% of the leaf area; Level 9: The lesion area accounts for more than 51% of the leaf area.

[0070] The disease rate, disease index and control effect are calculated according to the following formulas: Incidence rate (%) = (number of diseased plants / total number of plants) × 100; Disease index (%) = (∑ (number of diseased plants at each level × disease level) / (total number of plants × highest disease level)) × 100; Control effect (%) = (control disease rate - treatment disease rate) / control disease rate × 100; In the field trials at three different test sites in Juye, Linqing and Guangrao in 2023 and 2024, compared with the control group, soaking corn seeds in SEB-34 fermentation liquid of different concentrations can significantly reduce the incidence of corn leaf blight, showing good prevention and control effects.

[0071] Effectiveness will be seen in 2023 Fig.10 , Juye SEB-34 fermentation broth high concentration 10 8The cfu / mL treatment had the highest control effect, which was 67.65%, followed by the control agent tebuconazole seed dressing treatment and the SEB-34 fermentation broth medium concentration treatment, which were 63.97% and 62.5%, respectively. There was no significant difference among the three treatments (P<0.05). The low concentration of SEB-34 fermentation broth treatment had the lowest control effect, which was 52.94%, significantly lower than the high concentration of SEB-34 fermentation broth treatment, but not significantly different from the other two treatments. The high concentration of SEB-34 fermentation broth treatment in Linqing had the highest control effect, followed by the control agent treatment and the SEB-34 fermentation broth medium concentration treatment, which were 75.8%, 70.07% and 66.88%, respectively. There was no significant difference among the three. The low concentration of SEB-34 fermentation broth treatment had the lowest control effect, which was 59.24%, which was not significantly different from the medium concentration of SEB-34 fermentation broth treatment but significantly lower than the other two treatments. The high-concentration treatment of Guangrao SEB-34 fermentation broth had the highest protective effect, followed by the control agent treatment and the medium-concentration treatment of SEB-34 fermentation broth, which were 73.79%, 72.41% and 68.28% respectively. There were no significant differences among the three. The low-concentration treatment of SEB-34 fermentation broth had the lowest protective effect, which was 55.86%, which was not significantly different from the medium-concentration treatment of SEB-34 fermentation broth but significantly lower than the other two treatments.

[0072] Effectiveness will be seen in 2024 Fig.10 , Juye SEB-34 fermentation broth high concentration 10 8 The control effect of cfu / mL treatment was the highest, followed by the control agent tebuconazole seed dressing treatment, which were 81.77% and 80.3% respectively, with no significant difference between the two. The control effects of SEB-34 fermentation broth medium and low concentration treatments decreased in turn, which were 72.41% and 69.95% respectively, with no significant difference between the two and significantly lower than the other two treatments. 8 The CFU / mL treatment had the highest control effect, followed by the control agent tebuconazole seed dressing treatment, with control effects of 73.77% and 72.13% respectively, with no significant difference between the two. The third was the control effect of 67.21% in the SEB-34 fermentation broth medium concentration treatment, which was significantly lower than the SEB-34 fermentation broth high concentration treatment, but not significantly different from the control agent treatment. The SEB-34 fermentation broth low concentration treatment had the lowest control effect, at 55.74%, which was significantly lower than the other treatments. Guangrao SEB-34 fermentation broth high concentration 10 8 The cfu / mL treatment had the highest control effect, followed by the control agent tebuconazole seed dressing treatment, with control effects of 77.29% and 73.43% respectively, and the difference between the two was not significant. The third was the SEB-34 fermentation broth medium concentration treatment with a control effect of 67.64%, which was significantly lower than the SEB-34 fermentation broth high concentration treatment, but not significantly different from the control agent treatment. The SEB-34 fermentation broth low concentration treatment had the lowest control effect of 57.49%, which was significantly lower than other treatments.

[0073] The 2023 production results are shown in Fig.11 , Juye SEB-34 fermentation broth high concentration 10 8 The yield of the treatment with cfu / mL was the highest, which was 635.82 kg, significantly higher than the other treatments, followed by the SEB-34 fermentation broth with a concentration of 10 7 The yields of the treatment with cfu / mL and the control agent tebuconazole were 593.26 kg and 579.31 kg, respectively. There was no significant difference in the yield between the two treatments. 6 cfu / mL treatment, the yield was 550.49 kg, significantly lower than the above three treatments, the ck control had the lowest yield, 524.55 kg, significantly lower than the other treatments. The yields of the high and medium concentration treatments of SEB-34 fermentation broth in Linqing and the control agent treatment decreased in turn, which were 569.87 kg, 565.85 kg and 564.19 kg, respectively, and there were no significant differences among the three treatments. The fourth was the low concentration treatment of SEB-34 fermentation broth, with a yield of 535.18 kg, significantly lower than the above three treatments, and the ck treatment had the lowest yield, 489.97 kg, significantly lower than the other treatments. The yields of the high and medium concentration treatments of SEB-34 fermentation broth in Guangrao, the control agent treatment and the low concentration treatment of SEB-34 fermentation broth decreased in turn, which were 456.78 kg, 448.33 kg, 447.35 kg and 427.22 kg, respectively, and there were no significant differences among the four treatments. The ck treatment had the lowest yield, 391.7 kg, significantly lower than the other treatments.

[0074] The 2024 production results are shown in Fig.11, the yield of Juye SEB-34 fermentation broth high concentration treatment, control agent treatment and SEB-34 fermentation broth medium concentration treatment decreased in turn, which were 554.33 kg, 542.58 kg and 541.95 kg respectively, and the differences among the three treatments were not significant. The yield of SEB-34 fermentation broth low concentration treatment and ck treatment was the lowest, which were 507.47 kg and 494.84 kg respectively, and the difference between the two treatments was not significant and significantly lower than the other three treatments. Linqing SEB-34 fermentation broth high concentration treatment had the highest yield, which was 431.17 kg, significantly higher than the other treatments. The yield of SEB-34 fermentation broth low and medium concentration treatments and control agent treatment decreased in turn, which were 408.11 kg, 406.4 kg and 398.62 kg respectively, and the differences among the three treatments were not significant. The yield of ck treatment was the lowest, which was 384.7 kg, which was not significantly different from the control agent treatment and significantly lower than the other treatments. The yields of Guangrao SEB-34 fermentation broth high concentration treatment, control agent treatment, and SEB-34 fermentation broth medium and low concentration treatments decreased in sequence, which were 436.94 kg, 432.74 kg, 425.98 kg and 413.01 kg, respectively. There was no significant difference among the four treatments. The yield of ck treatment was the lowest, which was 373.79 kg, significantly lower than other treatments.

[0075] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. A strain of Bacillus subtilis ( Bacillus subtilis )SEB-34, the deposit number is CGMCC No. 26419.

2. A fermentation product of Bacillus subtilis SEB-34 according to claim 1, characterized in that: The fermentation product is the cell-free fermentation liquid of Bacillus subtilis SEB-34, or the dried product or concentrated liquid of the cell-free fermentation liquid.

3. A microbial agent, characterized in that: The active ingredient of the microbial agent is at least one of the bacterial body, spores and fermentation products of Bacillus subtilis SEB-34 as claimed in claim 1.

4. The microbial agent according to claim 3 is characterized in that: The dosage form of the microbial agent is a liquid preparation or a solid preparation; The amount of Bacillus subtilis SEB-34 in the liquid preparation is not less than 1×10 8 cfu / mL; the number of Bacillus subtilis SEB-34 in the solid preparation is not less than 1×10 9 cfu / g; The microbial preparation may also include other inert ingredients.

5. The microbial agent according to claim 4 is characterized in that: The amount of Bacillus subtilis SEB-34 in the solid preparation is (5-10)×10 9 cfu / g; The inert component is selected from one or more of an absorbent, a stabilizer and a surfactant.

6. A method for preparing a microbial agent according to any one of claims 3 to 5, characterized in that: The following steps are involved: Cultivating the seed liquid of Bacillus subtilis SEB-34 in a fermentation medium to obtain a fermentation liquid; obtaining a fermentation product after solid-liquid separation of the fermentation liquid; and selecting at least one of the bacterial body, spores and fermentation product of Bacillus subtilis SEB-34 to obtain a microbial agent; The fermentation medium comprises the following components in percentage by weight: 1% bran, 1% corn flour, 0.5% sodium chloride, 0.1% potassium dihydrogen phosphate, 0.05% manganese sulfate, and the remainder is water.

7. The preparation method according to claim 6, characterized in that: The following steps are involved: (1) Bacillus subtilis SEB-34 strain was activated on LB plate medium, and a single colony was picked and cultured on LB slant medium at 25°C-30°C to obtain an activated strain; (2) Inoculate the activated strain into LB liquid culture medium and culture with stirring at 35°C for 24 hours to obtain seed solution; (3) Inoculate the seed liquid into the fermentation medium at a volume ratio of 1:(25-50), and ferment and culture at 35°C and a shaking speed of 150 rpm to obtain a fermentation liquid; (4) After solid-liquid separation of the fermentation liquid, bacteria, spores and cell-free fermentation liquid can be obtained; (5) concentrating or drying the cell-free fermentation broth to obtain a dry product or concentrated solution of the SEB-34 cell-free fermentation broth; (6) Select at least one of the cells, spores and fermentation products of SEB-34 and mix them to obtain a microbial agent.

8. The preparation method according to claim 7, characterized in that: In step (1), the composition and content of the LB plate medium and the LB slant medium are: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder; In step (2), the composition and content of the LB liquid culture medium are: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride; The pH value of LB plate medium, LB slant medium, and LB liquid medium was 7.0; In step (3), the end point of the fermentation culture is when the mature spores in the fermentation broth account for 90% of the total number of spores and bacterial cells.

9. Use of the Bacillus subtilis according to claim 1, the fermentation product according to claim 2 or the microbial agent according to any one of claims 3 to 5 in preventing and controlling plant diseases and promoting plant growth, characterized in that: The plant disease is caused by Fusarium graminearum ( Fusarium graminearum ) or Helminthosporium maydis ( Bipolaris maydis (Nisikado et Miyake) Shoemaker) caused.

10. The use according to claim 9, characterized in that: The plant is corn.

Images