Construction method and application method of Brucella effect protein BspE gene deleted strain

Abstract

The invention belongs to but not limited to the technical field of genetic engineering technology, and discloses a construction method and application of a BspE gene deletion strain of Brucella effect protein, the BspE gene deletion strain is constructed by using homologous recombination and SacB reverse screening technology, Brucella abortus A19 vaccine strain liquid is used as a template, PCR amplification is carried out to obtain upstream and downstream homologous arms of BspE gene, and the BspE gene deletion strain is constructed by using the upstream and downstream homologous arms of the BspE gene. The method comprises the following steps: carrying out fusion PCR (Polymerase Chain Reaction) amplification on upstream and downstream homologous arms of a BspE gene subjected to gel recovery, and connecting and transforming an obtained fusion fragment and a pUC19-SacB plasmid to obtain a recombinant plasmid pUC19-delta BspE. The invention relates to a bovine brucella BspE deletion vaccine strain, which is characterized in that a plasmid is obtained, the plasmid is electrically transformed into a bovine brucella A19 competent cell, and the positive transformant is a bovine brucella BspE deletion strain through kanamycin resistance and sucrose pressure screening, PCR (polymerase chain reaction) identification and sequencing, and the deletion vaccine strain improves the levels of antibacterial cytokines and specific brucella antibody IgG, and can be used for preparing the bovine brucella BspE deletion vaccine strain. The Brucella attenuated vaccine strain is a novel Brucella candidate attenuated vaccine strain and has a good market prospect.

Description

Technical Field

[0001] The present invention belongs to but is not limited to the technical field of genetic engineering technology, and in particular relates to a construction method and an application method of a Brucella effector protein BspE gene deletion strain. Background Art

[0002] Brucellosis is a zoonosis caused by Brucella, which poses a great threat to human health and the economic development of animal husbandry. At present, the prevention and control of brucellosis mainly relies on live attenuated vaccines, which play an important role in prevention and control, but also have some problems, such as interference with diagnosis, residual virulence and abortion of pregnant animals.

[0003] Many intracellular parasites promote their survival and proliferation in host cells by secreting effector proteins. Brucella survives and proliferates in the body by secreting a variety of virulence factors to evade the body's immune response. T4SS is an important virulence factor of Brucella, and the effector proteins it secretes have a regulatory effect on the survival of Brucella in cells and the immune response after infection. At present, 17 effector proteins related to T4SS have been discovered, namely VceA, VceC, RicA, BPE005, BPE043, BPE123, BPE275, BtpA, BtpB, SepA, BspA, BspB, BspC, BspE, BspF, BspJ and BspL, which play an important role in the process of Brucella infecting the host.

[0004] There are three main problems in the existing brucellosis prevention and control technologies:

[0005] 1. Vaccine issues: Although live attenuated vaccines have played a role in preventing and controlling brucellosis, their residual virulence and interference with diagnosis make it difficult to distinguish infected individuals among vaccinated animals. In addition, the use of vaccines has caused abortions in pregnant animals, causing economic losses to the animal husbandry industry.

[0006] 2. The function of the effector protein is unclear: Although the T4SS system of Brucella and the 17 effector proteins it secretes play an important role in infection and immune escape, the function of the BspE protein is still unclear, which limits the understanding of its specific mechanism of action in the host infection process and affects the optimization of related prevention and control strategies.

[0007] 3. Complex escape mechanism: Brucella evades the host's immune response by secreting a variety of virulence factors. Existing research on the survival mechanism of Brucella in host cells is not comprehensive enough, resulting in the inability of prevention and control methods to effectively control its immune escape characteristics. Summary of the invention

[0008] In view of the problems existing in the prior art, the present invention relates to a traceless gene knockout technology, taking bovine Brucella A19 strain as the research object, and constructing a method and application of a Brucella effector protein BspE gene deletion strain.

[0009] The present invention is achieved by a method for constructing a BspE gene deletion strain of the effector protein of bovine Brucella, which utilizes homologous recombination and SacB reverse screening technology to construct the BspE gene deletion strain, comprising the following steps:

[0010] Step 1, designing BspE upstream and downstream homology arm primers and identification primers according to the Brucella bovis genome sequence;

[0011] Step 2: using the inactivated Brucella bovis A19 strain as a template, amplifying the upstream and downstream homologous arms of the BspE gene with a high-fidelity enzyme, and performing gel recovery after successful verification of the PCR product by electrophoresis;

[0012] Step 3, using the reaction product of step 2 as a template, using BspE-up-F and BspE-down-R as primers for amplification, and after successful electrophoresis verification, the PCR product is subjected to gel recovery treatment to obtain a BspE upstream and downstream homology arm gene fusion DNA fragment;

[0013] Step 4: Construction of pUC19-ΔBspE recombinant plasmid: using ClonExpress one-step method, the fusion DNA fragment recovered in step 3 was reacted with pUC19-SacB plasmid;

[0014] Step 5, construction and screening of A19ΔBspE deletion strain: prepare Brucella bovis A19 competent cells, use primers BspE-PC-F and BspE-PC-R for PCR identification, and screen BspE gene deletion strains.

[0015] Further, the primers in step 1 include:

[0016] BspE-up-F:ACCTGCAGGCATGCAAGCTTAAAATAGCTGCGGAACGC;

[0017] BspE-up-R:ATCGAACAGGAGACCAGACCGCCGCACCATGCTGAAGC;

[0018] BspE-down-F: GCTTCAGCATGGTGCGGCGTCTGGTCTCCTGTTCGAT;

[0019] BspE-down-R: ACCATGATTACGCCAAGCTTTTTTCGACCGCAATGCAG;

[0020] BspE-PC-F:AAACAAGGGCGTATCAGCG;

[0021] BspE-PC-R:AAAACCCCGGACTTTGAAACC.

[0022] Furthermore, the amplification conditions in the step 2 are: pre-denaturation at 98°C for 10 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; extension at 72°C for 10 min; the amplification system of the upstream homologous arm of the BspE gene is 25 μL: Primer StarMax Premix: 12.5 μL; Brucella bovis A19 bacterial liquid: 3 μL; BspE-up-F: 1 μL; BspE-up-R: 1 μL; ddH2O: 7.5 μL; the amplification system of the downstream homologous arm of the BspE gene is 25 μL: Primer StarMax Premix: 12.5 μL; Brucella bovis A19 bacterial liquid: 3 μL; BspE-down-F: 1 μL; BspE-down-R: 1 μL; ddH2O: 7.5 μL.

[0023] Furthermore, the amplification conditions in the step three are: pre-denaturation at 98°C for 10 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles; extension at 72°C for 10 min; the amplification system for the upstream homologous arm of the BspE gene is 25 μL: Primer StarMax Premix: 12.5 μL; template: 3 μL; BspE-up-F: 1 μL; BspE-down-R: 1 μL; ddH2O: 7.5 μL.

[0024] Further, the specific operation process of step 4 is as follows:

[0025] Ligation system 20μL: step three reaction product: 8μL, pUC19-SacB: 2μL, 2×ClonExpress Mix: 10μL, incubate in a 50℃ water bath for 45min, then transform into E. coli competent cells DH5α, spread on LB plates containing 50μg / mL kanamycin, pick out single clones and transfer to LB liquid culture medium containing 50μg / mL kanamycin, culture at 37℃ with shaking for 12h, take bacterial solution for bacterial solution PCR detection, and send positive bacterial solution to the company for sequencing.

[0026] Further, the specific operation process of step five is as follows:

[0027] A single colony of Brucella bovis A19 with good growth was picked from a non-antibiotic TSA plate, inoculated into 15 mL of TSB liquid medium, and cultured in a constant temperature shaker at 37°C and 180 r / min until the logarithmic growth phase (OD600≈0.6) to prepare Brucella competent cells;

[0028] The preparation method of competent cells of Brucella bovis is as follows: the Brucella bovis A19 vaccine strain frozen at -80°C is streaked and revived on an antibiotic-free TSA solid culture medium, and cultured at 37°C for 72 hours; a monoclonal colony is picked and inoculated into 15mL TSB liquid culture medium, and cultured at 37°C and 180r / min to the logarithmic growth phase (OD600≈0.6); the bacterial solution cultured to the logarithmic growth phase is taken, ice-bathed for 1h, centrifuged at 4°C and 5000r / min for 5min, and the bacteria are collected; the bacteria are resuspended with 10mL ddH2O precooled at 4°C, centrifuged at 4°C and 5000r / min for 5min, the supernatant is discarded, and the process is repeated three times; the bacteria are resuspended with 10mL 10% sterile glycerol precooled at 4°C, centrifuged at 4°C and 5000r / min for 5min, the supernatant is discarded, and the process is repeated three times; finally, the supernatant is aspirated, the precipitate is resuspended with 200μL 10% sterile glycerol, and the precipitate is divided into two tubes and placed on an ice box.

[0029] Further, the construction and screening method of A19ΔBspE deletion strain was as follows: the correctly sequenced recombinant plasmid pUC19-ΔBspE was mixed evenly with A19 competent cells, placed in an ice bath for 1 hour, transferred to an electric shock cup, a voltage of 2.5KV was applied, TSB culture medium was added immediately after lightning shock, transferred to a 15mL centrifuge tube, cultured in a shaking incubator at 37°C and 180r / min for 48 hours, and after recovery, spread on a TSA plate containing 25μg / mL kanamycin and cultured at 37°C. The single colony was cultured for 3 days; a single colony was picked and placed in TSB liquid culture medium containing 50 μg / mL kanamycin, and after culturing to the logarithmic growth phase, it was spread on a TSA plate containing 10% sucrose and cultured at 37°C for 3 days; a single clone colony was picked and placed in TSB culture medium, and after culturing to the logarithmic growth phase, 200 μL of the bacterial solution was taken and inactivated in a 90°C water bath for 1 hour, and the bacterial solution was identified by PCR using primers BspE-PC-F and BspE-PC-R to screen for BspE gene deletion strains.

[0030] Another object of the present invention is to provide a method for constructing a bovine Brucella effector protein BspE gene deletion strain and use of the BspE gene deletion strain constructed by the method in preparing a vaccine for preventing Brucella infection.

[0031] In view of the technical problems existing in the above-mentioned prior art, some creative technical effects are brought about after solving the problems. The specific description is as follows:

[0032] First, the present invention uses the genomic DNA of the bovine Brucella A19 vaccine strain as a template, obtains the specific upstream and downstream homologous arms of the BspE gene by PCR amplification, performs fusion PCR amplification on the upstream and downstream homologous arms of the BspE gene recovered by gel, connects and transforms the obtained fusion fragment with the pUC19-SacB plasmid, and obtains the recombinant plasmid pUC19-ΔBspE. The plasmid is electrotransformed into the prepared bovine Brucella A19 competent cells, screened by kanamycin resistance and sucrose pressure, identified by PCR and sequenced, and the obtained positive transformant is the BspE deletion strain of bovine Brucella.

[0033] Compared with the parental strain A19 of Brucella bovis, the constructed A19ΔBspE deletion strain has similar survival, adhesion and invasion abilities in vitro and in RAW264.7 cells as the parental Brucella A19 strain; the A19ΔBspE deletion strain exhibited a stronger ability to induce antibacterial TNF-ɑ production in vitro and in vivo. Within 3 weeks of infection, the pathological changes in the spleen of A19ΔBspE mice were not significantly different from those of Brucella bovis A19; and the level of Brucella IgG antibodies in the serum of mice in the A19ΔBspE infection group was significantly higher than that of the parental Brucella A19 strain, indicating that the constructed A19ΔBspE deletion strain has better immune protection than the parental strain and can be used as a new candidate vaccine strain for Brucella bovis.

[0034] The present invention constructs a bovine Brucella A19ΔBspE deletion strain by homologous recombination and SacB reverse screening technology, and verifies that the constructed A19ΔBspE deletion strain has better immune protection than the parent strain, and can be used as a new bovine Brucella candidate vaccine strain. The bovine Brucella BspE gene deletion strain obtained by the present invention can provide a reference strain for the development of a new attenuated Brucella vaccine, which is of great significance.

[0035] Second, the expected benefits and commercial value of the technical solution of the present invention after transformation are as follows: Brucella is a major animal epidemic that the country is currently concerned about, and ranks first among major animal zoonoses. Governments at all levels have formulated corresponding purification and prevention and control requirements in accordance with national policies. Vaccines are a key prevention and control link. According to current vaccine immunity and market demand, it has a large market prospect. The expected benefits and commercial value after transformation will exceed 100 million yuan.

[0036] The technical solution of the present invention fills the technical gap in the industry at home and abroad: the new attenuated Brucella A19ΔBspE deletion strain constructed by the patent of the present invention fills the technical gap in the lack of BspE effector protein deletion strain vaccines at home and abroad, and at the same time fills the gap in the current attenuated vaccines without effector protein virulence factors.

[0037] The technical solution of the present invention solves a technical problem that people have been eager to solve but have never succeeded in solving: the problem of Brucella vaccine is the technical problem of residual virulence and low antibody level. The Brucella attenuated A19ΔBspE deletion strain constructed by this patent increases the level of antibacterial inflammatory factors but does not cause pathological damage, and increases the antibody level after immunization. It has strong creativity and innovation, and has preliminarily solved the key technical problems that have long existed in Brucella vaccine prevention and control.

[0038] The technical solution of the present invention overcomes technical prejudice: in the method for constructing a Brucella deletion strain, a homologous recombination scarless deletion method is adopted to avoid the deletion of the first gene, which causes a chain reaction of changes in the expression of a large number of genes, and at the same time avoids the disadvantages of using resistance gene screening in vaccine strains, which is in line with the general direction of vaccine research. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a flow chart of the method for constructing a Brucella bovis effector protein BspE gene deletion strain provided by an embodiment of the present invention;

[0040] Figure 2 It is a graph showing the PCR results of the upstream and downstream homology arms of the BspE gene provided in an embodiment of the present invention;

[0041] M is DL2000 DNA Marker, lane 1 is the PCR product of the upstream homology arm of the BspE gene, and lane 2 is the PCR product of the downstream homology arm of the BspE gene;

[0042] Figure 3 It is a diagram showing the PCR result of the fusion of the upstream and downstream homology arms of BspE provided in an embodiment of the present invention;

[0043] M is DL2000 DNA Marker, and lane 1 is the product of the fusion of the upstream and downstream homology arms of the BspE gene;

[0044] Figure 4 This is a diagram showing the identification results of the recombinant vector pUC19-ΔBspE provided in an embodiment of the present invention;

[0045] M is DL5000 DNA Marker, lane 1 is the positive control, lane 2 is the negative control, and lanes 3-7 are the PCR identification results of the recombinant vector pUC19-ΔBspE;

[0046] Figure 5 It is a diagram of the identification results of the BspE gene-deficient strain of Brucella bovis provided in an embodiment of the present invention;

[0047] M is DL5000 DNA Marker, lane 1 is negative control, lane 2 is positive control, and lane 3 is the PCR product for identifying the BspE gene deletion strain of Brucella bovis;

[0048] Figure 6 It is a graph showing the growth curve detection result of the BspE gene-deficient strain of Brucella bovis provided in an embodiment of the present invention;

[0049] Figure 7 This is a graph showing the results of an intracellular proliferation test of a BspE gene-deficient strain of Brucella bovis provided in an embodiment of the present invention;

[0050] Figure 8 This is a graph showing the detection result of the Brucella bovis BspE gene deletion on the inflammatory cytokine TNF-α in RAW264.7 cells provided in an embodiment of the present invention; A: relative expression level, B: TNF-α;

[0051] Fig. 9 This is a diagram showing the results of a bacterial adhesion test of a Brucella bovis BspE gene-deficient strain provided by an embodiment of the present invention;

[0052] Fig.10 This is a graph showing the results of a bacterial invasion test of Brucella bovis BspE gene-deficient bacteria provided by an embodiment of the present invention;

[0053] Fig.11 This is a diagram showing the detection results of the BspE gene deletion of Brucella bovis on the pathological changes of the spleen of infected mice provided by an embodiment of the present invention; the red arrow indicates the neutrophil, the green arrow indicates the macrophage, and the scale is 50 μm;

[0054] Fig.12 This is a graph showing the results of detecting the effect of BspE gene deletion of Brucella bovis on IgG antibody levels in the serum of infected mice provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0055] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0056] The Brucella bovis A19 strain (CVCC 70202) mentioned in the present invention was purchased from Tiankang Biotechnology Co., Ltd. and is a strain available on the market.

[0057] The method for constructing a Brucella bovis effector protein BspE gene deletion strain provided by the present invention adopts homologous recombination and SacB reverse screening technology to construct the BspE gene deletion strain, comprising the following steps:

[0058] Step 1, designing primers for upstream and downstream homology arms of the BspE gene and primers for identification according to the genome sequence of Brucella bovis;

[0059] Step 2: using the inactivated bovine Brucella A19 strain as a template, a high-fidelity enzyme is used to amplify the upstream and downstream homology arms of the BspE gene, and the amplified product is successfully verified by electrophoresis and then subjected to gel recovery treatment;

[0060] Step 3, using the amplified product of step 2 as a template, using BspE-up-F and BspE-down-R primers for amplification, and after successful electrophoresis verification, the amplified product is subjected to gel recovery treatment to obtain a fusion DNA fragment of the upstream and downstream homology arms of the BspE gene;

[0061] Step 4: construct the pUC19-ΔBspE recombinant plasmid, and use the ClonExpress one-step method to react the fusion DNA fragment recovered in step 3 with the pUC19-SacB plasmid;

[0062] Step five, constructing and screening A19ΔBspE deletion strains, specifically including preparing Brucella bovis A19 competent cells, using primers BspE-PC-F and BspE-PC-R for PCR identification, and screening out BspE gene deletion strains.

[0063] Primers in step 1 include:

[0064] BspE-up-F:ACCTGCAGGCATGCAAGCTTAAAATAGCTGCGGAACGC;

[0065] BspE-up-R:ATCGAACAGGAGACCAGACCGCCGCACCATGCTGAAGC;

[0066] BspE-down-F: GCTTCAGCATGGTGCGGCGTCTGGTCTCCTGTTCGAT;

[0067] BspE-down-R: ACCATGATTACGCCAAGCTTTTTTCGACCGCAATGCAG;

[0068] BspE-PC-F:AAACAAGGGCGTATCAGCG;

[0069] BspE-PC-R:AAAACCCCGGACTTTGAAACC.

[0070] The amplification conditions in step 2 are:

[0071] Pre-denaturation: 98°C, 10 minutes;

[0072] Cycling conditions: 98°C, 10 seconds; 60°C, annealing for 30 seconds; 72°C, extension for 1 minute, for a total of 30 cycles;

[0073] Final extension: 72°C, 10 min;

[0074] Amplification system:

[0075] BspE gene upstream homology arm amplification system (25 μL): Primer StarMax Premix 12.5 μL; Brucella bovis A19 bacterial solution 3 μL; BspE-up-F 1 μL; BspE-up-R 1 μL; ddH2O 7.5 μL;

[0076] BspE gene downstream homology arm amplification system (25 μL): Primer StarMax Premix 12.5 μL; Brucella bovis A19 bacterial solution 3 μL; BspE-down-F 1 μL; BspE-down-R 1 μL; ddH2O 7.5 μL.

[0077] The present invention provides a method for constructing a BspE gene deletion strain of the effector protein of bovine Brucella using homologous recombination and SacB reverse screening technology. The BspE gene deletion strain was successfully constructed by designing specific primers to knock out the BspE gene, and combining high-fidelity enzyme amplification technology and molecular biological identification means. The method has clear steps, simple operation, high efficiency and reliability, and can effectively improve the success rate and accuracy of gene deletion strain construction.

[0078] Step 1 ensures accurate amplification of the upstream and downstream homologous arms of the BspE gene by designing specific primers, laying the foundation for subsequent homologous recombination.

[0079] Steps 2 and 3 ensure the high fidelity of the homology arms and the integrity of the fusion DNA fragments through the use of high-fidelity enzymes and precise PCR amplification.

[0080] In step 4, ClonExpress one-step method was used for plasmid recombination, which simplified the operation process and improved the recombination efficiency.

[0081] Step 5 ensures the correct construction of the BspE gene deletion strain through the preparation of competent cells and PCR identification, providing an efficient screening method.

[0082] The method for constructing a Brucella bovis effector protein BspE gene-deficient strain of the present invention overcomes the problems of low gene deletion efficiency and complicated operation in the prior art, and has the following significant technical effects:

[0083] 1. High efficiency: Through optimized PCR amplification conditions and one-step plasmid recombination, the construction efficiency of gene deletion is improved and the experimental cycle is significantly shortened.

[0084] 2. Accuracy: Designing specific primers and using high-fidelity enzyme amplification ensures the accurate amplification of homologous arms and the integrity of fusion DNA fragments, improving the accuracy and success rate of gene knockout.

[0085] 3. Easy to operate: The steps are clear, the process is simplified, the operation process is efficient and convenient, and it is suitable for large-scale gene knockout experiments.

[0086] 4. Stability: SacB reverse screening technology provides an effective screening method to ensure the stability and reliability of gene-deficient strains.

[0087] The method for constructing a Brucella bovis effector protein BspE gene deletion strain provided by the present invention has the significant advantages of high efficiency, accuracy, simplicity and stability, is suitable for Brucella bovis related research and application, and has broad industrial application prospects and significant technological progress.

[0088] like Figure 1 As shown, a method for constructing a bovine Brucella effector protein BspE gene deletion strain provided in an embodiment of the present invention utilizes homologous recombination and fructan sucrose transferase gene (SacB) reverse screening technology to construct a BspE gene deletion strain, and the specific steps are as follows:

[0089] (1) Primer design: The complete genome sequence of Brucella bovis A19 was searched in NCBI, and Snapgene was used to design BspE upstream and downstream homology arm primers and identification primers. The primer sequences are shown in Table 1.

[0090] Table 1 Primer sequences

[0091]

[0092]

[0093] (2) PCR amplification of target fragment: Using the bacterial culture of Brucella bovis A19 as a template, PCR amplification was performed using primers BspE-up-F / R and BspE-down-F / R to obtain the BspE upstream and downstream homologous arm gene fragments.

[0094] (3) Fusion PCR amplification: The gel-recovered fragment obtained in step (2) was subjected to fusion PCR amplification using primers BspE-up-F and BspE-down-R to obtain a fusion DNA fragment of the BspE upstream and downstream homology arm genes.

[0095] (4) Construction of recombinant plasmid pUC19-ΔBspE: Using the ClonExpress one-step method, the fusion DNA fragment recovered in step (3) was reacted with the pUC19-SacB plasmid.

[0096] After incubating the reaction system in a 50°C water bath for 45 minutes, the reaction system was transferred into Escherichia coli DH5α competent cells, spread on LA plates containing 50 μg / mL kanamycin, and incubated at 37°C for 12 hours. After picking single clone colonies and incubating them in LB liquid culture medium containing 50 μg / mL for 12 hours, the recombinant plasmid pUC19-ΔBspE was extracted using the Tiangen plasmid extraction kit, identified and sequenced by PCR, and stored at -20°C for use.

[0097] (5) Screening and identification of A19ΔBspE deletion strain: A single colony of Brucella bovis A19 with good growth was picked from a non-antibiotic TSA plate, inoculated into 15 mL of TSB liquid culture medium, and cultured in a constant temperature shaker at 37°C and 180 r / min until the logarithmic growth phase (OD600≈0.6) to prepare Brucella competent cells. The steps for preparing Brucella competent cells are as follows:

[0098] 1) Take the bacterial culture medium that has been cultured to the logarithmic growth phase, centrifuge it at 4°C and 5000r / min for 5 min, and collect the precipitate.

[0099] 2) Resuspend the precipitate with 10 mL of 10% sterile glycerol cooled at 4°C, centrifuge at 4°C and 5000 rpm for 5 min to collect the precipitate, and repeat three times.

[0100] 3) Finally, aspirate the supernatant, resuspend the precipitate with 200 μl 10% sterile glycerol, divide into two tubes, and place on an ice box.

[0101] Mix 10 μL of recombinant plasmid pUC19-ΔBspE and A19 competent cells evenly, place in an ice bath for 1 hour, transfer to an electric shock cup, apply 2.5KV voltage, add TSB culture medium immediately after lightning shock, transfer to a 15mL centrifuge tube, culture at 37℃, 180r / min shaker for 48 hours, spread on a TSA plate containing 25μg / mL kanamycin, and incubate at 37℃ for 72 hours. Pick a single clone colony in TSB culture medium containing 50μg / mL kanamycin, culture to the logarithmic growth phase, spread on a TSA plate containing 10% sucrose, and incubate at 37℃ for 72 hours. Pick a single clone colony in TSB culture medium, culture to logarithmic growth, take 200μL of bacterial solution, inactivate in a 90℃ water bath for 1 hour, use primers BspE-PC-F and BspE-PC-R to perform bacterial solution PCR identification, and screen for BspE gene deletion strains.

[0102] The novel Brucella BspE-deficient vaccine strain constructed by the present invention was evaluated for target animal immune effect, laying the foundation for the creation of the vaccine. Specifically, female BALB / c mice aged 6-8 weeks were selected and randomly divided into 3 groups, namely PBS, Brucella bovis A19 and A19ΔBspE groups. Each mouse in the PBS group was intraperitoneally injected with 200 μL of sterile PBS, and each mouse in the other two groups was intraperitoneally injected with 5×10 Brucella suspensions of Brucella bovis A19 and A19ΔBspE, respectively. 6 CFU / 200μL; 5 mice were randomly selected from each group and weighed and killed at 72h, 1, 2, and 3 weeks after infection; spleens were weighed and fixed in 4% paraformaldehyde for pathological sections. The collected blood was allowed to stand at room temperature for 2h, and the supernatant was collected after centrifugation to detect the level of Brucella IgG antibodies and evaluate the immune effect of the candidate strains of the attenuated deletion vaccine.

[0103] The results of the animal test evaluation of the Brucella A19ΔBspE deletion strain application example are as follows:

[0104] (1) Pathological sections of mouse spleen Fig.11 As shown. The white pulp and red pulp areas of the spleen tissue of mice in the PBS group had clear structures and distinct layers, with occasional hemosiderin deposition; within 3 weeks after infection, the red pulp areas of the spleens of mice in the B. bovis A19 and A19ΔBspE groups had increased erythrocytes, neutrophils, and macrophages in the splenic cords. Example Conclusion: Compared with the B. bovis A19 group, A19ΔBspE had no significant pathological damage changes with the parent strain.

[0105] (2) Results of mouse serum IgG antibody levels Fig.12 As shown, 2 weeks after infection, the level of serum IgG in A19ΔBspE mice was significantly higher than that in bovine Brucella A19. Example Conclusion: Brucella A19ΔBspE deletion vaccine strain significantly increased the level of vaccine immune antibodies, which was better than the parent strain, and the deletion strain optimized the parent strain.

[0106] Method for constructing a Brucella effector protein BspE deletion strain.

[0107] 1. Primer Design

[0108] Homologous recombination and SacB reverse screening techniques were used to construct a Brucella BspE gene deletion strain. Based on the complete genome sequence of the first chromosome of the bovine Brucella A19 strain from NCBI (GenBank accession number: NZ_CP030751.1), Snapgene was used to design primers for the upstream and downstream homologous arms of the BspE gene and primers for deletion strain identification. The primer sequences are shown in Table 1.

[0109] 2. Obtaining the target fragment

[0110] Using the Brucella bovis A19 strain as a template, PCR amplification was performed using primers BspE-up-F / R and BspE-down-F / R. The reaction system was as follows:

[0111] PCR reaction system (25 μl):

[0112] Brucella bovis A19 bacterial solution 3μL

[0113] BspE-up-F / R; BspE-down-F / R1μL

[0114] Primer Star Max Premix 12.5μL

[0115] ddH2O 7.5μL

[0116] PCR reaction procedure:

[0117] Pre-denaturation 98℃10min

[0118] Denaturation 98℃ 10s 30cycle

[0119] Annealing 60℃30s

[0120] Extension 72℃1min

[0121] Extension 72℃10min

[0122] After the PCR reaction was completed, the PCR product was subjected to 1% agarose gel electrophoresis, the specific target band was cut out, and the PCR product was recovered and purified according to the instructions of the agarose gel DNA recovery kit.

[0123] The results are as follows Figure 2 As shown, single bands appeared at 601 bp and 601 bp, respectively, and the sizes were consistent with expectations.

[0124] 3. Obtaining fusion fragments

[0125] The BspE upstream and downstream homology arm fragments recovered and purified in step 2 were used as templates, and primers BspE-up-F and BspE-down-R were used for fusion PCR amplification. The reaction system was as follows:

[0126] PCR reaction system (25 μL):

[0127] 3 μL of BspE upstream and downstream homology arm fragments recovered by gel

[0128] BspE-up-F, BspE-down-R 1μL

[0129] Primer Star Max Premix 12.5μL

[0130] ddH2O 7.5μL

[0131] PCR reaction procedure:

[0132] Pre-denaturation 98℃10min

[0133] Denaturation 98℃ 10s 30cycle

[0134] Annealing 60℃30s

[0135] Extension 72℃1min

[0136] Extension 72℃10min

[0137] After the PCR reaction was completed, the PCR product was subjected to 1% agarose gel electrophoresis, the specific target band was cut out, and the PCR product was recovered and purified according to the instructions of the agarose gel DNA recovery kit.

[0138] The results are as follows Figure 3 As shown, a single band appeared at 1202 bp, and the size was consistent with the expectation.

[0139] 4. Construction of recombinant plasmid pUC19-ΔBspE

[0140] The fusion fragment recovered and purified in step 3 was connected to the pUC19-SacB plasmid to obtain the recombinant plasmid pUC19-ΔBspE. The reaction system is as follows:

[0141] Fusion DNA fragment 8μL

[0142] pUC19-SacB vector 2 μL

[0143] 2×ClonExpress Mix 10μL

[0144] After incubation in a 50°C water bath for 45 minutes, the reaction system was transformed into DH5α competent cells, plated on LA plates containing 50 μg / mL kanamycin, cultured at 37°C for 12 hours, and single colonies were picked and cultured at 37°C and 180 rpm for 12 hours. The plasmid was extracted according to the instructions of the Tiangen Plasmid Extraction Kit to obtain the recombinant plasmid pUC19-ΔBspE. After PCR identification, it was sent to a biological company for sequencing.

[0145] The results are as follows Figure 4 As shown, a specific band appeared at 1202 bp, indicating that the recombinant plasmid was correctly connected.

[0146] 5. Screening and identification of BspE gene deletion strains

[0147] The steps for preparing Brucella competent cells are as follows:

[0148] (1) Brucella bovis A19 vaccine strain frozen at -80°C was streaked onto antibiotic-free TSA solid medium and cultured at 37°C for 72 h;

[0149] (2) Pick a single clone and inoculate it into 15 mL of TSB liquid medium and culture it at 37°C and 180 rpm until the logarithmic growth phase (OD600≈0.6);

[0150] (3) Take the bacterial culture solution that has been cultured to the logarithmic growth phase, place it on ice for 1 h, and centrifuge it at 4°C and 5000 rpm for 5 min to collect the bacterial cells;

[0151] (4) Resuspend the cells in 10 mL of 4°C precooled ddH2O, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, and repeat three times;

[0152] (5) Resuspend the cells in 10 mL of 10% sterile glycerol precooled at 4°C, centrifuge at 4°C and 5000 rpm for 5 min, discard the supernatant, and repeat three times;

[0153] (6) Finally, aspirate the supernatant, resuspend the precipitate with 200 μL of 10% sterile glycerol, divide into two tubes, and place on ice.

[0154] Mix 10 μL of recombinant plasmid pUC19-ΔBspE and A19 competent cells evenly, place in an ice bath for 1 hour, transfer to an electric shock cup, apply 2.5KV voltage, add TSB culture medium immediately after lightning shock, transfer to a 15mL centrifuge tube, culture at 37℃, 180r / min shaker for 48 hours, spread on a TSA plate containing 25μg / mL kanamycin, and incubate at 37℃ for 72 hours. Pick a single clone colony in TSB culture medium containing 50μg / mL kanamycin, culture to the logarithmic growth phase, spread on a TSA plate containing 10% sucrose, and incubate at 37℃ for 72 hours. Pick a single clone colony in TSB culture medium, culture to logarithmic growth, take 200μL of bacterial solution, inactivate in a 90℃ water bath for 1 hour, use primers BspE-PC-F and BspE-PC-R to perform bacterial solution PCR identification, and screen for BspE gene deletion strains.

[0155] PCR reaction system (25 μL):

[0156] Bacterial liquid 3μL

[0157] BspE-PC-F, BspE-PC-R 1μL

[0158] 2×Taq MasterMix 12.5μL

[0159] ddH2O 7.5μL

[0160] PCR reaction procedure;

[0161] Pre-denaturation 98℃10min

[0162] Denaturation 98℃ 10s 30cycle

[0163] Annealing 60℃30s

[0164] Extension 72℃1min

[0165] Extension 72℃10min

[0166] After the above PCR reaction was completed, the PCR product was subjected to 1% agarose gel electrophoresis and the result was observed by gel imaging system. Glycerol with a final concentration of 30% was added to the correctly identified BspE gene-deficient strain of Brucella bovis and stored at -20°C for later use.

[0167] The results are as follows Figure 5 As shown, lane 2, i.e., Brucella bovis A19 strain, showed a specific band at 2414 bp, while specific bands of 2060 bp were amplified in test samples 5 and 7, and the sizes were consistent with expectations, indicating that the BspE gene deletion strain was successfully constructed.

[0168] 6. Effect of BspE gene deletion on the in vitro growth of Brucella

[0169] Brucella bovis A19 and correctly identified A19ΔBspE were streaked on plates and placed in a 37°C constant temperature incubator for 72 hours. Single colonies were picked and inoculated into 15 mL of TSB culture medium and cultured in a constant temperature shaker at 37°C and 180 r / min until the logarithmic growth phase. Brucella bovis A19 and A19ΔBspE were inoculated into conical flasks containing 100 mL of TSB culture medium at a ratio of 1:100, and cultured in a constant temperature shaker at 37°C and 180 r / min. 1 mL of the culture solution was taken every 8 hours and the OD600 of the culture solution was detected by a multifunctional microplate reader until 72 hours.

[0170] The results are as follows Figure 6 As shown, at all measured times, there was no significant difference in the growth trend of A19ΔBspE compared with the bovine Brucella A19 strain, indicating that the knockout of the BspE gene had no effect on the in vitro growth of Brucella.

[0171] 7. Effect of BspE gene deletion on the intracellular survival of Brucella

[0172] RAW264.7 cells were inoculated into 24-well plates at 5×105 / mL. After 12 hours of culture, the counted Brucella bovis A19 and A19ΔBspE were infected with cells at a multiplicity of infection (MOI) of 1:200 and cultured at 37°C, 5% CO2 for 4 hours. Washed with PBS three times, culture solution containing 50μg / mL gentamicin was added, and sterilized in a 37°C, 5% CO2 incubator for 1 hour. Washed with PBS three times, culture solution containing 25μg / mL gentamicin was added, and cultured in a 37°C, 5% CO2 incubator. After 0, 6, 12, 24 and 48 hours, the culture solution was discarded, washed with PBS three times, 0.5% TritonX-100 was added, and the cells were lysed for 10 minutes in a 37°C, 5% CO2 incubator to release bacteria, and the colonies were counted by coating on TSA plates through 10-fold gradient dilution.

[0173] The results are as follows Figure 7 As shown, during all infection time periods, there was no significant difference in the intracellular survival ability of A19ΔBspE compared with the bovine Brucella A19 strain, indicating that the deletion of the BspE gene had no effect on the intracellular survival of Brucella.

[0174] 8. Determination of inflammation-related cytokine TNF-α

[0175] 1) Primer design:

[0176] The GAPDH and TNF-α of the mus species in Gene were searched in NCBI, and the reference sequence numbers were: NC_000072.7 and NC_000083.7, respectively. Then, Snapgene was used to design the upstream and downstream primers of GAPDH and TNF-α, and the sequences are shown in Table 2.

[0177] Table 2

[0178]

[0179] 2) Detect the level of inflammatory factor TNF-α using qPCR and ELISA methods:

[0180] The infection method was the same as step 7. The cell culture supernatant was collected 24 and 48 h after infection, and the secretion level of TNF-α was detected by qPCR and TNF-α ELISA kit, respectively.

[0181] The results are as follows Figure 8 As shown in A, compared with the bovine Brucella A19 group, the mRNA level of TNF-α in the A19ΔBspE group cells was significantly increased, indicating that the BspE gene deletion significantly increased the mRNA level of TNF-α in the cells.

[0182] The results are as follows Figure 8As shown in B, compared with the Brucella bovis A19 group, the level of TNF-α secretion induced by macrophages in the A19ΔBspE group was significantly increased, indicating that the BspE gene deletion significantly promoted the expression level of TNF-α in RAW264.7 cells.

[0183] 9. Effect of BspE gene deletion on the adhesion ability of Brucella

[0184] The cell inoculation and challenge method were the same as step 7, but the MOI was 100. After challenge, the cells were incubated at 37°C and 5% CO2 for 1 hour, washed three times with sterile PBS, lysed with 0.5% Triton X-100, and 10-fold serial dilutions were performed for plating and counting.

[0185] The results are as follows Fig. 9 As shown, compared with bovine Brucella A19, there was no significant difference in the adhesion ability of A19ΔBspE to RAW264.7 cells, indicating that the knockout of BspE had no effect on the intracellular adhesion ability of Brucella.

[0186] 10. Effect of BspE gene deletion on the ability of Brucella to invade RAW264.7 cells

[0187] Cell inoculation, bacterial attack, sterilization and maintenance culture were the same as step 7. After culturing with a culture medium containing 25 μg / mL gentamicin for 1 hour, 0.5% Triton X-100 was added to lyse the cells, and 10-fold serial dilutions were plated and counted.

[0188] The results are as follows Fig.10 As shown, compared with bovine Brucella A19, there was no significant difference in the ability of A19ΔBspE to invade RAW264.7 cells, indicating that the knockout of BspE had no effect on the ability of Brucella to invade cells.

[0189] 11. Mouse infection experiment

[0190] Female BALB / c mice aged 6-8 weeks were selected and randomly divided into 3 groups, 20 mice in each group, namely PBS, Brucella bovis A19 and A19ΔBspE groups. Each mouse in the PBS group was intraperitoneally injected with 200μL of sterile PBS, and each mouse in the other 2 groups was intraperitoneally injected with 5×106CFU / 200μL of Brucella suspension of Brucella bovis A19 and A19ΔBspE, respectively; 5 mice were randomly selected from each group and weighed and killed at 72h, 1, 2, and 3 weeks after infection; spleens were weighed and fixed in 4% paraformaldehyde for pathological sections. The collected blood was allowed to stand at room temperature for 2h, and the supernatant was collected after centrifugation to detect IgG antibody levels.

[0191] Mouse spleen pathological section results Fig.11The white pulp and red pulp areas of the spleen tissue of mice in the PBS group had clear structures and distinct layers, with occasional hemosiderin deposition; within 3 weeks after infection, the red pulp areas of the spleens of mice in the B. bovis A19 and A19ΔBspE groups had increased erythrocytes, neutrophils, and macrophages in the splenic cords, indicating that compared with the B. bovis A19 group, there were no significant changes in the spleen pathological sections of mice in the BspE gene deletion group.

[0192] The results of mouse serum IgG antibody levels are as follows Fig.12 As shown, at 1 week after infection, the level of serum IgG in A19ΔBspE mice was higher than that in the Brucella bovis A19 group, but there was no significant difference between them; at 2 weeks after infection, the level of serum IgG in A19ΔBspE mice was significantly higher than that in the Brucella bovis A19 group; at 3 weeks after infection, there was no significant difference in the level of serum IgG in mice between the Brucella bovis A19 and A19ΔBspE groups, indicating that 2 weeks after infection, the level of serum Brucella IgG antibodies in the A19ΔBspE infection group mice was significantly higher than that in the Brucella bovis A19.

[0193] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A method for constructing a Brucella bovis effector protein BspE gene deletion strain, characterized in that: The following steps are involved: Step 1, designing BspE upstream and downstream homology arm primers and identification primers according to the Brucella bovis genome sequence; Step 2: using the inactivated Brucella bovis A19 strain as a template, amplifying the upstream and downstream homologous arms of the BspE gene with a high-fidelity enzyme, and performing gel recovery after successful verification of the PCR product by electrophoresis; Step 3, using the reaction product of step 2 as a template, using BspE-up-F and BspE-down-R as primers for amplification, and after successful electrophoresis verification, the PCR product is subjected to gel recovery treatment to obtain a BspE upstream and downstream homology arm gene fusion DNA fragment; Step 4: Construction of pUC19-ΔBspE recombinant plasmid: using ClonExpress one-step method, the fusion DNA fragment recovered in step 3 was reacted with pUC19-SacB plasmid; Step 5, construction and screening of A19ΔBspE deletion strain: prepare Brucella bovis A19 competent cells, use primers BspE-PC-F and BspE-PC-R for PCR identification, and screen BspE gene deletion strains.

2. The method for constructing a Brucella bovis effector protein BspE gene deletion strain as claimed in claim 1, characterized in that: The primers in step 1 include: BspE-up-F:ACCTGCAGGCATGCAAGCTTAAAATAGCTGCGGAACGC; BspE-up-R:ATCGAACAGGAGACCAGACCGCCGCACCATGCTGAAGC; BspE-down-F: GCTTCAGCATGGTGCGGCGTCTGGTCTCCTGTTCGAT; BspE-down-R: ACCATGATTACGCCAAGCTTTTTTCGACCGCAATGCAG; BspE-PC-F:AAACAAGGGCGTATCAGCG; BspE-PC-R:AAAACCCCGGACTTTGAAACC.

3. The method for constructing a Brucella bovis effector protein BspE gene deletion strain as claimed in claim 1, characterized in that: The amplification conditions in the step 2 are: pre-denaturation at 98°C for 10 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; extension at 72°C for 10 min; the amplification system for the upstream homologous arm of the BspE gene is 25 μL: Primer StarMax Premix: 12.5 μL; Brucella bovis A19 bacterial liquid: 3 μL; BspE-up-F: 1 μL; BspE-up-R: 1 μL; ddH2O: 7.5 μL; the amplification system for the downstream homologous arm of the BspE gene is 25 μL: Primer StarMax Premix: 12.5 μL; Brucella bovis A19 bacterial liquid: 3 μL; BspE-down-F: 1 μL; BspE-down-R: 1 μL; ddH2O: 7.5 μL.

4. The method for constructing a Brucella bovis effector protein BspE gene deletion strain as claimed in claim 1, characterized in that: The amplification conditions in the step three are: pre-denaturation at 98°C for 10 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles; extension at 72°C for 10 min; the amplification system for the upstream homology arm of the BspE gene is 25 μL: Primer StarMaxPremix: 12.5 μL; template: 3 μL; BspE-up-F: 1 μL; BspE-down-R: 1 μL; ddH2O: 7.5 μL.

5. The method for constructing a Brucella bovis effector protein BspE gene deletion strain as claimed in claim 1, characterized in that: The specific operation process of step 4 is as follows: Ligation system 20μL: step three reaction product: 8μL, pUC19-SacB: 2μL, 2×ClonExpress Mix: 10μL, incubate in a 50℃ water bath for 45min, then transform into E. coli competent cells DH5α, spread on LB plates containing 50μg / mL kanamycin, pick out single clones and transfer to LB liquid culture medium containing 50μg / mL kanamycin, culture at 37℃ with shaking for 12h, take bacterial solution for bacterial solution PCR detection, and send positive bacterial solution to the company for sequencing.

6. The method for constructing a Brucella bovis effector protein BspE gene deletion strain as claimed in claim 1, characterized in that: The specific operation process of step 5 is as follows: A single colony of Brucella bovis A19 with good growth was picked from a non-antibiotic TSA plate, inoculated into 15 mL of TSB liquid medium, and cultured in a constant temperature shaker at 37°C and 180 r / min until the logarithmic growth phase (OD600≈0.6) to prepare Brucella competent cells; The preparation method of competent cells of Brucella bovis is as follows: the Brucella bovis A19 vaccine strain frozen at -80°C is streaked and revived on an antibiotic-free TSA solid culture medium, and cultured at 37°C for 72 hours; a monoclonal colony is picked and inoculated into 15mL TSB liquid culture medium, and cultured at 37°C and 180r / min to the logarithmic growth phase (OD600≈0.6); the bacterial solution cultured to the logarithmic growth phase is taken, ice-bathed for 1h, centrifuged at 4°C and 5000r / min for 5min, and the bacteria are collected; the bacteria are resuspended with 10mL ddH2O precooled at 4°C, centrifuged at 4°C and 5000r / min for 5min, the supernatant is discarded, and the process is repeated three times; the bacteria are resuspended with 10mL 10% sterile glycerol precooled at 4°C, centrifuged at 4°C and 5000r / min for 5min, the supernatant is discarded, and the process is repeated three times; finally, the supernatant is aspirated, the precipitate is resuspended with 200μL 10% sterile glycerol, and the precipitate is divided into two tubes and placed on an ice box.

7. The method for constructing a Brucella bovis effector protein BspE gene deletion strain as claimed in claim 6, characterized in that: Construction and screening method of A19ΔBspE deletion strain: The correctly sequenced recombinant plasmid pUC19-ΔBspE was mixed evenly with A19 competent cells, placed in an ice bath for 1 hour, transferred to an electric shock cup, and a voltage of 2.5KV was applied. TSB culture medium was added immediately after lightning electric shock, transferred to a 15mL centrifuge tube, and cultured in a shaking incubator at 37°C and 180r / min for 48 hours. After recovery, it was spread on a TSA plate containing 25μg / mL kanamycin and cultured at 37°C for 3 hours. days; pick a single colony and place it in TSB liquid culture medium containing 50 μg / mL kanamycin, culture it to the logarithmic growth phase, spread it on a TSA plate containing 10% sucrose, and culture it at 37°C for 3 days; pick a single clone colony in TSB culture medium, culture it to logarithmic growth, take 200 μL of bacterial solution, inactivate it in a 90°C water bath for 1 hour, use primers BspE-PC-F and BspE-PC-R to perform bacterial solution PCR identification, and screen for BspE gene deletion strains.

8. A method for using the BspE gene-deficient strain constructed by the method for constructing the bovine Brucella effector protein BspE gene-deficient strain as described in any one of claims 1 to 7 in preparing a vaccine for preventing Brucella infection, characterized in that: The application method includes: The BspE gene deletion strain is used to establish a Brucella infection model, and the effect of the deletion strain on the host immune system is observed. Specifically, its immunological effect is evaluated by measuring the cytokine level, antibody production and T cell proliferation activity in the host immune response.

9. The method for using the bovine Brucella effector protein BspE gene deletion strain in vaccine development as claimed in claim 1, characterized in that: The BspE gene-deficient strain is used as an attenuated vaccine strain for the prevention of bovine Brucella infection, and the protective effect and safety of the vaccine strain after immunization are specifically evaluated through experiments.

10. The method for using the bovine Brucella effector protein BspE gene deletion strain in drug screening according to claim 1, characterized in that: An in vitro Brucella infection model was constructed using the BspE gene deletion strain to screen antimicrobial drugs for Brucella infection. Drug screening was performed specifically by measuring the effect of drugs on the growth inhibition of the deletion strain.

Images