Protein expression system and application thereof

Abstract

The invention provides a protein expression system and application thereof, the protein expression system at least comprises a recombinant expression vector and Escherichia fagenii for transforming the recombinant expression vector, and the recombinant expression vector comprises a target protein gene segment and a pUC57 vector segment. The research finds that the same type of plasmids have significant expression difference in the Escherichia fagenii, for example, the target protein amount expressed by the pUC57 plasmid is significantly higher than that expressed by the pUC19 plasmid, then the pUC57 plasmid and the Escherichia fagenii are combined to form a protein expression system, the protein expression system has a better expression effect on the target protein, and the expression efficiency of the protein expression system is improved. The method has the advantages of simple operation, no need of extra inducers, reduction of the production cost of recombinant proteins, substantial improvement of the yield and enzyme activity of target proteins, and provision of more choices for the production of biological pharmacy, diagnostic reagents and industrial enzymes.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a protein expression system and its applications. Background Technology

[0002] In the fields of genetic engineering and biotechnology, selecting appropriate plasmid and host strain combinations is crucial for improving protein expression efficiency. *Escherichia coli* is widely used as a host strain for recombinant protein expression, typically in conjunction with pUC series plasmids, which possess high copy numbers and relaxed replication characteristics. However, current research lacks studies on optimizing protein expression of similar plasmids in emerging host strains such as *Escherichia coli*, making it impossible to determine whether similar plasmids exhibit similar effects in *Escherichia coli*. Summary of the Invention

[0003] In view of this, the purpose of this invention is to study the expression effect of pUC series plasmids in Escherichia coli, and to explore protein expression systems based on Escherichia coli and their applications.

[0004] To achieve the above technical objectives, the technical solution adopted in this application is as follows:

[0005] In a first aspect, the present invention provides a protein expression system, the protein expression system comprising at least: a recombinant expression vector, and Escherichia coli for transforming the recombinant expression vector, the recombinant expression vector comprising a target protein gene fragment and a pUC57 vector fragment.

[0006] Preferably, the target protein gene fragment is obtained by PCR amplification of the target protein gene; and / or, the pUC57 vector fragment is obtained by PCR amplification of the pUC57 vector.

[0007] Preferably, the primer pairs for amplifying the pUC57 vector are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

[0008] In a second aspect, the present invention provides the application of the protein expression system described in the first aspect in the production of proteins in eukaryotic and / or prokaryotic and / or cell-free systems.

[0009] Thirdly, the present invention provides a method for protein production using the protein expression system described in the first aspect, the method comprising:

[0010] Step 1: Design primer pairs for the target protein gene and the pUC57 vector respectively, and perform PCR amplification of the target protein gene and the pUC57 vector respectively using their respective primer pairs. Assemble the amplified target protein gene fragment and pUC57 vector fragment to construct a recombinant expression vector.

[0011] Step 2: Transform the recombinant expression vector obtained in Step 1 into Escherichia coli Fergusonii.

[0012] Preferably, the primer pairs for amplifying the pUC57 vector are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

[0013] Preferably, the method further includes: culturing the transformed colonies obtained in step 2.

[0014] More preferably, the culture conditions are: temperature 25-35℃, system rotation speed 180-300 rpm.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The protein expression system of this invention is based on the existing Escherichia coli prokaryotic expression system. Further research was conducted on the expression of similar plasmids in *Escherichia coli* and a protein expression system based on *Escherichia coli* was developed. The study revealed significant expression differences between similar plasmids in *Escherichia coli*. For example, the pUC57 plasmid expressed a significantly higher amount of the target protein than the pUC19 plasmid. Therefore, the pUC57 plasmid and *Escherichia coli* were combined to form a protein expression system. This system exhibits better expression of the target protein without the need for additional inducers. It not only reduces the production cost of recombinant proteins but also significantly increases the yield and enzyme activity of the target protein, providing more options for the production of biopharmaceuticals, diagnostic reagents, and industrial enzymes. Attached Figure Description

[0017] Figure 1 The images show the pUC57 and pUC19 plasmids used in this embodiment of the invention, where A is the pUC57 plasmid and B is the pUC19 plasmid.

[0018] Figure 2 The images shown are SDS-PAGE gel images from Example 1 of this invention. Image a is an SDS-PAGE gel image with CK added as a reference: 1: CK (E. coli K12); 2: K12-puc19-GuaA; 3: K12-puc57-GuaA; 4: Ef-puc19-GuaA; 5: Ef-puc57-GuaA; Image b is an SDS-PAGE gel image with Ef added as a reference.

[0019] Figure 3 This is a bar chart of fluorescence intensity in Example 2 of the present invention. Detailed Implementation

[0020] The pUC57 and pUC19 plasmids used in this embodiment of the invention are commercially available products, and their plasmid maps are shown below. Figure 1 As shown.

[0021] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0022] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0023] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0024] Example 1:

[0025] This embodiment uses *Escherichia coli* K12 and *Escherichia coli* Fergusonii (ATCC 35469, commercially available product, hereinafter referred to as Ef) as host strains to investigate the expression differences of two different plasmids, pUC57 and pUC19, for the target protein xanthocyanidase in the two host bacteria, as detailed below:

[0026] Step 1: Select the gene sequence of the target protein flavinylaminease GuaA (e.g., SEQ ID NO.1), and design and synthesize homologous arm primer pairs SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.6, SEQ ID NO.7 based on this sequence; wherein SEQ ID NO.2 and SEQ ID NO.3 contain the pUC19 vector homologous arm fragment (as underlined in the sequence), and SEQ ID NO.6 and SEQ ID NO.7 contain the pUC57 vector homologous arm fragment (as underlined in the sequence).

[0027] SEQ ID NO.1

[0028] ATGACGGAAAACATTCATAAGCATCGCATCCTCATTCTGGACTTCGGTTCTCAGTACAC

[0029] TCAACTGGTTGCGCGCCGCGTGCGTGAGCTGGGTGTTTACTGCGAACTGTGGGCGTGG

[0030] GATGTGACAGAAGCACAAATTCGTGACTTCAATCCAAGCGGCATTATTCTTTCCGGCG

[0031] GCCCGGAAAGTACTACTGAAGAAAACAGTCCGCGTGCGCCGCAGTATGTCTTTGAAGC

[0032] AGGCGTACCGGTATTCGGCGTTTGCTATGGCATGCAGACCATGGCAATGCAGTTGGGC

[0033] GGTCACGTTGAAGCCTCTAACGAACGTGAATTTGGCTACGCGCAGGTTGAAGTCGTAA

[0034] ACGACAGCGCACTGGTTCGCGGTATCGAAGATGCGCTGACCGCAGACGGTAAACCGCT

[0035] GCTCGATGTCTGGATGAGCCACGGCGATAAAGTTACCGCTATTCCGTCCGACTTCATCA

[0036] CCGTAGCCAGCACCGAAAGCTGCCCGTTTGCCATTATGGCTAACGAAGAAAAACGCTT

[0037] CTATGGCGTACAGTTCCACCCGGAAGTGACTCATACCCGCCAGGGTATGCGCATGCTG

[0038] GAGCGTTTTGTGCGTGATATCTGCCAGTGTGAAGCCCTGTGGACGCCAGCGAAAATTA

[0039] TCGACGATGCTGTAGCTCGCATCCGCGAGCAGGTAGGCGACGATAAAGTCATCCTCGG

[0040] CCTCTCTGGTGGTGTGGATTCCTCCGTAACCGCAATGCTGCTGCACCGCGCTATCGGTA

[0041] AAAACCTGACTTGCGTATTCGTCGACAACGGCCTGCTGCGCCTCAACGAAGCAGAGCA

[0042] GGTTCTGGATATGTTTGGCGATCACTTTGGTCTTAACATTGTTCACGTACCGGCAGAAG

[0043] ATCGCTTCCTGTCAGCGCTGGCTGGCGAAAACGATCCGGAAGCAAAACGTAAAATCAT

[0044] CGGTCGCGTTTTCGTTGAAGTATTCGATGAAGAAGCGCTGAAACTGGAAGACGTGAAG

[0045] TGGCTGGCGCAGGGCACCATCTACCCTGACGTTATCGAATCTGCGGCGTCTGCAACCG

[0046] GTAAAGCACACGTCATCAAATCTCACCACAACGTGGGCGGCCTGCCGAAAGAGATGAA

[0047] GATGGGCCTGGTTGAACCGCTGAAAGAGCTGTTCAAAGACGAAGTGCGTAAGATTGGT

[0048] CTGGAGCTGGGCCTGCCGTACGACATGCTGTACCGTCACCCGTTCCCGGGACCAGGCC

[0049] TTGGCGTTCGTGTTCTGGGTGAAGTGAAGAAAGAGTACTGTGACCTGCTGCGCCGTGCT

[0050] GACGCCATCTTCATTGAAGAACTGCGTAAAGCGGACCTGTACGACAAAGTCAGCCAGG

[0051] CGTTCACTGTGTTCCTGCCGGTACGTTCCGTTGGCGTAATGGGCGATGGTCGTAAGTAT

[0052] GACTGGGTTGTCTCTCTGCGTGCTGTCGAAACCATCGACTTTATGACCGCACACTGGGC

[0053] GCATCTGCCGTACGATTTCCTCGGTCGCGTTTCCAACCGCATTATCAATGAAGTGAACG

[0054] GTATTTCCCGCGTGGTGTATGACATCAGCGGCAAGCCGCCAGCTACCATTGAGTGGGAATGA.

[0055] SEQ ID NO.2(puc19-GF)

[0056] TGCCTGCAGGT ATGACGGAAAACATTCATAAGC.

[0057] SEQ ID NO.3(puc19-GR)

[0058] CCTCTAGAGTCG TCATTCCCACTCAATGGTAGC.

[0059] SEQ ID NO.6(puc57-GF)

[0060] GGCCTCTGCAGT ATGACGGAAAACATTCATAAGC.

[0061] SEQ ID NO.7(puc57-GR)

[0062] CCGGGCCCGTCG TCATTCCCACTCAATGGTAGC.

[0063] Step 2: Using the xanthine ammonia-transferase gene as a template, and in the presence of high-fidelity DNA polymerase KOD one, PCR amplification was performed using primer pairs SEQ ID NO.2 and SEQ ID NO.3 to obtain the xanthine ammonia-transferase gene fragment containing the pUC19 vector fragment; simultaneously, PCR amplification was performed using primer pairs SEQ ID NO.6 and SEQ ID NO.7 to obtain the xanthine ammonia-transferase gene fragment containing the pUC57 vector fragment.

[0064] Step 3: Using the pUC19 vector as a template, amplify the pUC19 vector fragment using primer pairs SEQ ID NO.4 and SEQ ID NO.5; simultaneously, using the pUC57 vector as a template, amplify the pUC57 vector fragment using primer pairs SEQ ID NO.8 and SEQ ID NO.9.

[0065] SEQ ID NO.4(puc19-F)

[0066] CGACTCTAGAGGATCCCCGG.

[0067] SEQ ID NO.5(puc19-R)

[0068] ACCTGCAGGCATGCAAG.

[0069] SEQ ID NO.8 (puc57-F)

[0070] CGACGGGCCCGGGA.

[0071] SEQ ID NO.9(puc57-R)

[0072] ACTGCAGAGGCCTGCATG.

[0073] Step 4: Use Hieff The Plus One Step Cloning Kit allows for the cloning and assembly of two amplified xanthocyanidin ammonia-transferase gene fragments with their corresponding pUC19 and pUC57 vector fragments, respectively, to construct pUC19-GuaA and pUC57-GuaA recombinant plasmids.

[0074] Step 5: Prepare competent cells of *Escherichia coli* K12 and *Escherichia coli* Fergusonia to improve the conversion efficiency of cells to foreign DNA; use the heat shock method to transform recombinant plasmids pUC19-GuaA and pUC57-GuaA into competent cells of *Escherichia coli* K12 and *Escherichia coli* Fergusonia, respectively; culture on LB solid medium plates containing 100 μg / mL ampicillin, and screen for positive clones containing recombinant plasmids.

[0075] Step 6: Pick the transformed colonies and culture them in a small amount in 3 mL LB liquid medium containing 100 μg / mL ampicillin. Incubate overnight at 37°C and 200 rpm. Extract plasmid DNA and use primer pairs (SEQ ID NO.10 and SEQ ID NO.11) for sequencing to verify the correctness of the recombinant plasmid.

[0076] SEQ ID NO.10 (puc19-Identification Primer-F)

[0077] CAGGAAACAGCTATGAC.

[0078] SEQ ID NO.11 (puc57-identification primer-F)

[0079] GTAAAACGACGGCCAGT.

[0080] Step 7: The verified recombinant strain was cultured for protein expression in 50 mL of LB liquid medium containing 100 μg / mL ampicillin at 28°C and 200 rpm for 24 hours.

[0081] Step 8: Collect the cultured bacterial cells, resuspend the bacterial cells in lysis buffer (50mM Tris-HCl, pH 8.0), add 100mM lysozyme and 100mM protease inhibitor, break the bacterial cells by ultrasonic disruption, centrifuge at 12000rpm for 10 minutes, and collect the supernatant.

[0082] Step 9: Prepare a 12% SDS-PAGE gel and denature the collected supernatant protein sample to allow the protein to fully develop; load the treated protein sample onto the SDS-PAGE gel for electrophoretic separation; stain the gel with Coomassie Brilliant Blue to display the target protein xanthine ammonia-transferase band; quantitatively analyze the differences in expression levels among different host strains based on the intensity of the target protein band.

[0083] Step 10: Compare the expression levels of the target protein xanthine aminotransferase in *Escherichia coli* K12 and *Escherichia coli* Fergusonia using different plasmids, based on SDS-PAGE results (e.g., ...). Figure 2 As shown in the figure, the plasmid and host strain with the highest expression level were selected for the expression of xanthocyanidin, with the target band size of xanthocyanidin being 57KD.

[0084] Step 11: Determination of XMP aminoase activity. Enzyme activity was determined using the Sakamoto method with slight modifications. *E. coli* and *Escherichia coli* cells with different plasmids were collected by centrifugation, then suspended in 1 / 10 volume of water. Toluene was added at a concentration of 20 mL / L, and the mixture was shaken at 28°C for 20 min. The activity was then measured. The reaction mixture consisted of 160 mM Tris-HCl (pH 8.6), 12 mM ATP, 23 mM XMP, 16 mM MgSO4·7H2O, 40 mM (NH4)2SO4, and the toluene-treated cells, adjusted to a total volume of 5 mL. The reaction mixture was shaken in a test tube at 42°C for 15 min. 0.1 mL of the mixture was then mixed with 3.9 mL of 3.5% perchloric acid and analyzed by liquid chromatography (HPLC). The HPLC conditions were as follows: C18 column, 5 μm, 4.6 x 250 mm; detection speed, 254 nm; mobile phase: 0.5% sodium dihydrogen phosphate buffer solution and methanol; column temperature, 30°C; flow rate, 1.0 mL / min. Under these conditions, the amount of GMP generated reflects the activity of XMP ammonialase. One enzyme unit is defined as the amount of enzyme that catalyzes the formation of 1 μmol of GMP molecules per minute under the above conditions. Enzyme activity U = amount of GMP generated / reaction time.

[0085] Step 12: Data Analysis and Results Summary

[0086] The expression levels of target proteins using different plasmids (pUC19 and pUC57) in *Escherichia coli* K12 and *Escherichia coli* Fergusonian (Ef) were compared. In *E. coli* K12, the protein expression levels of the pUC series plasmids were similar; however, in *E. coli* Fergusonian, the pUC57 plasmid showed a higher protein expression level. Simultaneously, the enzyme activity assay results are shown in Table 1. In *E. coli* K12, the enzyme activity results obtained using the pUC series plasmids were largely similar, while in *E. coli* Fergusonian (Ef), the enzyme activity results obtained using the pUC series plasmids differed by more than 40%, a trend similar to that of the protein expression results. Based on the SDS-PAGE and enzyme activity assay results, subsequent experiments can select the plasmid and host strain combination with the highest protein expression level.

[0087] Table 1. XMP aminotransferase activities of strains carrying different plasmids

[0088]

[0089] Example 2:

[0090] This embodiment uses *Escherichia coli* K12 and *Escherichia coli* Fergusonia as host strains to investigate the expression differences of two different plasmids, pUC57 and pUC19, targeting the green fluorescent protein in the two host bacteria, as detailed below:

[0091] Step 1: Obtain the gene sequence information (SEQ ID NO. 12) of the target protein, green fluorescent protein (GFP), from the gene database. Based on this sequence, design and synthesize homologous arm primer pairs SEQ ID NO. 13 and SEQ ID NO. 14, as well as homologous arm primer pairs SEQ ID NO. 15 and SEQ ID NO. 16. Among them, SEQ ID NO. 13 and SEQ ID NO. 14 contain the pUC19 vector homologous arm fragment (underlined in the sequence below), and SEQ ID NO. 15 and SEQ ID NO. 16 contain the pUC57 vector homologous arm fragment (underlined in the sequence below).

[0092] SEQ ID NO.12 Green fluorescent protein gene (GFP)

[0093] ATGCGTAAAGGCGAAGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATG

[0094] GTGATGTCAACGGTCATAAGTTTTCCGTGCGTGGCGAGGGTGAAGGTGACGCAACTAA

[0095] TGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGA

[0096] CTCTGGTAACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATG

[0097] AAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGCTATGTGCAGGAACGCACGA

[0098] TTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGA

[0099] TACCCTGGTAAACCGCATTGAGCTGAAAGGCATTGACTTTAAAGAAGACGGCAATATC

[0100] CTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAATGTTTACATCACCGCCGATA

[0101] AACAAAAAAATGGCATTAAAGCGAATTTTAAAATTCGCCACAACGTGGAGGATGGCA

[0102] GCGTGCAGCTGGCTGATCACTACCAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTG

[0103] CTGCCAGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCGAACGAGA

[0104] AACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAGCGGGCATCACGCATGGTATGGATGAACTGTACAAATGA。

[0105] SEQ ID NO.13(puc19-GFP-F)

[0106] TGCCTGCAGGT ATGCGTAAAGGCGAAGA。

[0107] SEQ ID NO.14(puc19-GFP-R)

[0108] CCTCTAGAGTCG TCATTTGTACAGTTCATCC.

[0109] SEQ ID NO.15(puc57-GFP-F)

[0110] GGCCTCTGCAGT ATGCGTAAAGGCGAAGAGCT.

[0111] SEQ ID NO.16(puc57-GFP-R)

[0112] CCGGGCCCGTCG TCATTTGTACAGTTCATCC.

[0113] Step 2: Using the synthesized GFP gene as a template, in the presence of the high-fidelity DNA polymerase Phusion, PCR amplification was performed using primer pairs SEQ ID NO.13 and SEQ ID NO.14 to obtain a GFP gene fragment containing the pUC19 vector fragment; simultaneously, PCR amplification was performed using primer pairs SEQ ID NO.15 and SEQ ID NO.16 to obtain a GFP gene fragment containing the pUC57 vector fragment.

[0114] Step 3: Using the pUC19 vector as a template, amplify the pUC19 vector fragment using primer pairs SEQ ID NO.4 and SEQ ID NO.5; simultaneously, using the pUC57 vector as a template, amplify the pUC57 vector fragment using primer pairs SEQ ID NO.8 and SEQ ID NO.9.

[0115] Step 4, Use The HD Cloning Kit is used to clone and assemble the two amplified GFP gene fragments with their corresponding pUC19 and pUC57 vector fragments to construct pUC19-GFP and pUC57-GFP recombinant plasmids.

[0116] Step 5: Prepare competent cells of Escherichia coli K12 and Escherichia coli Fergusonia to improve the conversion efficiency of cells to foreign DNA; use electroporation to transform recombinant plasmids pUC19-GFP and pUC57-GFP into competent cells of Escherichia coli K12 and Escherichia coli Fergusonia, respectively; culture on LB solid medium plates containing 50 μg / mL kanamycin and screen for positive clones containing recombinant plasmids.

[0117] Step 6: Pick the transformed colonies and culture them in 5 mL of LB liquid medium containing 50 μg / mL kanamycin overnight at 30°C and 220 rpm. Extract plasmid DNA and use primer pairs SEQ ID NO.10 and SEQ ID NO.11 to sequence and verify that the recombinant plasmid is correct.

[0118] Step 7: The verified recombinant strain was cultured for protein expression in 100 mL of LB liquid medium containing 50 μg / mL kanamycin at 30°C and 220 rpm for 16 hours.

[0119] Step 8: Dilute the bacterial culture, adjust the OD to 0.6-0.8, and use a fluorescence spectrophotometer to measure the GFP fluorescence intensity in the bacterial culture to quantitatively analyze the differences in expression levels among different host strains;

[0120] Step 9: In this embodiment, the expression efficiency of pUC19 and pUC57 plasmids in different host strains was evaluated by fluorescence intensity analysis, and the results are as follows: Figure 3 As shown, in *E. coli* K12, the fluorescence intensities of pUC19 and pUC57 plasmids exhibited similar levels. However, in *Escherichia coli* Fergusonian, the pUC57 plasmid showed a significantly higher fluorescence intensity. This finding is consistent with the results of Example 1, indicating that the expression efficiency of the pUC series plasmids varies significantly across different host strains. Taken together, these results clearly demonstrate that the pUC57 plasmid has higher expression efficiency in *Escherichia coli* Fergusonian and is therefore more suitable for application in this host.

[0121] Example 3:

[0122] This embodiment uses *Escherichia coli* K12 and *Escherichia coli* Fergusonia as host strains to investigate the expression differences of two different plasmids, pUC57 and pUC19, targeting the protein polyphosphate kinase (PPK) in the two host bacteria. PPK can catalyze the transfer of the terminal phosphate group of polyphosphate to the hydroxyl group of AMP, thereby giving AMP two phosphate groups and converting it into ATP. Details are as follows:

[0123] Step 1: Select the target polyphosphate kinase (PPK) gene sequence information (SEQ ID NO.17), and design and synthesize homologous arm primer pairs SEQ ID NO.18, SEQ ID NO.19, and homologous arm primer pairs SEQ ID NO.20, SEQ ID NO.21 based on this sequence; wherein SEQ ID NO.18 and SEQ ID NO.19 contain the pUC19 vector homologous arm fragment (as underlined in the sequence), and SEQ ID NO.20 and SEQ ID NO.21 contain the pUC57 vector homologous arm fragment (as underlined in the sequence).

[0124] SEQ ID NO.17 Polyphosphate kinase (PPK)

[0125] ATGGCGACTGATTTCTCTAAACTGTCCAAATACGTTGAAACCCTGCGTGTAAAGCCGA

[0126] AACAGTCTATCGATCTGAAGAAAGACTTCGATACCGACTATGATCACAAGATGCTGAC

[0127] TAAAGAAGAAGGTGAAGAACTGCTGAACCTGGGCATCTCCAAACTGTCCGAAATCCAA

[0128] GAGAAACTGTACGCATCTGGTACTAAATCTGTGCTGATCGTATTCCAGGCTATGGATGC

[0129] GGGTGGTAAAGACGGCACTGTCAAACACATCATGACTGGTCTGAATCCACAGGGTGTT

[0130] AAAGTTACTAGCTTCAAAGTTCCGTGCAAATTCGAACTGAGCCACGACTACCTGTGGC

[0131] GTCACTACGTTGCTTTGCCAGCGACTGGTGAAATCGGTATCTTCAACCGTTCTCATTAC

[0132] GAGAACGTTCTGGTTACCCGTGTTCATCCGGAATACCTGCTGTCTGAACAGACCTCTGG

[0133] TGTTACCGCTATCGAACAGGTGAACCAGAAATTCTGGGACAAACGTTTCCAGCAGATC

[0134] AACAACTTCGAACAGCACATCTCCGAGAACGGTACCATCGTTCTGAAATTCTTTCTGCA

[0135] CGTTTCCAAGAAAGAACAGAAGAAACGCTTCATCGAACGTATCGAACTGGACACCAAG

[0136] AACTGGAAATTCTCCACCGGTGATCTGAAAGAACGTGCTCACTGGAAAGACTACCGTA

[0137] ACGCTTACGAAGATATGCTGGCAAACACCTCTACCAAACAGGCACCGTGGTTCGTTAT

[0138] TCCAGCGGATGACAAATGGTTCACTCGTTTGCTGATCGCAGAAATCATCTGTACCGAAC

[0139] TGGAGAAACTGAACCTGACCTTTCCGACTGTTTCTCCGGAACAGAAAGCTGAACTGGA

[0140] GAAAGCGAAAGCGGAACTGGTTGCGGAGAAATCCAGCGATCACCACCACCACCACTAA。

[0141] SEQ ID NO.18(puc19-PPK-F)

[0142] TGCCTGCAGGT ATGGCGACTGATTTCTCTAAACT。

[0143] SEQ ID NO.19(puc19-PPK-R)

[0144] CCTCTAGAGTCG TTAGTGGTGGTGGTGGTGAT。

[0145] SEQ ID NO.20(puc57-PPK-F)

[0146] GGCCTCTGCAGT ATGGCGACTGATTTCTCTAAACT。

[0147] SEQ ID NO.21(puc57-PPK-R)

[0148] CCGGGCCCGTCG TTAGTGGTGGTGGTGGTGAT。

[0149] Step 2: Using the polyphosphate kinase gene as a template, in the presence of the high-fidelity DNA polymerase Phusion, PCR amplification was performed using primer pairs SEQ ID NO.18 and SEQ ID NO.19 to obtain the polyphosphate kinase (PPK) gene fragment containing the pUC19 vector fragment; simultaneously, PCR amplification was performed using primer pairs SEQ ID NO.20 and SEQ ID NO.21 to obtain the polyphosphate kinase (PPK) gene fragment containing the pUC57 vector fragment;

[0150] Step 3: Using the pUC19 vector as a template, amplify the pUC19 vector fragment using primer pairs SEQ ID NO.4 and SEQ ID NO.5; simultaneously, using the pUC57 vector as a template, amplify the pUC57 vector fragment using primer pairs SEQ ID NO.8 and SEQ ID NO.9.

[0151] Step 4, Use The HD Cloning Kit was used to clone and assemble the two amplified polyphosphate kinase gene fragments with the corresponding pUC19 and pUC57 vector fragments to construct pUC19-PPK and pUC57-PPK recombinant plasmids.

[0152] Step 5: Prepare competent cells of *Escherichia coli* K12 and *Escherichia coli* Fergusonia to improve the transformation efficiency of exogenous DNA; use electroporation to transform recombinant plasmids pUC19-PPK and pUC57-PPK into competent cells of *E. coli* K12 and *E. coli* Fergusonia, respectively; culture on LB agar plates containing 50 μg / mL kanamycin and screen for positive clones containing recombinant plasmids;

[0153] Step 6: Pick the transformed colonies and culture them in 5 mL of LB liquid medium containing 50 μg / mL kanamycin overnight at 37°C and 220 rpm. Extract plasmid DNA and use primer pairs (SEQ ID NO.10 and SEQ ID NO.11) to sequence and verify that the recombinant plasmid is correct.

[0154] Step 7: Inoculate the verified recombinant strain into 100 mL of LB liquid medium containing 50 μg / mL kanamycin and incubate at 30°C and 220 rpm for 16 hours for protein expression. Collect 1 g (wet weight) of bacterial pellet, resuspend in 4 mL of PBS buffer and vortex to mix. Add a mixture of lysozyme solution and protease inhibitor at a volume ratio of 100:1, and incubate on ice for 30 min, gently inverting to mix during incubation. Then sonicate (10 s sonication followed by 10 s intervals, for a total of 10 min). Finally, centrifuge at 4°C and 12000 rpm for 10 min to remove impurities. The supernatant is the cell lysis supernatant and can be stored at -20°C or -80°C for later use.

[0155] Step 8: The cell lysis supernatant, 1.6 g / L PPA, 2.25 mM AMP, and 10 mM MgCl2 were mixed in 10 mL of potassium phosphate buffer (50 mM, pH 7.5). The reaction mixture was incubated at 37 °C and then quenched by adding 10 mL of 0.2 M H₃PO₄. The levels of adenosine triphosphate (ATP) and adenine ribonucleotide (AMP) in the termination reaction mixture were analyzed by high-performance liquid chromatography (HPLC). HPLC was performed at a flow rate of 1 mL / min, with UV detection at 254 nm. The mobile phase was potassium phosphate buffer (50 μmol / L, pH 7.5), and the injection volume was 20 μL.

[0156] Step 9: Data Analysis and Results Summary

[0157] In this embodiment, *Escherichia coli* K12 and *Escherichia coli* Ef were used as host strains to express polyphosphokinase (PPK) via the pUC series plasmids. The reaction conditions were as shown in step 8, and AMP and ATP concentrations were analyzed by high-performance liquid chromatography (HPLC) after incubation. According to the experimental results in Table 2, in *Escherichia coli* Ef, when expressing PPK using the pUC57 plasmid, ATP production was higher if the amount of cell lysis buffer added was kept constant. This phenomenon suggests that the pUC57 plasmid may have a more efficient advantage for heterologous PPK expression in this host strain.

[0158] Table 2 HPLC concentrations of AMP and ATP

[0159]

[0160]

[0161] In summary, this invention, through studying the expression of enzyme activity and the yield of certain active ingredients by the same type of plasmid in *E. coli* and *Escherichia coli* Fergusoniana*, discovered significant expression differences between the same type of plasmid in *E. coli*, with the pUC57 plasmid expressing a significantly higher amount of the target protein than the pUC19 plasmid. Therefore, a highly efficient protein expression system was obtained. This system differs significantly from existing *E. coli* expression systems, specifically in that the pUC19 plasmid expresses a significantly higher amount of the target protein than the pUC57 plasmid in *E. coli* K12. Furthermore, the optimization strategy proposed in this invention provides researchers with a clear selection basis for the efficient and rational application of the same type of plasmid in different expression systems, avoiding the blindness of traditional trial-and-error methods and improving the success rate and efficiency of protein expression.

[0162] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A protein expression system, characterized in that, The protein expression system includes at least: a recombinant expression vector and Escherichia coli Fergusonii for transforming the recombinant expression vector, wherein the recombinant expression vector includes a target protein gene fragment and a pUC57 vector fragment.

2. The protein expression system according to claim 1, characterized in that, The target protein gene fragment is obtained by PCR amplification of the target protein gene; and / or, the pUC57 vector fragment is obtained by PCR amplification of the pUC57 vector.

3. The protein expression system according to claim 2, characterized in that, The primer pairs for amplifying the pUC57 vector are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

4. The use of the protein expression system according to any one of claims 1 to 3 in the production of proteins in eukaryotes and / or prokaryotes and / or cell-free systems.

5. A method for protein production using the protein expression system according to any one of claims 1 to 3, characterized in that, The method includes: Step 1: Design primer pairs for the target protein gene and the pUC57 vector respectively, and perform PCR amplification of the target protein gene and the pUC57 vector respectively using their respective primer pairs. Assemble the amplified target protein gene fragment and pUC57 vector fragment to construct a recombinant expression vector. Step 2: Transform the recombinant expression vector obtained in Step 1 into Escherichia coli Fergusonii.

6. The method according to claim 5, characterized in that, The primer pairs for amplifying the pUC57 vector are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

7. The method according to claim 5 or 6, characterized in that, The method further includes the process of culturing the transformed colonies obtained in step 2.

8. The method according to claim 7, characterized in that, The controlled conditions for transforming colony culture were: temperature 25–35℃ and rotation speed 180–300 rpm.

Images