Plasmid vector pSY1A for wheat germ cell-free expression system, transformant and application thereof
By designing the pSY1A plasmid vector and optimizing the restriction enzyme sites and PCR primers, the problems of cumbersome experimental procedures and low efficiency in cell-free expression systems were solved, and efficient exogenous gene expression was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2026-06-26
AI Technical Summary
In existing cell-free protein synthesis systems, the two-step PCR method is cumbersome and cannot achieve efficient expression of gene sequences with poor PCR performance, thus affecting work efficiency.
A pSY1A plasmid vector for a cell-free expression system in wheat embryos was designed, containing an ampicillin resistance gene, an Ori replicon, a T7 promoter, a translation enhancer, an MCS multiple cloning site, a 3'-UTR sequence, and a T7 terminator. PCR primers were optimized by using restriction enzyme sites to simplify the experimental procedure and improve reproducibility.
With sufficient plasmids, experimental time is shortened, reproducibility is good, gene sequences with poor PCR performance can be optimized, and efficient cell-free expression can be achieved.
Smart Images

Figure CN121518520B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to plasmid vectors, transformants, and their applications for cell-free expression systems in wheat embryos. Background Technology
[0002] Cell-free protein synthesis (CFPS) systems are a rapid and high-throughput technique for expressing target proteins. They utilize exogenous DNA or mRNA as templates, and with the aid of various enzymes provided by cell lysates, supplemented with substrates and energy, proteins are synthesized in vitro. Currently, CFPS systems mainly include four types: E. coli lysate, rabbit reticulocyte lysate, wheat germ extract, and yeast extract.
[0003] Wheat Germ Extract (WGE) is a well-processed and optimized wheat germ extract. It contains cellular components essential for protein synthesis (tRNA, ribosomes, and initiation, elongation, and termination factors). This extract stimulates the efficiency of chain elongation by supplementing the energy regeneration system (creatine phosphokinase / creatine phosphokinase) and spermidine.
[0004] In vitro transcription is a crucial step for successful cell-free expression. Before transcription, the target gene sequence needs to be modified by introducing auxiliary sequences that enhance transcription and translation, such as transcription promoters, translation enhancers, and terminators, to ensure that transcription and translation can proceed more smoothly.
[0005] Currently, the introduction of helper sequences is mostly performed using a two-step PCR method. The advantage of this method is that it can rapidly complete the entire cell-free expression process for novel target genes. The disadvantage is that most cell-free expression processes require optimization, and for target gene sequences with poor PCR performance, cell-free expression may not even be possible. If optimization of the target gene expression conditions is required, the two-step PCR method must be used for an extended period, making the experimental process overly cumbersome and directly impacting work efficiency. Summary of the Invention
[0006] The purpose of this invention is to provide a pSY1A plasmid vector, transformant, and its application for a cell-free expression system in wheat embryos, which can solve the problems mentioned in the background art.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] The pSY1A plasmid vector for the cell-free expression system in wheat embryos includes an ampicillin resistance gene, an Ori replicon, a T7 promoter, a translation enhancer, an MCS multiple cloning site, a 3'-UTR sequence, and a T7 terminator sequence. The gene sequence of the pSY1A plasmid vector is shown in SEQ ID NO.1.
[0009] Furthermore, the 3'-UTR sequence contains polyadenylated deoxyribonucleic acid polyA.
[0010] Furthermore, the transcription module of the pSY1A plasmid vector consists of an EcoRV linearized restriction site, a T7 promoter sequence, a translation enhancer, a multiple cloning site sequence, a polyA sequence, a SmaI linearized restriction site, a 3'-UTR sequence, and a T7 terminator. The gene sequence of the transcription module is as follows:
[0011] cgggatatcgtctctcccgcgaaattaatacgactcactatagggctcacctatctctctacacaaaacatttcct
[0012] acatacaactttcaacttcctattatgggatccccggaattccgcgtcgacaagcttgcggccgcactcgagtga
[0013] aaaaaaaaaagagctcttggatccggccataaggttggatccggccataagggcctgatccttcgagggggg
[0014] gcccgggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggactg.
[0015] Furthermore, the PciI restriction sites and protective sequences of the transcription module gene sequence are as follows:
[0016] ctcacatgt;
[0017] The EcoRV restriction sites and protective sequences of the gene sequence of the transcription module are as follows:
[0018] cgggatatcgtctct.
[0019] Furthermore, the SmaI restriction site and protective sequence of the transcription module gene sequence are as follows:
[0020] cccgggatc;
[0021] The AatII restriction sites and protective sequences of the gene sequences of the transcription module are as follows:
[0022] ctggacgtcagg.
[0023] Furthermore, the Ori replicon initiates plasmid replication, and the Ori replication initiation sequence is as follows:
[0024] ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaccaccgctaccagcggtggtttgtttgcc
[0025] ggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttcta
[0026] gtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac
[0027] cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggc
[0028] gcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactg
[0029] agatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggt
[0030] aagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaa;
[0031] T7 promoter for in vitro transcription; the sequence of the T7 promoter is as follows:
[0032] TAATACGACTCACTATAGGG;
[0033] The 3'-UTR sequence is as follows, terminating the expression of exogenous genes in the wheat germ cell-free expression system; aaaaaaaaaagagctcttggatccggccataaggttggatccggccataagggcctgatccttcgagggggggcc.
[0034] Furthermore, the ampicillin resistance gene sequence is as follows, which produces an enzyme that breaks down ampicillin, enabling strains containing the corresponding plasmid to grow on ampicillin-containing culture media;
[0035] cgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgc
[0036] ttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc
[0037] cttcctgtttttgctcaccgaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggt
[0038] tacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagc
[0039] acttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcata
[0040] cactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaaga
[0041] gaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc
[0042] gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctga
[0043] atgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactatt
[0044] aactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggac
[0045] cacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcg
[0046] gtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa.
[0047] Furthermore, the translation enhancer gene sequence is as follows, which enhances the expression efficiency of the exogenous gene;
[0048] CTCACCTATCTCCTACACAAAACATTTCCCTACATACAACTTTCAA CTTCCTATT;
[0049] The MCS multiple cloning site sequence is as follows, consisting of multiple different restriction enzyme sites, used for the insertion of foreign gene fragments;
[0050] ggatccccggaattccgcgtcgacaagcttgcggccgcactcgag
[0051] The polyadenosine deoxynucleic acid (polyA) sequence is as follows, which maintains the stability of the exogenous gene.
[0052] aaaaaaaaaagagctc
[0053] The T7 terminator is as follows, which terminates the transcription of T7 RNA polymerase;
[0054] ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg.
[0055] The EcoRV / SmaI flathead enzyme linearization site is the restriction site of the linearized plasmid.
[0056] When sequencing the exogenous gene inserted into the plasmid, the T7 sequencing primer pair includes the 5' primer sequence that binds to the T7 promoter and the 3' primer sequence that binds to the T7 terminator.
[0057] A transformant comprising the pSY1A plasmid vector.
[0058] Application of a pSY1A plasmid vector in a bacterial strain.
[0059] Compared with the prior art, the beneficial effects of the present invention are:
[0060] The plasmids of this invention can link exogenous genes into vectors through restriction enzyme sites. The plasmid vectors can be repeatedly linearized for in vitro transcription and translation. When there are enough plasmids, the total experimental time is shorter and the reproducibility is better than that of two-step PCR. For some target genes with poor PCR results, the PCR primers can be optimized by adding restriction enzyme sites and protecting bases to reduce the difficulty of PCR experiments and obtain ideal experimental results. Attached Figure Description
[0061] Figure 1 A schematic diagram illustrating the route for constructing the pSY1A plasmid vector according to this invention;
[0062] Figure 2 This is a structural diagram of the pSY1A plasmid vector of the present invention;
[0063] Figure 3 The electrophoretic analysis results of the transcript samples collected in this invention; Detailed Implementation
[0064] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0065] Combination Figure 1and Figure 2 The following embodiments are provided:
[0066] Example 1: Construction of recombinant vector pSY1A
[0067] 1. Construction of recombinant vector pSY1A
[0068] 1.1 Experimental Procedure
[0069] The transcription component sequences were synthesized in their entirety by Sangon Biotech (Shanghai) Co., Ltd. The empty vector pUC19 was a commercially available empty vector purchased from Sangon Biotech (Shanghai) Co., Ltd.
[0070] The transcription component sequence was inserted into the pUC57 vector (provided by Sangon Biotech Co., Ltd.) to construct the transcription component vector. Based on the pUC57 vector and the transcription component sequence, 3' and 5' primers were designed, as follows:
[0071] 5' primer sequence: GAAGAGCGCCCAATACGCAAACC
[0072] 3' primer sequence: TTCCCCGAAAAGTGCCACCTGAC
[0073] Using the transcription component vector as a template, the transcription component sequence was amplified by PCR using 5' and 3' primers. The reagents used for PCR were purchased from Takara Bio Inc. The PCR reaction system is shown in Table 1 below:
[0074] Table 1. PCR reaction system for constructing recombinant vector pSY1A
[0075]
[0076]
[0077] The PCR procedure is shown in Table 2 below:
[0078] Table 2. PCR procedure for constructing recombinant vector pSY1A
[0079]
[0080] The PCR reaction products were analyzed by electrophoresis, and the target fragment was then recovered by gel extraction using the GeneJET gel extraction kit (Thermo Fisher). The specific operation steps were performed according to the kit's instructions.
[0081] The PCR products and pUC19 plasmid were digested stepwise using restriction endonucleases Aat II and Pci I, respectively. First, Aat II was used for digestion at 37°C for 15 min. The products were then analyzed by electrophoresis, and the target fragment was recovered using a GeneJET gel extraction kit (Thermo Fisher Scientific). The recovered sample was then digested with Pci I at 37°C for 1 h, and the products were analyzed by electrophoresis. The target fragment was then recovered again using a GeneJET gel extraction kit (Thermo Fisher Scientific).
[0082] The transcriptional component sequence obtained after enzyme digestion and gel recovery was ligated with the pUC19 fragment. The ligation reaction was carried out at a ratio of 100 ng of the target gene fragment and 50 ng of plasmid in a T4 DNA Ligase ligase system (Takara Bio Inc.) at 16℃ for 4 h. The ligation reaction solution was stored at -80℃ for later use. The reaction system is shown in Table 3 below.
[0083] Table 3 Connection Reaction System
[0084]
[0085] Example 2: Construction of the recombinant vector pSY1A
[0086] 2. Construction of the recombinant vector pSY1A
[0087] 2.1 Experimental Procedure
[0088] The transcription component sequences were synthesized in their entirety by Sangon Biotech (Shanghai) Co., Ltd. The empty vector pUC18 was a commercially available empty vector purchased from Sangon Biotech (Shanghai) Co., Ltd.
[0089] Using a vector containing the synthetic gene as a template, primers for the 3' and 5' ends were designed, with the sequences as follows:
[0090] 5' primer sequence: GAAGAGCGCCCAATACGCAAACC
[0091] 3' primer sequence: TTCCCCGAAAAGTGCCACCTGAC
[0092] Using the transcription component vector as a template, the transcription component sequence was amplified by PCR using 5' and 3' primers. The reagents used for PCR were purchased from Takara Bio Inc. The PCR reaction system is shown in Table 1 below:
[0093] Table 1. PCR reaction system for constructing recombinant vector pSY1A
[0094]
[0095]
[0096] The PCR procedure is shown in Table 2 below:
[0097] Table 2. PCR procedure for constructing recombinant vector pSY1A
[0098]
[0099] The PCR reaction products were analyzed by electrophoresis, and the target fragment was then recovered by gel extraction using the GeneJET gel extraction kit (Thermo Fisher). The specific operation steps were performed according to the kit's instructions.
[0100] The PCR products and pUC18 plasmid were digested stepwise using restriction endonucleases Aat II and Pci I, respectively. First, Aat II was used for digestion at 37°C for 15 min. The products were then analyzed by electrophoresis, and the target fragment was recovered using a GeneJET gel extraction kit (Thermo Fisher Scientific). The recovered sample was then digested with Pci I at 37°C for 1 h, and the products were analyzed by electrophoresis. The target fragment was then recovered again using a GeneJET gel extraction kit (Thermo Fisher Scientific).
[0101] The transcriptional component sequence obtained after enzyme digestion and gel recovery was ligated with the pUC18 fragment. The ligation reaction was carried out at a ratio of 100 ng of the target gene fragment and 50 ng of the plasmid in a T4 DNA Ligase ligase system (Takara Bio Inc.) at 16℃ for 4 h. The ligation reaction solution was stored at -80℃ for later use. The reaction system is shown in Table 3 below.
[0102] Table 3 Connection Reaction System
[0103]
[0104] Example 3: Transformation, extraction, and sequencing of recombinant vector plasmids
[0105] 3.1 Experimental Procedure
[0106] Take 2 μl of T4 ligase reaction solution and add it to 50 μl of E. coli competent cells. Place it on ice for 30 min, then place it in a 42°C water bath for 90 s heat shock, and immediately return it to ice for 2–5 min. Then add 300 μl of SOC liquid medium and incubate at 37°C and 200 rpm for 45 min on a shaker. Take 100 μl of the bacterial culture and spread it onto LB solid medium containing ampicillin. Incubate it upside down in a 37°C incubator overnight to obtain positive E. coli strains.
[0107] Six single colonies were picked and placed in 10 mL of LB broth containing ampicillin, and incubated overnight at 37°C. The next day, plasmids were extracted using the GeneJET plasmid miniprep kit (Thermo Fisher Scientific), and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing using T7 sequencing primers. Plasmids with correct sequences were selected for storage.
[0108] Example 4: Insertion of exogenous gene into plasmid vector
[0109] Using the pGL3 control plasmid vector as a template, the luciferase gene was amplified by PCR using LUC-3' and LUC-5' primers. All reagents used in the PCR were purchased from Takara Bio Inc.
[0110] The primer sequences are as follows:
[0111] LUC-5' primer sequence: CGGAATTCATGGAAGACGCCAAAAACAT
[0112] LUC-3' primer sequence: CCCTCGAGTTACACGGCGATCTTT
[0113] The PCR reaction system is shown in Table 4 below:
[0114] Table 4. PCR reaction system for exogenous gene insertion plasmid vector
[0115] Components Volume (μl) 10X PCR buffer 5 <![CDATA[25mMMg 2+ ]]> 5 2.5mMNTP 2 5' primer 0.5 3' primer 0.5 stencil 2 Taq enzyme 1 water 34 Total volume 50
[0116] The PCR procedure is shown in Table 5 below:
[0117] Table 5. PCR Procedure for Exogenous Gene Insertion Plasmid Vector
[0118]
[0119]
[0120] The PCR reaction products were analyzed by electrophoresis, and the target fragment was then recovered by gel extraction using the GeneJET gel extraction kit (Thermo Fisher). The specific operation steps were performed according to the kit's instructions.
[0121] The PCR product and pSY1A plasmid were double-digested with restriction endonucleases EcoRI and XhoI, respectively, at 37°C for 2.5 h. The products were analyzed by electrophoresis, and the target fragment was recovered from the gel using the GeneJET gel extraction kit (ThermoFisher).
[0122] The luciferase sequence obtained after enzyme digestion and gel recovery was ligated with the pSY1A fragment. The ligation reaction was carried out at a ratio of 100 ng of the target gene fragment and 50 ng of the plasmid in a T4 DNALigase ligase system (Takara Bio Inc.). The ligation reaction was carried out at 16℃ for 4 h. The ligation reaction solution can be directly used for E. coli transformation experiments.
[0123] Example 5: Transcription of plasmids containing exogenous genes
[0124] Take 5 μl (500 ng) of each plasmid containing the luciferase gene (pSY1A-LUC) and linearize them using restriction endonucleases EcoRV and SmaI, respectively. The linearization conditions are 37℃ (EcoRV) for 2.5 h and 30℃ (SmaI) for 2.5 h, respectively. The linearization reaction system is shown in Table 6 below:
[0125] Table 6 shows the linearization reaction systems of plasmids using restriction endonucleases EcoRV and SmaI, respectively.
[0126]
[0127]
[0128] Take 5 μl (500 ng) of the plasmid containing the luciferase gene (pSY1A-LUC), and linearize the plasmid using restriction endonucleases EcoRV and SmaI. The linearization conditions are 30℃ for 2.5 h. The linearization reaction system is as follows:
[0129] Table 7 shows the reaction system for linearizing plasmids using both restriction endonucleases EcoRV and SmaI.
[0130]
[0131] The three linearization reaction solutions were analyzed by electrophoresis, and the linearized plasmids were then recovered using the GeneJET gel recovery kit (ThermoFisher).
[0132] Using linearized plasmids as templates, in vitro transcription experiments were performed. Transcription reagents were purchased from Takara Bio Inc. The transcription conditions were 37℃ for 3 hours. The transcription system is shown in Table 8 below:
[0133] Table 8 Transcription System
[0134]
[0135]
[0136] Transcription samples were collected and analyzed by electrophoresis to confirm whether the samples contained the target gene. Results are as follows: Figure 3 As shown:
[0137]
[0138]
[0139]
[0140] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A pSY1A plasmid vector for a cell-free expression system in wheat embryos, characterized in that, The pSY1A plasmid vector gene sequence includes the ampicillin resistance gene, Ori replicon, T7 promoter, translation enhancer, MCS multiple cloning site, 3'-UTR sequence, T7 terminator sequence, and is shown in SEQ ID NO.
1.
2. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 1, characterized in that, The 3'-UTR sequence contains polyadenylated deoxyribonucleic acid (poly A).
3. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 1, characterized in that, The transcription module of the pSY1A plasmid vector consists of an EcoRV linearization restriction site, a T7 promoter sequence, a translation enhancer, a multiple cloning site sequence, a polyA sequence, a SmaI linearization restriction site, a 3'-UTR sequence, and a T7 terminator. The gene sequence of the transcription module is as follows: cgggatatcgtctctcccgcgaaattaatacgactcactatagggctcacctatctctctacacaaaacatttccctacatacaactttcaacttcctattatgggatccccggaattccgcgtcgacaagcttgcggccgcactcgagtgaaaaaaaaaagagctcttggatccgg ccataaggttggatccggccataagggcctgatccttcgagggggggcccgggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggactg.
4. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 3, characterized in that, The PciI restriction site and protective sequence of the pSY1A plasmid vector gene sequence shown in SEQ ID NO.1 are as follows: ctcacatgt; The EcoRV restriction sites and protective sequences of the gene sequence of the transcription module are as follows: cgggatatcgtctct.
5. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 3, characterized in that, The SmaI restriction sites and protective sequences of the gene sequences of the transcription module are as follows: cccgggatc; The AatII restriction site and protective sequence of the pSY1A plasmid vector gene sequence shown in SEQ ID NO.1 are as follows: ctggacgtcagg.
6. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 1, characterized in that, The Ori replicon initiates plasmid replication. The Ori replication initiation site sequence is as follows: ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaa; The T7 promoter initiates in vitro transcription, and the sequence of the T7 promoter is as follows: TAATACGACTCACTATAGGG; The 3'-UTR sequence is as follows: aaaaaaaaaagagctcttggatccggccataaggttggatccggccataagggcctgatccttcgagggggggcc.
7. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 1, characterized in that, The ampicillin resistance gene sequence is as follows: cgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa。 8. The pSY1A plasmid vector for a cell-free wheat embryo expression system as described in claim 2, characterized in that, The translation enhancer gene sequence is as follows: CTCACCTATCTCCTACACAAAACATTTCCCTACATACAACTTTCAACTTCCTATT; The MCS multiple cloning site sequence is as follows, consisting of multiple different restriction enzyme sites, used for the insertion of foreign gene fragments; ggatccccggaattccgcgtcgacaagcttgcggccgcactcgag The polyadenosine deoxynucleic acid (polyA) sequence is as follows: aaaaaaaaaagagctc The T7 terminator is as follows, which terminates the transcription of T7 RNA polymerase; ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg.
9. An Escherichia coli transformant comprising the pSY1A plasmid vector as described in claim 1.
Citation Information
Patent Citations
Method for expressing human fibroblast growth factor 21 through wheat germ cell-free protein synthesis system
CN113336839A
Escherichia coli-pseudomonas aeruginosa shuttle expression vector and construction method thereof
CN114525296A