Method for constructing recombinant virus vector based on iridovirus PCNA protein
By constructing a recombinant viral vector for the iridovirus PCNA protein, the problem of studying the function of the iridovirus PCNA protein was solved, and the stability of the plasmid in cells and the effect of inhibiting the host's antiviral immune response were achieved.
Patent Information
- Application Number
- CN202510993424.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-12-02
AI Technical Summary
The lack of recombinant viral vectors targeting the PCNA protein of iridoviruses in existing technologies makes it difficult to effectively study their function.
A recombinant viral vector based on the PCNA protein of iridovirus was constructed. The upstream and downstream fragments of the ORF068 gene were amplified and inserted into the pEGFP-N3 plasmid. After ligating the CMV-puro-GFP fragment, it was inserted into the pUC19 plasmid to form the recombinant viral vector.
A simple and easy-to-operate method for constructing plasmids is provided. The constructed plasmids exhibit stability in cells and can suppress the host's antiviral immune response.
Smart Images

Figure CN121046418A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering. This project aims to provide a recombinant viral vector for constructing iridoviruses that lack the PCNA gene. Technical Background
[0002] Iridoviruses are major pathogens of viral diseases in aquatic animals, seriously threatening the healthy growth of aquatic animals. Iridoviruses are a type of cytoplasmic DNA virus with more than 160 open reading frames in their genome. Proliferating cell nuclear antigen (PCNA) is an important cell cycle-related protein, named for its high expression in proliferating cells [1]. In recent years, virus-encoded PCNA-like proteins have been reported, which mainly function as DNA polymerase processing factors. However, functional studies of PCNA proteins in iridoviruses, especially grouper iridovirus and largemouth bass iridovirus, have not been reported. There are currently no recombinant viral vectors based on iridovirus PCNA proteins. To solve this problem, this patent provides a recombinant viral vector for constructing an iridovirus that lacks the gene encoding the PCNA protein. Summary of the Invention
[0003] The technical problem to be solved by the present invention is to provide a method for constructing a recombinant viral vector.
[0004] To solve the technical problem, the solution of the present invention is:
[0005] The present invention provides a method for constructing a recombinant viral vector based on the PCNA protein of iridovirus. Using iridovirus as a template, upstream and downstream fragments of the ORF068 gene are amplified. A puro gene fragment is cloned from the pLVX-Puro plasmid and inserted into the pEGFP-N3 plasmid to construct the pEGFP-puro-GFP vector. The upstream and downstream fragments of ORF068 and the CMV-puro-GFP fragment in the pEGFP-puro-GFP vector are ligated, and the ligated fragment is inserted into the pUC19 plasmid to construct the recombinant viral vector.
[0006] 9. The method according to claim 1, wherein the upstream and downstream fragments of the ORF068 gene are approximately 500 bp fragments upstream and downstream of the ORF068 gene.
[0007] The amplification primers for the upstream and downstream fragments of the ORF068 gene are: F3: gcctgcaggtcgactTGATCCCCCACACCCAAGAG, R3: CTCACCATTATTCAGTTGACACTGCCCCACAA; and the primers for the downstream fragment are: F4: TGCCTGATTCTGACTTTTGGTAAATTATTACCCACAAACAATG, R4: caggaattcgagctGAGCACGCAGTCAGACGC.
[0008] The cloned puro gene fragment was amplified using primers F5: GCTAGCGCTACCGGACTCAGAATGACCGAGTACAAGCCCAC and R5: CACCATGGTGGCGATGGCACCGGGCTTGCG, with pLVX-Puro plasmid as a template.
[0009] The iridovirus mentioned is a fish iridovirus.
[0010] The iridoviruses mentioned are grouper iridovirus and / or largemouth bass iridovirus.
[0011] A recombinant viral vector constructed according to the above method.
[0012] The above-mentioned recombinant viral vector is used in the preparation of agents that inhibit the host's antiviral immune response.
[0013] The beneficial effects of this invention are:
[0014] The plasmid construction method provided by this invention is simple and highly operable; the constructed plasmids exhibit strong stability in cells. Attached Figure Description
[0015] Figure 1 In this invention, ORF068 negatively regulates the STING-induced immune response in grouper.
[0016] Figure 2 This is an electrophoresis diagram of the upstream fragment 68u, the downstream fragment 68D, and the selection marker gene fragment CMV-puro-EGFP (68CPE) of ORF068 in this invention.
[0017] Figure 3 This is an electrophoresis image of the pUC19-Δ68 plasmid constructed in this invention.
[0018] Figure 4 This is a fluorescence image showing whether the recombinant viral plasmid pUC19-Δ68 was transfected into grouper spleen cells and whether or not SGIV was infected. Detailed Implementation
[0019] The technical features of the technical solution provided by the present invention will be further clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0020] Example 1: Preparation of SGIV
[0021] The grouper iridovirus was isolated by the Aquatic Animal Medicine Laboratory of South China Agricultural University and stored at -80℃. One day before the experiment, grouper spleen (GS) cells were transferred to a 25cm specimen. 2 The cells were cultured in culture flasks. When the cells adhered and were in the logarithmic growth phase, SGIV was added to the culture system at a multiplicity of infection (MOI) of 0.1, and then the flasks were incubated. When the vast majority of cells showed obvious CPE (cytopathic effect), the culture flasks were placed at -80°C and subjected to three freeze-thaw cycles to allow the SGIV virus particles to be completely released from the host cells. The culture medium was then aliquoted and stored at -80°C to obtain the SGIV virus solution.
[0022] Example 2: Effects of SGIV ORF068 on the host's antiviral immune response
[0023] Based on the EST sequence information of the grouper transcriptome, primers F1-R1 (F1: TACGCATCAGCGGAAATGCAGTGCCTCCAAGATCAG; R1: gatatctgcagaattTATTCTTCCTTGATAATGGTCGGTGCT) were designed to amplify the STING open reading frame. Using the grouper genome as a template, the grouper STING open reading frame was amplified by PCR and the fragment was purified, following the reaction system and procedure in Table 2. Based on the SIGV ORF068 sequence information, primers F2-R2 (F2: TACGCATCAGCGGAAATGGCGGTATATAAAAATTCCCATTTTTGGAAG; R2: gatatctgcagaattTGATACATTCAAAGTCCTATTTTCGGTACGT) were designed to amplify the ORF068 open reading frame. Using SGIV virus solution as a template, the ORF068 open reading frame was amplified by PCR and the fragment was purified, following the reaction system and procedure in Table 2. Following the instructions for the TAKARA rapid digestion enzyme, the pcDNA3.1-3×HA plasmid (HZbscience) was double-digested, as shown in Table 3. Then, following the instructions for the ligase (Vazyme, C112), the ORF068 and STING fragments were inserted into the pcDNA3.1-3×HA plasmid to construct the pHA-VP068 and pHA-EcSTING vectors, respectively.
[0024] GS cells were transferred to 24-well plates for culture, with approximately 1 × 10⁶ cells seeded per well. 6 Once the cells have grown to a monolayer and adhered to the culture medium, discard the original medium (Leibovitz L-15 medium containing 10% fetal bovine serum) and replace it with serum-free Leibovitz L-15 medium. Following the instructions for use of Lipo 2000 (Thermo Fisher, 11668019) and Opti-MEM (Gibico, 31985088), transfect each well of a 24-well plate with 1 μg of pHA-EcSTING or 1 μg of both pHA-EcSTING and pHA-VP068 vector, as per the transfection system in Table 4. Simultaneously transfect the plasmids required for dual-luciferase activity assay: pIFN1 (Promega), pISRE (Promega), and pSV40 (Promega). After the vectors have fully expressed, collect the samples. Following the instructions of the Dual-Luciferase Reporter Gene Therapy Kit (Promega) and Cell RNA Extraction Kit (FOREGNE), the effect of pHA-VP068 on the pHA-STING-induced immune response was determined. Results are as follows: Figure 1As shown, overexpression of VP068 significantly inhibits STING-mediated interferon promoter activity and the transcriptional level of interferon-related genes.
[0025] Example 3: Amplification of upstream and downstream fragments of SGIV ORF068
[0026] Based on the SGIV whole genome sequence information, primers F3-R3 (approximately 500 bp upstream of ORF068) and primers F4-R4 (approximately 500 bp downstream of ORF068) were designed for amplification (Table 1). Using SGIV viral solution as a template, the upstream and downstream fragments of ORF068 were amplified by PCR according to the reaction system and procedure in Table 2, and the fragments were purified. Successful amplification was confirmed by agarose gel electrophoresis. Results are as follows: Figure 2 As shown, the upstream and downstream fragments of ORF068 were amplified by agarose gel electrophoresis, and their sizes were as expected.
[0027] Table 1 PCR amplification primers
[0028]
[0029]
[0030] Table 2 PCR reaction system and reaction procedure
[0031]
[0032] Example 4: Construction of the pEGFP-puro-EGFP vector
[0033] Based on the sequence information of the pLVX-Puro plasmid (Shanghai Zeye Biotechnology Co., Ltd.), primers F5-R5 (F5: GCTAGCGCTACCGGACTCAGAATGACCGAGTACAAGCCCAC, R5: CACCATGGTGGCGATGGCACCGGGCTTGCG) were designed for the puro gene. The puro gene was amplified according to the PCR reaction system and procedure in Table 2. Following the instructions for the TAKARA rapid digestion enzyme, the pEGFP-N3 plasmid was double-digested, as shown in Table 3. The puro fragment and the digested pEGFP-N3 were purified using a fragment purification kit (Omega, D6492). Following the instructions for the ligase (Vazyme, C112), the puro fragment was inserted into the pEGFP-N3 plasmid through the XhoI-BamHI restriction site to construct the pEGFP-puro-EGFP vector.
[0034] Table 3. Double enzyme digestion system and ligation system
[0035]
[0036]
[0037] Example 5 Construction of Recombinant Vector
[0038] Based on the constructed pEGFP-puro-GFP vector sequence, primers F6-R6 (F6: AGGCGGTGCCATATATGGAGTTCCGCGTTACATAACT, R6: TGCCAGACATCTTGTACAGCTCGTCCATGCC) were designed to amplify the CMV-puro-EGFP (CPE) fragment in the vector. The amplified CMV-puro-EGFP fragment was then analyzed by agarose gel electrophoresis as follows: Figure 2 As shown, the fragment size is approximately 2000 bp. Referring to the double digestion system in Table 3, the pUC19 plasmid was first double-digested at the HindIII-EcoRI site and purified for later use. Referring to the ligation system in Table 3, the upstream and downstream fragments of ORF068 and the CMV-puro-EGFP fragment were ligated in the following order: up-fragment + CMV-puro-EGFP + down-fragment. Referring to the ligation system in Table 3, the ligated recombinant fragment was inserted into the pUC19 plasmid through HindIII-EcoRI to construct the recombinant viral vector pUC19-Δ68. The results were analyzed by agarose gel electrophoresis (…). Figure 3 The recombinant viral vector pUC19-Δ68 was successfully constructed.
[0039] Example 6: Expression of the recombinant vector in host cells
[0040] GS cells were transferred to 24-well plates for culture, with approximately 1 × 10⁶ cells seeded per well. 6 Once the cells have grown to a monolayer and adhered to the plate, discard the original culture medium (Leibovitz L-15 medium containing 10% fetal bovine serum) and replace it with serum-free Leibovitz L-15 medium. Following the instructions for use of Lipo 2000 (thermo fisher, 11668019) and Opti-MEM (Gibico, 31985088), transfect 1 μg of the recombinant viral vector pUC19-Δ68 into each well of a 24-well plate according to the transfection system in Table 4.
[0041] After the recombinant vector was fully expressed, SGIV (prepared in Example 1) was added to 24-well plates at an MOI of 1, with an equal volume of culture medium used as a control. After culturing for another 24 hours, the fluorescence expression of the recombinant viral vector was observed using a fluorescence microscope. The results are as follows: Figure 4As shown, after transfection with the recombinant viral vector pUC19-Δ68 and subsequent viral infection, green fluorescence was observed under a fluorescence microscope. The cells also developed pathological changes due to viral infection, and the diseased cells overlapped with the green fluorescent cells, indicating that viral recombination may have occurred.
[0042] Table 4 Transfection System
[0043]
[0044] 1. Upstream fragment of ORF068
[0045] TGATCCCCACCCAAGAGGGAGACGCGATGGTCTCCGTCATAAATGGAAAACGCGCAGTCGTGAAAGCCGTCCCCACCAAAACTGACCACGGCGGTGGATGCCGATTTACTGGCCGCCCTGCAAGAACCCGTATACCCGCCAGAAGAAGTCA TGGAAGTGGATAGAATGCCCGTTATACCCGAAGAAGTTGACTACAAGGCCGATCTTTACAAAAAACCAAAATGGACTCTAGAACCCACTCTCATAGACAAGCTAAACGAATATCTCGACACCAGAATTGTGGGGCAGTGTCAACTGAATA(SEQ ID NO.1)
[0046] 2. Downstream fragments of ORF068
[0047] TTCTGACTTTTGGTAAATTATTACCCACAAACAATGGCATTGCCGTTTCTGATCAGCGTCTCTGGAAACATTGGTGCCGGAAAATCGTCTTTGTTGGCCGCGCTGGCCAAGCGAGGTTATTACGTACAACCCGAAGATTTTACCAAGTGGGGC CCGCTCTTTAACCTTGCGCTAGCCGAGCCAAAACGGTACAAGTTTTCGAGCCAGTTAAAGATTCTAATGGTGCAGATGGATCTGCAGAGGGAGCACCGAAACGGAACTCGCCCGCTGGTCATTTTAGAGAGGGCGTCTGACTGCGTGCTC(SEQ ID NO.2)
[0048] 3. CMV-puro-EGFP fragment sequence
[0049]
Claims
1. A method for constructing a recombinant viral vector based on the PCNA protein of iridovirus, characterized in that, Using iridovirus as a template, upstream and downstream fragments of the ORF068 gene were amplified. The puro gene fragment was cloned from the pLVX-Puro plasmid and inserted into the pEGFP-N3 plasmid to construct the pEGFP-puro-GFP vector. The upstream and downstream fragments of ORF068 and the CMV-puro-GFP fragment in the pEGFP-puro-GFP vector were ligated respectively. The ligated fragment was then inserted into the pUC19 plasmid to construct a recombinant viral vector.
2. The method according to claim 1, characterized in that, The upstream and downstream fragments of the ORF068 gene are approximately 500 bp segments upstream and downstream of the ORF068 gene.
3. The method according to claim 1, characterized in that, The amplification primers for the upstream and downstream fragments of the ORF068 gene are: F3: gcctgcaggtcgactTGATCCCCCACACCCAAGAG, R3: CTCACCATTATTCAGTTGACACTGCCCCACAA; and the primers for the downstream fragment are: F4: TGCCTGATTCTGACTTTTGGTAAATTATTACCCACAAACAATG, R4: caggaattcgagctGAGCACGCAGTCAGACGC.
4. The method according to claim 1, characterized in that, The cloned puro gene fragment was amplified using primers F5: GCTAGCGCTACCGGACTCAGAATGACCGAGTACAAGCCCAC and R5: CACCATGGTGGCGATGGCACCGGGCTTGCG, with pLVX-Puro plasmid as a template.
5. The method according to claim 1, characterized in that, The iridovirus mentioned is a fish iridovirus.
6. The method according to claim 5, characterized in that, The iridoviruses mentioned are grouper iridovirus and / or largemouth bass iridovirus.
7. A recombinant viral vector constructed according to any one of claims 1-6.
8. The use of the recombinant viral vector according to claim 7 in the preparation of a formulation that inhibits the host's antiviral immune response.